ID: 1089695485

View in Genome Browser
Species Human (GRCh38)
Location 11:120213565-120213587
Sequence CTCCAACTCCACCCCGTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 250}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089695485_1089695487 -10 Left 1089695485 11:120213565-120213587 CCTAGGACGGGGTGGAGTTGGAG 0: 1
1: 0
2: 3
3: 22
4: 250
Right 1089695487 11:120213578-120213600 GGAGTTGGAGAGTGCAGTGTGGG 0: 1
1: 0
2: 0
3: 30
4: 422
1089695485_1089695489 -8 Left 1089695485 11:120213565-120213587 CCTAGGACGGGGTGGAGTTGGAG 0: 1
1: 0
2: 3
3: 22
4: 250
Right 1089695489 11:120213580-120213602 AGTTGGAGAGTGCAGTGTGGGGG 0: 1
1: 0
2: 0
3: 30
4: 398
1089695485_1089695490 16 Left 1089695485 11:120213565-120213587 CCTAGGACGGGGTGGAGTTGGAG 0: 1
1: 0
2: 3
3: 22
4: 250
Right 1089695490 11:120213604-120213626 GAATAGCCTTACCCTCACCCAGG 0: 1
1: 0
2: 0
3: 5
4: 94
1089695485_1089695488 -9 Left 1089695485 11:120213565-120213587 CCTAGGACGGGGTGGAGTTGGAG 0: 1
1: 0
2: 3
3: 22
4: 250
Right 1089695488 11:120213579-120213601 GAGTTGGAGAGTGCAGTGTGGGG 0: 1
1: 0
2: 10
3: 166
4: 2261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089695485 Original CRISPR CTCCAACTCCACCCCGTCCT AGG (reversed) Intronic
900395888 1:2453093-2453115 CACCACCTCCACCCAGGCCTGGG + Intronic
901790339 1:11650539-11650561 CTCCTCCTCCACGCCGCCCTCGG + Exonic
902274689 1:15330968-15330990 CTCCATCCCCACCCTGCCCTAGG - Intronic
902810128 1:18883339-18883361 CTCCAGCTCCACCGCATACTTGG + Exonic
902911047 1:19597314-19597336 CTGCAACTCCACCCCGCACCCGG - Intronic
902927469 1:19705709-19705731 CTCCTACACCATCCCGTTCTAGG - Intronic
903380994 1:22896746-22896768 CCCCGACCCCACCCCATCCTGGG + Intronic
903446389 1:23424927-23424949 CTCCAACTCCGGCCCTTCCAGGG + Intergenic
903607216 1:24583830-24583852 CTCCTACTCCAAACCGTCCTCGG - Intronic
903937639 1:26907564-26907586 CATTAACTCCACCCTGTCCTTGG - Intronic
904715880 1:32467325-32467347 CTCCGCCTCCACCGCCTCCTGGG + Intronic
904830957 1:33306662-33306684 CTCCCACTCCACACCTTCCCGGG + Intergenic
905181286 1:36168601-36168623 CACCAACTCCACCAACTCCTAGG - Intronic
906052833 1:42888618-42888640 CTACAGCTCCAGCCCCTCCTGGG + Intergenic
908580485 1:65510968-65510990 CTCCCACTGCACCCCACCCTGGG + Intronic
908683528 1:66689202-66689224 CTCCACCTCCACCTCCTCCCCGG + Exonic
909643028 1:77888317-77888339 CTCCACCTCCAGCCAGGCCTGGG - Intergenic
910369018 1:86496549-86496571 ATCAATCTCCACCCTGTCCTGGG + Intronic
910724748 1:90327138-90327160 ATCAAACACCACCCCTTCCTGGG + Intergenic
911244179 1:95498693-95498715 CTCCAACTCCAAACCTGCCTGGG + Intergenic
912386044 1:109271701-109271723 CACCAAGTCCACCCTGACCTCGG + Exonic
912402583 1:109407679-109407701 CTCCAGCTGCACTCCATCCTGGG - Intronic
915466715 1:156102622-156102644 CTCCATTTCCAGCCCCTCCTGGG + Intronic
915719883 1:157977167-157977189 CTCCAACCCCACCCCTTACAGGG - Intergenic
916096651 1:161357439-161357461 CGCCAACTGCACCCCAGCCTGGG - Intronic
