ID: 1089695848

View in Genome Browser
Species Human (GRCh38)
Location 11:120215926-120215948
Sequence CTCCCTATCCTCCCTGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 230}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089695848_1089695855 17 Left 1089695848 11:120215926-120215948 CCAGCATCAGGGAGGATAGGGAG 0: 1
1: 0
2: 4
3: 47
4: 230
Right 1089695855 11:120215966-120215988 GTGGAAGGAGGGGATCCTGAAGG 0: 1
1: 0
2: 1
3: 26
4: 350
1089695848_1089695853 7 Left 1089695848 11:120215926-120215948 CCAGCATCAGGGAGGATAGGGAG 0: 1
1: 0
2: 4
3: 47
4: 230
Right 1089695853 11:120215956-120215978 CTCCAAAAGTGTGGAAGGAGGGG 0: 1
1: 0
2: 3
3: 38
4: 336
1089695848_1089695856 28 Left 1089695848 11:120215926-120215948 CCAGCATCAGGGAGGATAGGGAG 0: 1
1: 0
2: 4
3: 47
4: 230
Right 1089695856 11:120215977-120215999 GGATCCTGAAGGCCCACAGCTGG 0: 1
1: 0
2: 3
3: 21
4: 212
1089695848_1089695852 6 Left 1089695848 11:120215926-120215948 CCAGCATCAGGGAGGATAGGGAG 0: 1
1: 0
2: 4
3: 47
4: 230
Right 1089695852 11:120215955-120215977 ACTCCAAAAGTGTGGAAGGAGGG 0: 1
1: 1
2: 18
3: 106
4: 421
1089695848_1089695850 2 Left 1089695848 11:120215926-120215948 CCAGCATCAGGGAGGATAGGGAG 0: 1
1: 0
2: 4
3: 47
4: 230
Right 1089695850 11:120215951-120215973 ACAGACTCCAAAAGTGTGGAAGG 0: 1
1: 0
2: 3
3: 21
4: 244
1089695848_1089695849 -2 Left 1089695848 11:120215926-120215948 CCAGCATCAGGGAGGATAGGGAG 0: 1
1: 0
2: 4
3: 47
4: 230
Right 1089695849 11:120215947-120215969 AGACACAGACTCCAAAAGTGTGG 0: 1
1: 0
2: 2
3: 30
4: 272
1089695848_1089695851 5 Left 1089695848 11:120215926-120215948 CCAGCATCAGGGAGGATAGGGAG 0: 1
1: 0
2: 4
3: 47
4: 230
Right 1089695851 11:120215954-120215976 GACTCCAAAAGTGTGGAAGGAGG 0: 1
1: 3
2: 26
3: 138
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089695848 Original CRISPR CTCCCTATCCTCCCTGATGC TGG (reversed) Intronic
900225053 1:1529062-1529084 CTCCACATCCTCCCTGCTGCAGG - Intronic
900405163 1:2489776-2489798 CTCCGCATCCTCGCTGATGTTGG - Exonic
900793735 1:4695188-4695210 CTGCCCATCCTCCCTCCTGCAGG - Intronic
901128198 1:6944027-6944049 CTCCCTATCCCCCCAGCCGCTGG + Intronic
901738548 1:11327627-11327649 CTCCCTGTGCTCCATAATGCGGG - Intergenic
902334589 1:15747633-15747655 CTCCAGATCCTCCCTGAGGCAGG - Exonic
903032069 1:20471071-20471093 CTCCCAATGCTCTCTGAGGCAGG + Intergenic
903143152 1:21352162-21352184 CTCCCTGTCCTCTCTGAGGAAGG + Intergenic
904939915 1:34158463-34158485 CTCCCTACCCTCCTGGATGAAGG + Intronic
906125038 1:43422555-43422577 CTCCCTGACCTCTCTGCTGCGGG + Exonic
906431097 1:45756428-45756450 CTTTCTACCCTCCCTGATGAGGG + Intergenic
906550667 1:46663868-46663890 CTCCATATTCTCCCTGGCGCTGG + Intronic
907144523 1:52220199-52220221 CTTTCTACCCTCCCTGATGAAGG + Intronic
