ID: 1089696655

View in Genome Browser
Species Human (GRCh38)
Location 11:120220040-120220062
Sequence GCTGCTCTTGAGCCAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18767
Summary {0: 1, 1: 0, 2: 13, 3: 651, 4: 18102}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089696645_1089696655 26 Left 1089696645 11:120219991-120220013 CCCAGCTGTGCGACAGACCCCAG 0: 1
1: 0
2: 0
3: 14
4: 191
Right 1089696655 11:120220040-120220062 GCTGCTCTTGAGCCAGAGGCAGG 0: 1
1: 0
2: 13
3: 651
4: 18102
1089696653_1089696655 -2 Left 1089696653 11:120220019-120220041 CCATGTGAATAGGCTAGAGTCGC 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1089696655 11:120220040-120220062 GCTGCTCTTGAGCCAGAGGCAGG 0: 1
1: 0
2: 13
3: 651
4: 18102
1089696650_1089696655 8 Left 1089696650 11:120220009-120220031 CCCAGGGTCACCATGTGAATAGG 0: 1
1: 0
2: 0
3: 8
4: 105
Right 1089696655 11:120220040-120220062 GCTGCTCTTGAGCCAGAGGCAGG 0: 1
1: 0
2: 13
3: 651
4: 18102
1089696652_1089696655 7 Left 1089696652 11:120220010-120220032 CCAGGGTCACCATGTGAATAGGC 0: 1
1: 0
2: 1
3: 9
4: 81
Right 1089696655 11:120220040-120220062 GCTGCTCTTGAGCCAGAGGCAGG 0: 1
1: 0
2: 13
3: 651
4: 18102
1089696644_1089696655 27 Left 1089696644 11:120219990-120220012 CCCCAGCTGTGCGACAGACCCCA 0: 1
1: 0
2: 0
3: 16
4: 832
Right 1089696655 11:120220040-120220062 GCTGCTCTTGAGCCAGAGGCAGG 0: 1
1: 0
2: 13
3: 651
4: 18102
1089696649_1089696655 9 Left 1089696649 11:120220008-120220030 CCCCAGGGTCACCATGTGAATAG 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1089696655 11:120220040-120220062 GCTGCTCTTGAGCCAGAGGCAGG 0: 1
1: 0
2: 13
3: 651
4: 18102
1089696646_1089696655 25 Left 1089696646 11:120219992-120220014 CCAGCTGTGCGACAGACCCCAGG 0: 1
1: 0
2: 0
3: 11
4: 230
Right 1089696655 11:120220040-120220062 GCTGCTCTTGAGCCAGAGGCAGG 0: 1
1: 0
2: 13
3: 651
4: 18102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089696655 Original CRISPR GCTGCTCTTGAGCCAGAGGC AGG Intronic
Too many off-targets to display for this crispr