916204776 1:162305795-162305817 CTCCAACTCCACTATGACCTAGG - Intronic
917494683 1:175529545-175529567 CTGCAACACCTCCCAGTCCTGGG - Intronic
918216344 1:182394645-182394667 CTCCCACTCCACCCACCCCTTGG - Intergenic
918244413 1:182646368-182646390 CACCACCTCCACACCCTCCTCGG - Intronic
918395933 1:184112939-184112961 CTCCAACTCCACTCCCTACTGGG + Intergenic
919972202 1:202588318-202588340 CCCCAACCCCACCCCATCCCAGG - Exonic
921269783 1:213457262-213457284 TTCCAGCTCCACGCCATCCTCGG + Intergenic
921382265 1:214536154-214536176 CCCCCACCCCACCCCGGCCTTGG - Intronic
922574809 1:226654618-226654640 CCCCACCTCCAGCCCATCCTTGG + Intronic
923130357 1:231069603-231069625 CTCCAGCTCCTCCGCTTCCTGGG + Intergenic
923617224 1:235547992-235548014 CTGCAACTCCACCCCCAACTTGG - Exonic
1067015740 10:42755304-42755326 CTCCCACCCCACGCCGTCCCCGG - Intergenic
1069653515 10:70069841-70069863 CTCCAACTCTATTCCGTCTTGGG - Intronic
1069727678 10:70591601-70591623 CTCCACCTCCACCTTCTCCTGGG + Intergenic
1070641403 10:78173016-78173038 CTCCAACTCCTGCCAGTCATGGG - Intergenic
1070743436 10:78917783-78917805 CTCCAACTACACCCAGTCACGGG + Intergenic
1073945059 10:108740833-108740855 CTCCACCTCCACCCCTTGCCAGG - Intergenic
1074724997 10:116299363-116299385 TCCCAACTCCATCCCCTCCTTGG + Intergenic
1074765021 10:116694326-116694348 CTCCAACTCCAGCCAGCCCCTGG + Intronic
1076447657 10:130528687-130528709 CTCCACCTCCAGCCCGACGTGGG - Intergenic
1077431358 11:2517419-2517441 CCCCAAATCCAACCCGTCCCAGG - Intronic
1077471452 11:2762802-2762824 CCCCCACCCCACCCCGTCCACGG + Intronic
1078627495 11:12970922-12970944 CTCCAACCCCACCCCAGCCAAGG + Intergenic
1081462115 11:43281491-43281513 CTCCAGCTCCTCCCCTTCTTCGG + Intergenic
1082847869 11:57741085-57741107 CTCCAACTCTTGCCAGTCCTGGG - Intronic
1084040402 11:66539405-66539427 GGACAACTCCACCCCTTCCTTGG - Exonic
1084123304 11:67082194-67082216 CTCCAGCTCCACCCCTTCTCTGG - Intergenic
1084310456 11:68313244-68313266 CTGCAACTTCAGCCCGTCCTCGG - Intronic
1084394256 11:68898489-68898511 CTCCACCTCCACCTCCTCCTAGG + Intronic
1084573596 11:69975015-69975037 CTCCAGCTCCAGCCCCTCCCAGG - Intergenic
1087172781 11:95067447-95067469 GTCCAGCTCCGCCCCGTCCATGG - Exonic
1089107968 11:116030912-116030934 CTCCCATTCCACCCCCTCCAGGG + Intergenic
1089695485 11:120213565-120213587 CTCCAACTCCACCCCGTCCTAGG - Intronic
1090458938 11:126872668-126872690 CTCCTATCCCACCCCATCCTGGG + Intronic
1093260089 12:16925250-16925272 CTCCCACCCCACTCCGTCCATGG - Intergenic
1097175921 12:57142917-57142939 TTCCCACTCCACCCCCACCTAGG - Intronic
1097946309 12:65372536-65372558 CACCAACTCCACACAATCCTAGG - Intronic
1099693747 12:85993297-85993319 TTCCAACTCCTCCCCATCCCTGG - Intronic
1100632025 12:96399572-96399594 CTCCAGCTCCACCCCCGCCGAGG + Intronic
1102506724 12:113388702-113388724 TTCTAACTCCAGCCCCTCCTGGG + Exonic
1106328888 13:28720455-28720477 CTGCAACTGCACTCCGGCCTGGG - Intergenic