907319033 1:53591266-53591288 CTCCCTCTCCTCCATGATGCTGG - Intronic
907333534 1:53686366-53686388 CCCCCTAGCCTCTCTGATGGAGG + Intronic
907425355 1:54375917-54375939 CTCCCTTTCCTCCCAGAGCCTGG - Intronic
908549009 1:65190608-65190630 CTCTCCATCCTTCCTGATGTGGG - Intronic
910107046 1:83642846-83642868 CTCCCTCTCCTCCCTGCCCCTGG - Intergenic
912410831 1:109479723-109479745 CTTCCTATCCTCCTTCTTGCTGG + Exonic
912466376 1:109877586-109877608 CCCCCAGTGCTCCCTGATGCCGG - Intergenic
912543357 1:110433504-110433526 CTCCCTCTCCACCCTAATGGAGG + Intergenic
912544202 1:110439268-110439290 CTCCATATCCTCCCTGACAGAGG + Intergenic
914338398 1:146737827-146737849 TTACCTACCCTCCCTGATTCAGG + Intergenic
915565907 1:156712581-156712603 CTCCCTATCGGCCCTGGTGTGGG + Intergenic
916899601 1:169206410-169206432 CTCCCTACCCTCCGTGTTCCAGG - Intronic
917307330 1:173639979-173640001 CTTTCTACCCTCCCTGATGAAGG - Intronic
920112940 1:203599827-203599849 CTGCTTCTCCTCCCTGACGCTGG + Intergenic
920965645 1:210698598-210698620 CTCCCTCCCCTCCGTGATTCTGG - Intronic
921388376 1:214594447-214594469 CTCTCTTTCATCCCTGACGCTGG - Intergenic
922203030 1:223422740-223422762 CTTCCTTTCCTTCCTGATCCAGG - Intergenic
924149896 1:241118738-241118760 CCCCCTCTCCTCCATGTTGCTGG - Intronic
924855629 1:247872708-247872730 CTCCCTATCTACCCGGGTGCTGG - Intronic
1067455835 10:46418734-46418756 CTCCCTCTCCTCCCTGAGGCCGG + Intergenic
1067460708 10:46456246-46456268 CTCTCTGTCCACCCTGATACTGG - Intergenic
1067539882 10:47143747-47143769 CTCCCTATCCTTCCTGCAGCAGG - Intergenic
1067626483 10:47928354-47928376 CTCTCTGTCCACCCTGATACTGG + Intergenic
1067631365 10:47965905-47965927 CTCCCTCTCCTCCCTGAGGCCGG - Intergenic
1067790324 10:49282979-49283001 CTCCCCACCCTCCCGGATGGCGG - Intergenic
1070799876 10:79239076-79239098 CTCCCTTTCCCCCCTCATCCTGG - Intronic
1071067066 10:81648317-81648339 CTCCCTATTTTCCTTCATGCTGG + Intergenic
1072450738 10:95537684-95537706 CTCTCATTCCACCCTGATGCTGG + Intronic
1074979372 10:118607595-118607617 CTCCCTGTCCACCCTCATGTAGG + Intergenic
1076168287 10:128299725-128299747 CTCCCTCTCCTCCTTGCTGCAGG + Intergenic
1076411078 10:130251280-130251302 TTCCCTGCCCTCCCTGATGGAGG - Intergenic
1077049116 11:558839-558861 CTCCCTCTCCTCCTTACTGCGGG + Exonic
1077121822 11:912395-912417 CTTCCTATCCTCCCATCTGCGGG - Intronic
1077703376 11:4461820-4461842 CTCTCTAACCTCCCTGATGAGGG - Intergenic
1078431232 11:11290244-11290266 CTCCCTCTCCTCCATGACCCCGG - Intronic
1079705235 11:23607466-23607488 CTCCCTTTCCTCCCAGCTTCTGG - Intergenic
1080343134 11:31292598-31292620 TCCCCTCTCCTCCCTGCTGCTGG - Intronic
1080383134 11:31794759-31794781 CTCCCCCTCCTTCCTGTTGCTGG + Exonic