1107961688 13:45564761-45564783 CCCCCACTCCACCCATTCCTTGG - Intronic
1113426252 13:110210867-110210889 CTACAACTCCACCCCTTCTCTGG + Intronic
1113449681 13:110398795-110398817 CTCCAACTCCACCCTGCCTCTGG - Intronic
1114466107 14:22923980-22924002 CTCCACCTACACCCCAACCTGGG + Intronic
1117426627 14:55605317-55605339 CTCCAACTGCACTCCAGCCTGGG - Intronic
1119217399 14:72879614-72879636 CTCCACCTCCACCCTGTCCCTGG - Intronic
1119611807 14:76069794-76069816 CTACAACTCCACTCAGTCTTGGG - Intronic
1121789876 14:96690985-96691007 CTCCAATACCTCCCAGTCCTAGG + Intergenic
1122631573 14:103109694-103109716 CTCCCTCTCCACCCTGTCCCTGG + Intronic
1122906786 14:104805294-104805316 CACCATCCCCACCCTGTCCTGGG - Intergenic
1123054187 14:105561525-105561547 CTCCACTTCCAGCCTGTCCTGGG + Intergenic
1123078771 14:105681944-105681966 CTCCACTTCCAGCCGGTCCTGGG + Intergenic
1126872152 15:53001482-53001504 CTCCATCTCCTCCCAGTCCAGGG - Intergenic
1128099938 15:64990089-64990111 CTCCACCTCCTCCTCCTCCTAGG - Intronic
1128841399 15:70853993-70854015 CTCCAACTCGTCCACGTCCTCGG + Exonic
1130040828 15:80404308-80404330 CTCCTCCTCCTCCCCCTCCTCGG - Intergenic
1131188631 15:90295204-90295226 CTTCATCTCCTCCCGGTCCTGGG - Exonic
1132584200 16:699243-699265 CTCCCACTCCACCCTGTGCGTGG - Intronic
1132589055 16:718413-718435 CTCCACCCCCACCCCGGCCCAGG - Exonic
1133056968 16:3150212-3150234 CCCCACCTCCACCCCGCGCTGGG + Intergenic
1133508818 16:6438370-6438392 GTCCAACTCCACCACTTCTTAGG - Intronic
1133743095 16:8666202-8666224 CACCAACTACTCCCCGTCATTGG - Intergenic
1134140688 16:11715636-11715658 CTACAGCTCCACACCGTGCTTGG - Intronic
1135333382 16:21580475-21580497 ATCCCACTGCACCCCGGCCTGGG + Intergenic
1135607259 16:23835740-23835762 CCCCCACCCCACCCCGTCCTCGG - Intergenic
1136242156 16:28951211-28951233 CTCCACCTCAACCTCGTCCGCGG - Exonic
1137408289 16:48207205-48207227 CCCCAACCTCACCCCCTCCTGGG - Intronic
1138237676 16:55398771-55398793 CTCCCTGTCCAACCCGTCCTCGG - Intronic
1138515610 16:57534152-57534174 CCCCAACCCCACCCCCACCTGGG + Intronic
1140162720 16:72515185-72515207 CTCCAGCTCCACCCCCTACAGGG + Intergenic
1140503180 16:75452490-75452512 CTCCCACTGCACTCCATCCTGGG - Intronic
1141153987 16:81584093-81584115 CTCCAACTCCACTTCTCCCTTGG - Intronic
1141788379 16:86216801-86216823 CTGCAACCACACCCTGTCCTGGG + Intergenic
1142933546 17:3308814-3308836 CTCCAACTCCACCCCTTCCCTGG + Intergenic
1143152595 17:4816711-4816733 GTCCAGCTGCACCCAGTCCTTGG - Exonic
1145907358 17:28523865-28523887 CTCCACCCCAACCCCATCCTTGG - Intronic
1147167254 17:38600265-38600287 CTACATATCTACCCCGTCCTGGG - Intronic
1148601263 17:48895802-48895824 CTGCAACTCCACACCATTCTTGG + Exonic
1148852920 17:50563365-50563387 CTCCATCTCCATCCCTGCCTGGG - Intronic
1148904362 17:50902520-50902542 CTGCAACTGCACCCCAGCCTGGG + Intergenic
1150123145 17:62619756-62619778 CACCACCTCCACCCTGTCCCAGG - Intergenic
1150184899 17:63170085-63170107 CTCCAACTGCACTCCAGCCTGGG + Intronic
1151398505 17:73840636-73840658 CTCCACCCCCACCCCAGCCTCGG - Intergenic
1151612144 17:75183083-75183105 GTCCCACGCCACCGCGTCCTGGG + Intergenic
1151833226 17:76568103-76568125 CTCCAACTGCTCCCTGCCCTGGG + Intronic
1151940367 17:77288117-77288139 CTCCTACCCCACCCCGGCCTGGG + Intronic
1152069146 17:78126546-78126568 CTGCAGCTCCAGCCCCTCCTGGG + Exonic
1152888291 17:82865376-82865398 CTCCACATCCACCCCATCGTGGG + Intronic
1153403472 18:4707436-4707458 CTCCAACTGCACTCCAGCCTGGG + Intergenic
1154021166 18:10665145-10665167 CTCCAGCTCCACCCTGTCCTGGG - Intergenic
1155960930 18:31994125-31994147 CTCCATGTCCACCTCATCCTTGG - Intergenic
1157488428 18:48106117-48106139 CCCAAACTCCACCCTGGCCTTGG + Intronic
1158884691 18:61816002-61816024 CTCCTCCTCCACCGCCTCCTGGG + Exonic
1161439001 19:4279970-4279992 CTCCACCTCCTCCTCCTCCTTGG + Exonic
1161958482 19:7509287-7509309 CTCGGACTCCTCCACGTCCTGGG + Intronic
1161988205 19:7669342-7669364 CTCCTCCTCCTCCCTGTCCTGGG + Exonic
1162054302 19:8053440-8053462 CTCCAACCCCACCCCTGGCTCGG - Intronic
1162481130 19:10927814-10927836 CTCCTCCTCCACCTCATCCTCGG + Exonic
1162797624 19:13095050-13095072 CTCCACCCTCACCCCTTCCTAGG + Exonic
1163158527 19:15451844-15451866 CTCCAAGACCCCCGCGTCCTTGG + Exonic
1163366295 19:16877821-16877843 CTCCTACACCTCACCGTCCTGGG - Intronic
1164686326 19:30168913-30168935 CTCCCACTCCACCCCTAGCTGGG + Intergenic
1165066806 19:33234341-33234363 CTGCACCCCCACCCTGTCCTGGG + Intergenic
1165324687 19:35107650-35107672 CTCCCACTCCACCCCCTTCCAGG + Intergenic
1165939440 19:39407844-39407866 CTCCGACTCCAGCCCGTCTGGGG + Exonic
1166982467 19:46639339-46639361 CCCCACCTCCACCTCTTCCTAGG - Intergenic
1167430335 19:49450631-49450653 CTCCAACTCCTTTCTGTCCTAGG + Intronic
1167464739 19:49644861-49644883 CTCCCACTCCACCCTGTGCTTGG - Intronic
1167668406 19:50836218-50836240 CTTCACCTCCACCGCGGCCTGGG + Intronic
1167684745 19:50949553-50949575 CCCCAAATCCAACCCATCCTTGG + Intronic
1167840234 19:52110848-52110870 CTCCAGCTCCACCTCAGCCTTGG + Intergenic
1168120890 19:54252060-54252082 ATCCATCTCCACCCCGTCCTTGG + Exonic
1168136644 19:54356311-54356333 CTGGACCTCCACCCAGTCCTCGG - Intronic
929048088 2:37810336-37810358 ATCCAACTGCAGCCCGTACTTGG + Intergenic
929762339 2:44816546-44816568 CTCCACATTTACCCCGTCCTTGG - Intergenic
929763584 2:44826007-44826029 ATCCAGCCCCACCCCTTCCTAGG + Intergenic
930492032 2:52086215-52086237 CCCCACCTCCTTCCCGTCCTTGG - Intergenic
931365758 2:61617428-61617450 CTCCAGCTCCATTCTGTCCTAGG + Intergenic
931606924 2:64061836-64061858 CTCCCACTGCACCCCAGCCTGGG + Intergenic
932160593 2:69455935-69455957 CAACTACTCCACCCTGTCCTTGG + Intergenic
932385932 2:71332323-71332345 CTCAAACTCCACCGCCTCTTCGG - Intronic
933860810 2:86465436-86465458 CTGCAACTGCACTCCCTCCTGGG - Intronic
934093823 2:88579588-88579610 CTCCAAAGCCACCACGTCCCAGG + Exonic
936270105 2:111042726-111042748 CTCCAACTCCTTCCCTTCCTTGG - Intronic