1082867861 11:57916349-57916371 GCCCCTATCCTCCCTCATGGAGG + Intergenic
1083616691 11:64029702-64029724 CTCCCTACCCTGGCTGAGGCTGG + Intronic
1084432433 11:69118765-69118787 TTGCCTAGCCTCCCTGTTGCTGG + Intergenic
1084775203 11:71370296-71370318 CTCACTGGCCTCCCTGATGATGG + Intergenic
1088229674 11:107660881-107660903 CTTCCTGTGCTCCCTAATGCTGG - Intronic
1089695848 11:120215926-120215948 CTCCCTATCCTCCCTGATGCTGG - Intronic
1089851531 11:121501374-121501396 TTCCTTCTCCTCCCTGATGCTGG + Intronic
1091278872 11:134370694-134370716 CTCACTCTCCTCTCTGAGGCTGG - Intronic
1091626523 12:2125007-2125029 CTCCCACTCCACCCTGATGCAGG - Intronic
1093801330 12:23376237-23376259 TTCCCTATTGCCCCTGATGCAGG - Intergenic
1093982732 12:25492765-25492787 CTCACTATCCTACATGCTGCTGG + Intronic
1096828244 12:54295418-54295440 CTCCCCATCCTCACTCATGCTGG + Exonic
1097029735 12:56081887-56081909 CTCCCTATGCTCCCGGTTCCTGG + Intronic
1097203470 12:57299878-57299900 GTCCCCCTCCTCCCTGGTGCAGG + Intronic
1101747361 12:107553311-107553333 CTCCCAATACTCCTTGAGGCAGG + Intronic
1103716942 12:122950387-122950409 CTCCCTTCCCTCCCTGGTGCAGG + Intronic
1105432848 13:20352688-20352710 CTCCCTCTCCTCCCCGAGCCTGG + Intergenic
1106047532 13:26157702-26157724 CTTCATGTCCTCACTGATGCTGG - Intronic
1106207465 13:27613266-27613288 CACCCTCCCCTCCCTGCTGCAGG - Intronic
1107666556 13:42696831-42696853 TTGCCTATCCTGACTGATGCAGG + Intergenic
1109192918 13:59346542-59346564 CCCCCTACCCTCCAGGATGCTGG - Intergenic
1111098995 13:83555875-83555897 CACCCCATCCTCCCTCTTGCTGG - Intergenic
1111678414 13:91415056-91415078 CTACCTTGCCTCCCTGTTGCTGG + Intronic
1112531331 13:100206749-100206771 CTTCCTCTCTTCCCTGAAGCAGG + Intronic
1114572886 14:23686630-23686652 CTCCATATCATTCCTAATGCTGG - Intergenic
1116648241 14:47557538-47557560 CTCCCTTTCCTACCAGATGTTGG - Intronic
1116846404 14:49868291-49868313 CTCCCTCCCCTCCCAGTTGCTGG - Intergenic
1117348150 14:54854362-54854384 CTTCCTGCCCTCCCTGCTGCAGG - Intronic
1118908038 14:70037216-70037238 CTCCCTAGCCACCCTGATGCTGG + Intergenic
1121454236 14:94028076-94028098 CTCCCTATCTGCCCTGACTCAGG + Intronic
1121713197 14:96054157-96054179 CTCCCCATCATCCCTTATGCAGG + Intronic
1123016709 14:105379150-105379172 CACACTATCCACACTGATGCAGG - Intronic
1123020824 14:105397146-105397168 CTGCCCAACCTCCCTGGTGCTGG - Exonic
1124123400 15:26911899-26911921 CTCCATATCCACCCTGACGATGG + Intronic
1124407232 15:29403959-29403981 CTCTCCCTCCTCCCTGCTGCAGG + Intronic
1127572736 15:60260233-60260255 CTCCCTTTCCTCCATGATCTGGG + Intergenic
1127727737 15:61766786-61766808 CTCCTTATGCTTCCTCATGCAGG + Intergenic
1129348687 15:74940790-74940812 CTCCCTGTCCTCCCTACTACTGG - Intergenic
1130155337 15:81345527-81345549 CTCCCTTTCCTCCCCCATTCAGG + Intronic
1131054911 15:89369331-89369353 CTTCCTTTCTTCCCTGAAGCCGG - Intergenic
1134759484 16:16701441-16701463 TGCCCTCTCCTCCCTGATTCAGG + Intergenic
1134986586 16:18657753-18657775 TGCCCTCTCCTCCCTGATTCAGG - Intergenic
1135183048 16:20291814-20291836 CTCCCCATCCTCCCAGATCATGG - Intergenic
1135539455 16:23318830-23318852 CCCCAAATCCTCCATGATGCTGG - Intronic
1136061931 16:27732596-27732618 CTCCCCCTCCTCCCTGACTCTGG - Intronic
1136636919 16:31529863-31529885 TTCCCTTTCCACCCTGATCCAGG - Intergenic
1137246617 16:46711214-46711236 TTCTCTATCCTCCCTCAGGCGGG - Intronic
1138278060 16:55750606-55750628 CTCTCTCTCTTCCCTGATCCAGG - Intergenic
1138656014 16:58491853-58491875 CTCTCTAACCTCCCTGAAGGAGG - Intronic
1139995880 16:70979527-70979549 TTACCTACCCTCCCTGATTCAGG - Intronic
1141300873 16:82814399-82814421 CTCCCTTTCCTCCCTGGAGGTGG - Intronic
1141817010 16:86417716-86417738 GTCCCCACCCTCCCTGATGGAGG - Intergenic
1142024378 16:87804648-87804670 CTCCCTGTCCTCCCTGAGCTCGG + Intergenic
1143436149 17:6927899-6927921 CGCCTTGTCCTCCCTGTTGCTGG + Intronic
1143495737 17:7311762-7311784 CTCCCTATCCTTCCTGTTGAAGG + Intronic
1144734365 17:17546673-17546695 CTCCCTGTCCACCCTGGGGCTGG + Intronic
1145053426 17:19681807-19681829 CTCCCTTTCTTCCCTGAGGGTGG + Intronic
1146064472 17:29623530-29623552 CTCCCTCCCCTCCCAGATGCAGG + Intergenic
1146064553 17:29623924-29623946 CTCCCTTTCCTCCCCAGTGCTGG - Intergenic
1147965761 17:44193482-44193504 CTGCCTCTCCTCCCTGACCCAGG - Exonic
1148680748 17:49472315-49472337 CTCCATATCCTCCCTGCAGCTGG + Intronic
1152338171 17:79709711-79709733 GCCCCTCCCCTCCCTGATGCTGG + Intergenic
1152338198 17:79709798-79709820 GCCCCTCCCCTCCCTGATGCTGG + Intergenic
1152338239 17:79709929-79709951 GCCCCTCCCCTCCCTGATGCTGG + Intergenic
1152338254 17:79709973-79709995 GCCCCTCCCCTCCCTGATGCTGG + Intergenic
1152338283 17:79710061-79710083 GCCCCTCCCCTCCCTGATGCTGG + Intergenic
1152338326 17:79710192-79710214 GCCCCTCCCCTCCCTGATGCTGG + Intergenic
1153940735 18:9974281-9974303 GTCCTTCTCCTCCCAGATGCTGG - Intergenic
1154014562 18:10604915-10604937 TTACCCATCCTCCCTGCTGCAGG + Intergenic
1155907408 18:31468503-31468525 CTCCTTGTCCTCTCTGTTGCAGG - Intronic
1156362717 18:36398776-36398798 CTGCCTATTTTCCATGATGCAGG + Intronic
1156486708 18:37471093-37471115 CTCCCTCTCTGCCCTGAAGCTGG - Intronic
1156907423 18:42370555-42370577 TTCTCTATCATCCCTGATGATGG - Intergenic
1157264747 18:46208714-46208736 CACCCTGACCTCCCAGATGCTGG + Intronic
1158002626 18:52636725-52636747 TTCCCTATCCACCCTGATAGCGG + Intronic
1158991492 18:62873120-62873142 CTCTCTATCATCCCTTATGAAGG - Intronic