936553162 2:113468356-113468378 CTGCAATTCCACCCCCACCTTGG + Intronic
938073475 2:128319999-128320021 CTCCCCCCCCACCCCGTCCCCGG - Intergenic
945122927 2:206476618-206476640 CCCCCACTCCACCCCATCCGTGG + Intronic
946029295 2:216692213-216692235 CTCCGACTCCACCCCGCCGAAGG - Intronic
946029980 2:216695818-216695840 CTCCACCTCCTCCCCATTCTCGG - Intergenic
946365370 2:219245673-219245695 CTCCAACCCCAGCCCATCTTTGG - Intronic
946386094 2:219385451-219385473 CTCCATCTCCACTATGTCCTTGG + Exonic
946407142 2:219497828-219497850 CTCGATGTCCTCCCCGTCCTTGG - Intronic
946774870 2:223127142-223127164 CTCCACCTCCTCCTCCTCCTTGG + Intronic
946787448 2:223262709-223262731 CTCGAACTCCTCACCCTCCTCGG + Intergenic
947384270 2:229575634-229575656 CTCCAACACCACCGCAGCCTGGG + Intronic
948464946 2:238147840-238147862 CTCCACCTCCACCACGTCCAGGG - Exonic
1170359029 20:15524260-15524282 CTCCAACTCCAGCCCTTTCAGGG + Intronic
1171955952 20:31463923-31463945 TTCCAGCTCCACCACTTCCTAGG + Intergenic
1172181111 20:33004190-33004212 CTGCCCCTCCACCCTGTCCTTGG - Intronic
1172606346 20:36216784-36216806 CTCCAGCCCCACCCCAGCCTGGG - Intronic
1172787040 20:37475244-37475266 CTCCATCTCCACCCTTTCCCTGG + Intergenic
1172790509 20:37502104-37502126 CTCCAGCTCCACCTGGTCCTGGG + Intronic
1174048374 20:47749856-47749878 CTCTAAGTCCACCCAGGCCTGGG + Intronic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1175215667 20:57390688-57390710 TTCCAGCTCCACCCCGTTCTGGG - Intergenic
1175336050 20:58197082-58197104 CTCCCACTCCACCCCGTCACCGG + Intergenic
1175336083 20:58197175-58197197 CTCCCACTCCGCCCCGTCACCGG + Intergenic
1175501295 20:59452947-59452969 CTCCAGCTGCACCCTGCCCTCGG - Intergenic
1175822757 20:61919314-61919336 ATCCAACTCCACCCCATCTCCGG - Intronic
1175977481 20:62718334-62718356 CTCCACCCCCACCCTGGCCTAGG - Intronic
1176110014 20:63406883-63406905 GTCCATCTCCATCCCGTCCGTGG - Exonic
1177593226 21:23201020-23201042 ATGCAACTCCACCCCAGCCTGGG + Intergenic
1180075485 21:45459498-45459520 CGCCCCCTCCACCTCGTCCTGGG + Intronic
1181697256 22:24600016-24600038 CTCCACCCCCATCCCCTCCTTGG + Intronic
1181728567 22:24828178-24828200 CTCCAGCCCCACCCAGTACTGGG - Intronic
1182355922 22:29722184-29722206 CCCCAACTCCAGCCCTTTCTGGG + Intronic
1182412273 22:30197163-30197185 ATCCAACCCCACCCTGTCCCTGG - Intergenic
1183702262 22:39457338-39457360 CCCCACTTCCACCCCGTCCCGGG - Exonic
1184679299 22:46061743-46061765 CTCCGACCCGACCCCGGCCTGGG + Intronic
1185220320 22:49626382-49626404 CCCCAACCCCACCCCACCCTGGG + Intronic
951410307 3:22356139-22356161 TTCCACCTCCACACAGTCCTTGG - Intronic
952277779 3:31894196-31894218 CTCCAACTCCGACCGCTCCTGGG - Intronic
954380926 3:50218587-50218609 CTCCGACTCCACCCCGTCTGTGG - Exonic
955628842 3:60950521-60950543 CTCCATCTCCACTCCAGCCTGGG - Intronic
956505092 3:69929382-69929404 CTCCCACTCCACCCCACCCCAGG - Intronic
968094531 3:195918995-195919017 CTGCCACTGCACCCCGGCCTGGG + Intergenic