1160713255 19:563224-563246 CTTTCTACCCTCCCTGATGAGGG + Intergenic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1161199552 19:3006720-3006742 CTCCCTGCCCTCCCAGGTGCGGG - Intronic
1162556701 19:11391156-11391178 CCCCCTTTCCTCCCTCCTGCTGG - Intronic
1162971504 19:14183693-14183715 CTCCCTGTCCTCCCCCAGGCTGG - Exonic
1163375348 19:16927014-16927036 CACCCTCTCCTCCCTGACTCAGG + Intronic
1165384310 19:35501644-35501666 CTCCCCATCCTCCCTGACCCAGG + Intronic
1166985690 19:46659193-46659215 CACCGCCTCCTCCCTGATGCTGG + Intronic
1167409625 19:49337250-49337272 TTCCCTCTCCTCCCTGCTGGGGG - Intronic
925033749 2:671381-671403 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033764 2:671434-671456 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033779 2:671487-671509 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033794 2:671540-671562 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033809 2:671593-671615 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033824 2:671646-671668 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033839 2:671699-671721 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033854 2:671752-671774 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033869 2:671805-671827 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925033884 2:671858-671880 CTGCCTCTCCTCCCGGATGCAGG - Intronic
925097900 2:1222510-1222532 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097912 2:1222580-1222602 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097925 2:1222650-1222672 CTCCCTGTCCTGCCTGCTGGTGG + Intronic
925097935 2:1222720-1222742 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097947 2:1222790-1222812 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097959 2:1222860-1222882 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097972 2:1222930-1222952 CTCCCTGTCCTGCCTGCTGGTGG + Intronic
925097984 2:1223000-1223022 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925097996 2:1223070-1223092 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925098008 2:1223140-1223162 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925098020 2:1223210-1223232 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925098030 2:1223280-1223302 CTCCCTGTCCTGCCTGCTGCTGG + Intronic
925951679 2:8919361-8919383 CTTCATATCCTCACTAATGCTGG + Intronic
930460002 2:51661785-51661807 CTGCCTTTCTTCCCTGAAGCAGG - Intergenic
931224537 2:60318627-60318649 CTCCCTCCCCGCCCTGCTGCAGG + Intergenic
931669133 2:64630933-64630955 CTCTCTACCATCCCTGATGCTGG - Intergenic
931731409 2:65156785-65156807 CTCCCTCTCCTCCCTTTTGTTGG - Intergenic
932308514 2:70720899-70720921 CTCCCTTGCCTCCCTGCTGGAGG + Intronic
934168821 2:89321876-89321898 CTCCCTGTCCTCACTGATTGAGG - Intergenic
934198470 2:89860708-89860730 CTCCCTGTCCTCACTGATTGAGG + Intergenic
935652384 2:105393243-105393265 CTCCCTATCAACCCTGCTGCAGG + Intronic
937295510 2:120807699-120807721 CTCCCTTCCCTCCCCGATCCTGG + Intronic
941357332 2:164510615-164510637 CTACCTATCCTCCCCCAAGCAGG + Intronic
942664321 2:178300703-178300725 CTACTTATCCTCCCAAATGCTGG + Intronic
945111815 2:206367139-206367161 CTACCTTGCCTCCCTGTTGCTGG - Intergenic
946250168 2:218406662-218406684 CTCCCTGTCCTCGCGGACGCAGG + Intergenic
946330126 2:219004281-219004303 CTTCCCATCCTCCCAGCTGCTGG + Exonic
947718508 2:232353454-232353476 CTCCGTCTCCTCCCTGAGGAAGG + Intergenic
948497616 2:238362547-238362569 CTCCCTTTTCTCCCTCTTGCTGG - Intronic
948881159 2:240857855-240857877 CTGCCTGTCCTCCCTGGGGCGGG - Intergenic
1168990171 20:2088201-2088223 CTCCCTTTCCTCCCTGCACCCGG + Intergenic
1172530849 20:35630410-35630432 TTCCCCATCCACCCTGAGGCAGG - Intronic
1172844752 20:37923238-37923260 CTCCCTAACCTCCCAGACCCTGG - Intronic
1173305935 20:41849704-41849726 ATCCCTTTCCTCCTTCATGCTGG - Intergenic
1175322713 20:58100621-58100643 CTCCCTAACTTCCCTTATCCTGG + Intergenic
1175594492 20:60220035-60220057 GTCCCTGACCTCCCTGGTGCAGG - Intergenic
1176136588 20:63525125-63525147 CTGCCTTTCTTCCCTGAAGCAGG - Intergenic
1177097235 21:16851279-16851301 CTTCTTACCCTCCCTGATGTAGG - Intergenic
1177498614 21:21920649-21920671 CACCCTTTCCTCCCTCAAGCAGG - Intergenic
1179056442 21:37939529-37939551 CTCCCTACCCTCCCTTAACCAGG + Intergenic
1179313908 21:40223895-40223917 CTCTCCATCCTTCCTGATGGAGG - Intronic
1180965503 22:19786143-19786165 CTGCCTAGCCACCCAGATGCGGG + Exonic
1181695321 22:24590048-24590070 CTCCATCTCCTCCCTAAGGCTGG + Intronic
1181813782 22:25421396-25421418 CTCCCGATTCTCCCGGACGCAGG - Intergenic
1182455829 22:30449910-30449932 CTCCTGATTCTCCCTGATCCAGG - Intronic
1183483073 22:38075395-38075417 CTCCCTCTCCTTCCTAAGGCAGG - Exonic
1184403451 22:44286883-44286905 CTCCGTCTGCTCCCTGCTGCAGG + Intronic
1184474340 22:44712431-44712453 CTCCCTGTCCTCGCTGGCGCAGG - Intronic
950157979 3:10738291-10738313 CCCCCTAGCCTCCCTCATTCTGG - Intergenic
951523238 3:23629032-23629054 CTCCCTATTTTCCCTTATACAGG - Intergenic
952925449 3:38316450-38316472 TTCCCTCTCCTCCCTGCTGCCGG + Exonic
952985087 3:38771728-38771750 CTCCCTATCCTGCAAGAAGCTGG + Intronic
953492337 3:43362666-43362688 CTCCCTGCCCACCCTGGTGCAGG + Intronic
953798402 3:46002721-46002743 CTCCAAATCCTCGCTGGTGCTGG + Intergenic
954440168 3:50517415-50517437 CTCCCTTCCCTCTCTGAGGCAGG + Intergenic
954442916 3:50531463-50531485 TTCCCTAGCCTCCCTGGTGATGG - Intergenic
954444811 3:50540909-50540931 CACCCCACCCTCCCTGACGCAGG + Intergenic
955134029 3:56198430-56198452 CTCCCTGGCCTCCCTGCTTCAGG - Intronic