968810496 4:2797614-2797636 CCCCAACTCCACCCTGAGCTGGG + Intronic
968885848 4:3331792-3331814 CTCGGAGTCCACCCAGTCCTGGG + Intronic
969151066 4:5168926-5168948 CTTTCACTCCAACCCGTCCTTGG + Intronic
969196275 4:5566299-5566321 CTCCATCTCCACCACCACCTGGG - Intronic
970008044 4:11428927-11428949 CTCCCGCTCCTCCCCCTCCTCGG - Exonic
975410123 4:74039007-74039029 CTCCAACCCTACCCCGTACGCGG - Intergenic
976269504 4:83217105-83217127 CTCCCACTGCACCCAGGCCTTGG - Intergenic
977055202 4:92182775-92182797 TTCCAGCTCCACCGCGTCCACGG + Intergenic
978655801 4:111064114-111064136 CTCCAACTCCACCCTGTTTCTGG - Intergenic
983575931 4:169261564-169261586 CTCCAACTGCACTCCAACCTGGG + Intronic
985589626 5:757815-757837 CTCCCACCACACCCCGGCCTGGG - Intronic
985912537 5:2895542-2895564 CTCCACCTCCATCCCGAGCTGGG - Intergenic
985912546 5:2895576-2895598 CTCCACCTCCATCCCGAGCTGGG - Intergenic
985912557 5:2895610-2895632 CTCCACCTCCATCCCGAGCTGGG - Intergenic
985912568 5:2895644-2895666 CTCCACCTCCATCCCGAGCTGGG - Intergenic
985912579 5:2895678-2895700 CTCCACCTCCATCCCGAGCTGGG - Intergenic
985912611 5:2895785-2895807 CTCCACCTCCATCCCGAGCTGGG - Intergenic
985912622 5:2895819-2895841 CTCCACCTCCATCCCGAGCTGGG - Intergenic
988224084 5:28389711-28389733 CCCCGACTCCACTACGTCCTTGG + Intergenic
988469715 5:31526854-31526876 CTCCATGTCCTCCTCGTCCTCGG + Exonic
990265914 5:54075560-54075582 CTCCACCTCCTCCGCCTCCTGGG + Intronic
994553953 5:101272810-101272832 CTTCCACTCCACCCCAGCCTGGG + Intergenic
996394969 5:123004592-123004614 CTCCATCTCAACTCTGTCCTGGG + Intronic
997931665 5:138077721-138077743 CTCCAACTCTAACTCTTCCTAGG + Intergenic
998368406 5:141645819-141645841 CTCCTGCTCCACCTCATCCTGGG + Exonic
998391588 5:141790317-141790339 CCCCAACTCCACCCTGTTCCTGG - Intergenic
1000338871 5:160261673-160261695 CTCCAACCCCTCCCCGGGCTGGG + Intronic
1000339858 5:160268776-160268798 CTCCAACACCAGCCATTCCTGGG + Intronic
1001589104 5:172853356-172853378 CTCCACCTCCACCCCCACCACGG - Intronic
1002576484 5:180177008-180177030 CTCCAACTCCCACCCAACCTTGG + Intronic
1003733814 6:8855223-8855245 CTGCAACACCTCCCCGTCCCGGG + Intergenic
1005484534 6:26286931-26286953 CTCCCACCCCACCCCACCCTTGG - Intergenic
1007081051 6:39104571-39104593 CTCCACCACCACCCCGTCCATGG + Exonic
1007698354 6:43748053-43748075 CCCCAACTCCTCCCCATCCCTGG - Intergenic
1015701357 6:136038816-136038838 ATCCAATTCCACCCCCTCCTTGG - Intronic
1018974423 6:168554509-168554531 CTCCACCCCCACCCCTTCCAGGG - Intronic
1019118043 6:169781575-169781597 CCTCAACTCCACCCTGTCTTTGG - Exonic
1019287365 7:230360-230382 CCCCCCCCCCACCCCGTCCTGGG - Intronic
1020125963 7:5532630-5532652 CTCCAGCCCCACCCCGCCCCGGG + Intronic
1021525019 7:21577354-21577376 CTCCAACTCCCACCCTTGCTGGG + Intronic
1021993806 7:26160847-26160869 ATCCAGCTCCACCTCTTCCTGGG + Intronic
1023913872 7:44574059-44574081 CTCCTACTAGACCCAGTCCTAGG - Intronic
1026095159 7:67341080-67341102 ATCCCACTCCACTCCATCCTGGG - Intergenic
1026903982 7:74052211-74052233 CTCCCACTCCATCCCCTCCAGGG + Intronic
1027045958 7:74991571-74991593 TACCAACTCCACCCTGGCCTGGG - Intronic
1028417630 7:90596514-90596536 CTCCTCCTCCACCACCTCCTCGG - Intronic
1029386865 7:100249000-100249022 TACCAACTCCACCCTGGCCTGGG + Intronic
1030191090 7:106810778-106810800 CTCCAACCCCACCCCACCCCTGG + Intergenic
1030216152 7:107045161-107045183 CTCCTCCTCCTCCCCGTCCTCGG - Exonic
1031599753 7:123692542-123692564 CTCCACCTCCACCTCCTCCTGGG - Exonic
1031972462 7:128074497-128074519 CTCCACCTCCACCTCCACCTGGG - Exonic
1033453160 7:141479390-141479412 CACCAACACCACCACCTCCTAGG - Exonic
1036169041 8:6465397-6465419 CCCCATGTCCACCCCGTCCTCGG + Intronic
1038530668 8:28316044-28316066 ATCCTTCTCCACCCAGTCCTGGG + Intergenic
1038963709 8:32548872-32548894 CTCCTACTCCTCCTCCTCCTCGG + Intronic
1039845627 8:41323606-41323628 CTCCACCTCCCTCCTGTCCTGGG - Intergenic
1047703214 8:127471398-127471420 CTCCTACCCCACCCCCACCTTGG + Intergenic
1048001119 8:130380325-130380347 CTCCAACTCTGCTCCTTCCTTGG + Intronic
1048867154 8:138769554-138769576 CTCCACCACCACCCTGTTCTAGG + Intronic
1048874680 8:138827629-138827651 CTCCACCCCCACCAAGTCCTCGG + Intronic
1049331824 8:142058683-142058705 CCCCAGCTCAACCCCTTCCTGGG + Intergenic
1049714761 8:144084640-144084662 CTCCAGCTAGACCCCATCCTGGG - Intronic
1049899836 9:148832-148854 CTGCAATTCCACCCCCACCTTGG - Intronic
1053014424 9:34653910-34653932 CTCCTACTCCACTCAGTTCTGGG - Intronic
1053327084 9:37163343-37163365 ATGCCACTGCACCCCGTCCTGGG + Intronic
1054348162 9:63988947-63988969 CTGCAATTCCACCCCCACCTTGG - Intergenic
1054445889 9:65315306-65315328 CTGCAATTCCACCCCCACCTTGG - Intergenic
1054484381 9:65706204-65706226 CTGCAATTCCACCCCCACCTTGG + Intronic
1058961956 9:109999797-109999819 CTCCACCTCCACCCTCTGCTGGG - Intronic
1060507653 9:124210026-124210048 CTCCAGCTCCATCCTGTCATGGG - Intergenic
1060915491 9:127387087-127387109 CTCCAACTGGTCCCCATCCTTGG - Intronic
1061395439 9:130341219-130341241 CTGCAACACCACGCCATCCTTGG - Intronic
1061488151 9:130930666-130930688 CTCCACCTCCAGCCCTTACTGGG - Intronic
1061883715 9:133580384-133580406 CTCCTGCTGCACCCCGTCCCCGG - Intronic
1061915766 9:133752694-133752716 CCCCAACTGCACCTCTTCCTTGG + Intergenic
1062162555 9:135088180-135088202 CTCCTCCTCCTCCCCCTCCTCGG + Intronic
1062526537 9:136980161-136980183 CTCCGTCTCCACCCTGTCCCAGG + Exonic
1062637242 9:137498134-137498156 CTCCACCTCCACCCAGTCCAGGG + Exonic
1189018873 X:37313822-37313844 CCCCGACTCCACCTCGTCCCCGG + Intergenic
1189323896 X:40101661-40101683 CTCCAGCTCCACCCTGGCCTAGG + Intronic
1190152508 X:47959623-47959645 CTCCCACTCTAGCCCGTCATGGG + Intronic
1198024880 X:132695041-132695063 CTCCAGCGCCACCTCGTCCCTGG - Intronic
1198034237 X:132784936-132784958 GTCCCACTCTACCTCGTCCTTGG + Intronic
1201988459 Y:19995438-19995460 CCCCAACTCCACCCCCACCAAGG + Intergenic