955408964 3:58643605-58643627 CCCCCTACCCTCCCTGGTTCTGG + Intronic
955733246 3:62009724-62009746 CACCCTCTCCACACTGATGCAGG + Intronic
956311043 3:67880880-67880902 CTGCCTTTGCTCCCTGGTGCTGG - Intergenic
956557905 3:70542116-70542138 CTGCCTATCCTCCCTGCTGTTGG + Intergenic
966873276 3:184306328-184306350 CTCCCTCACCACCCTGACGCAGG + Exonic
967553664 3:190830371-190830393 CTACATATCCTCCCTCATTCTGG - Intergenic
967884351 3:194322952-194322974 CTCTCTCCCCTCCCTGAGGCTGG - Intergenic
974296022 4:59999814-59999836 TGGCCTATCCTCCCTGTTGCTGG + Intergenic
975044294 4:69783192-69783214 CTCCATATCCTCACTGGAGCAGG - Intronic
977518584 4:98052934-98052956 CTCCCTAACCTCACTGAGGAAGG + Intronic
980824595 4:138058293-138058315 ATCCCTATCCTCCCTGAATAAGG + Intergenic
986331074 5:6716449-6716471 CACCTCATCCTCCCTCATGCAGG + Intronic
988629618 5:32914824-32914846 CTGCCTTTCCTCCCTGGTGCTGG - Intergenic
989539824 5:42605831-42605853 CTCCATCAGCTCCCTGATGCAGG + Intronic
990686606 5:58309914-58309936 CTCCCTACCCTCCCTGACTTGGG + Intergenic
991092062 5:62703083-62703105 CTCCCTGACTTCCCTGAAGCGGG + Intergenic
991489281 5:67166669-67166691 CTTCCTATGGTCCCTGTTGCTGG - Exonic
993502805 5:88681003-88681025 TTCATTATCCTCCCTGAAGCGGG + Intergenic
993793791 5:92240752-92240774 CTCCCTATATTCCCTAATTCAGG - Intergenic
995549543 5:113267149-113267171 CTTCCTATCGTCCCTGTAGCAGG + Intronic
995886319 5:116898323-116898345 CTCCCATTCCTGCCTGCTGCTGG + Intergenic
997611703 5:135220194-135220216 CTCCACATCATCCCAGATGCTGG - Intronic
999131318 5:149285593-149285615 CTCCCTAGCCTTCCTGAGGAGGG + Intronic
1000147866 5:158470924-158470946 CTCACTGTCCTACCTGATGCGGG - Intergenic
1000745751 5:165031430-165031452 TCCCCTATCCTCCCTGGTGATGG - Intergenic
1002664406 5:180811661-180811683 CTCCCTACCCTCCCAGTCGCTGG + Intronic
1003184880 6:3821999-3822021 CTCCCCATCCTCCTGGATGCTGG - Intergenic
1004480035 6:16010223-16010245 CTTCCTTTCCTCCCTGAAACTGG - Intergenic
1005575228 6:27183875-27183897 CTTTCTACCCTCCCTGATGAGGG - Intergenic
1006630567 6:35427288-35427310 CTCCCTTCCCTCCCTGAGGCAGG + Exonic
1007071767 6:39043240-39043262 CCCTCTATCTTCCCTGCTGCGGG - Intergenic
1007418056 6:41703485-41703507 CTCCCCAGCCTCCCTGTGGCTGG + Intronic
1010035843 6:71324741-71324763 CTCCCTATCATTCCTCATCCTGG - Intergenic
1011259739 6:85458416-85458438 CTCCCTCCCCTGCCTGAAGCTGG - Intronic
1011959645 6:93071143-93071165 TTACCTATCTTACCTGATGCTGG + Intergenic
1015328481 6:131950989-131951011 CGCCCTGTCCTCCCTGCAGCCGG - Exonic
1018204185 6:161421491-161421513 CTCTCTATCCACCCTCATGCTGG - Intronic
1019157593 6:170049674-170049696 CTCCCCAGCCTTCCTGATGCAGG - Intergenic
1019616599 7:1965775-1965797 CTCCCTGTCCTCCCTCCTGCAGG + Intronic
1020745328 7:12072356-12072378 CTTTCTATTCTCCCTGATGAAGG - Intergenic
1022472016 7:30687861-30687883 CTCCATTTCCTGTCTGATGCTGG + Intronic
1022777689 7:33544779-33544801 CTCCCTATCCACCCTGGTAGTGG - Intronic
1023061554 7:36332488-36332510 CTTCCTATCTTCCCTGCTCCTGG + Intronic
1023979006 7:45055163-45055185 CTCCCTGGCCTCCCTGTGGCTGG - Intronic
1024799969 7:53065346-53065368 CTCTCTTTCCTCCCTGATTCTGG + Intergenic
1026729660 7:72900322-72900344 CTCCCTTTTATTCCTGATGCTGG + Intronic
1027114336 7:75466785-75466807 CTCCCTTTTATTCCTGATGCTGG - Intronic
1028416166 7:90582863-90582885 CGCCTTGGCCTCCCTGATGCTGG + Intronic
1029197597 7:98816769-98816791 GTCCCCACCCTCCATGATGCTGG + Intergenic
1033121677 7:138671948-138671970 CTCCCTTTCCTCCATCCTGCAGG - Intronic
1033898642 7:146108250-146108272 CTCTCTCTCCTCCCTGTTCCTGG + Intergenic
1036681165 8:10875398-10875420 CACCCTGTCCTCCCAGAAGCCGG + Intergenic
1036709223 8:11067708-11067730 CTCCCCAAACTCCCTGAAGCTGG + Intronic
1037837255 8:22221527-22221549 CTCCCCATCCTCCACGCTGCAGG + Exonic
1038742958 8:30231741-30231763 TTCCTTTTCCTCCCTGAGGCTGG + Intergenic
1039615419 8:38951365-38951387 CGGCCCAACCTCCCTGATGCTGG + Intronic
1039919791 8:41885148-41885170 CTCACCATCCTCACTGCTGCTGG - Intronic
1041548665 8:59076035-59076057 CTCCCTTCCCTCCCTCATGTAGG - Intronic
1042100403 8:65270348-65270370 CTCCTTAGCCTCCCAAATGCTGG - Intergenic
1044740201 8:95318553-95318575 CTCCCTATTCCCTCTGCTGCTGG + Intergenic
1046727972 8:117695035-117695057 CTGCCTAACCTCCCTGGTCCAGG - Intergenic
1046819507 8:118620691-118620713 CTCCCTCTCCTCCCTGCCCCAGG - Intronic
1050080719 9:1912947-1912969 GCCCCTATCCTCCCCCATGCTGG - Intergenic
1051170613 9:14315488-14315510 CTCCCTACCCGCCCGGGTGCAGG + Intronic
1053010652 9:34630967-34630989 TGCCCAACCCTCCCTGATGCTGG + Intergenic
1053170799 9:35880935-35880957 CTCCATATCCTGACTGATACTGG + Intergenic
1053605526 9:39654809-39654831 CTACCTATGCTCCCAGTTGCTGG - Intergenic
1053863447 9:42411438-42411460 CTACCTATGCTCCCAGTTGCTGG - Intergenic
1054562129 9:66722131-66722153 CTACCTATGCTCCCAGTTGCTGG + Intergenic
1055358661 9:75465086-75465108 CTCTCAAACCTCCCTGATTCAGG - Intergenic
1057239848 9:93399072-93399094 CTGCCCTCCCTCCCTGATGCGGG + Intergenic
1059417420 9:114170458-114170480 CTCTCTCTCCTTCCTGAAGCCGG + Intronic
1185550672 X:980829-980851 CACACTCTCCTCCCTGAGGCTGG + Intergenic
1185778292 X:2823954-2823976 CTTTCTCTCCTCCCTGTTGCCGG - Intergenic
1187154779 X:16712521-16712543 TCCCCTCTCCTCCCTGCTGCTGG + Intronic
1187246309 X:17555678-17555700 CTTCCAATCCTCACTGATGGGGG + Intronic
1187701850 X:21970423-21970445 CCCCCTCTCCTCTCTGCTGCTGG + Intronic
1188390276 X:29611158-29611180 CTTCCTTTCCTTCCTGATCCAGG + Intronic