ID: 1089697904

View in Genome Browser
Species Human (GRCh38)
Location 11:120227053-120227075
Sequence CAGCACAGAGCAGTGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 745
Summary {0: 1, 1: 0, 2: 3, 3: 104, 4: 637}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089697894_1089697904 11 Left 1089697894 11:120227019-120227041 CCCGCTGCTGGGCGGAGGGAAGG 0: 2
1: 0
2: 4
3: 47
4: 435
Right 1089697904 11:120227053-120227075 CAGCACAGAGCAGTGGAGGAGGG 0: 1
1: 0
2: 3
3: 104
4: 637
1089697896_1089697904 10 Left 1089697896 11:120227020-120227042 CCGCTGCTGGGCGGAGGGAAGGG 0: 1
1: 0
2: 3
3: 33
4: 391
Right 1089697904 11:120227053-120227075 CAGCACAGAGCAGTGGAGGAGGG 0: 1
1: 0
2: 3
3: 104
4: 637

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089697904 Original CRISPR CAGCACAGAGCAGTGGAGGA GGG Intronic
900571432 1:3360595-3360617 CCGCTCACAGCAGAGGAGGAGGG + Intronic
900586053 1:3432862-3432884 CAGCACAGGGCAGGTGGGGATGG - Intronic
901752427 1:11418905-11418927 TAGCACAGAGGAGAGGAGCATGG - Intergenic
902510011 1:16961297-16961319 AAGCACAGATCAGTGAAGGGAGG - Intronic
902535577 1:17117895-17117917 AAGAACACAGCAGTGGAGGGTGG - Intronic
902734909 1:18394151-18394173 CAGTCCAGGGCAGTGGAGGGTGG - Intergenic
903652294 1:24929632-24929654 CAGCACGGAGCAGAGGAAGTTGG + Exonic
903668707 1:25022915-25022937 CTGCAGAGAGAAGTGGAGGAGGG - Intergenic
903957381 1:27034658-27034680 CATCACTGCACAGTGGAGGAAGG - Intergenic
904049572 1:27631185-27631207 GAGAACACAGCAGTGGGGGAGGG - Intronic
904263996 1:29307365-29307387 CTGCTCAAGGCAGTGGAGGATGG - Intronic
905150179 1:35921078-35921100 CAGGACAGTGCAGAGGAGGGAGG - Exonic
905937002 1:41832653-41832675 CAGCACAAAGCAGTGGTGCCTGG + Intronic
905957890 1:42014361-42014383 CAGCACACAGCAAGGAAGGAGGG + Intronic
906941179 1:50256841-50256863 CAGCAGAGGGCAGAGGATGAAGG - Intergenic
907388653 1:54142023-54142045 CAGCATAGAACTGTGGAGGTTGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907734915 1:57103208-57103230 AAACACAGAGAAGTGTAGGAAGG + Intronic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908765685 1:67552953-67552975 CAGGACAGAGCAGTGAAGAAAGG - Intergenic
909715383 1:78701639-78701661 CAGCACAATGCAGTGGAGCAGGG + Intergenic
910528772 1:88211678-88211700 CAGCACAGACCATTGGAGGGTGG + Intergenic
910892550 1:92032782-92032804 CATCACATGGCAGAGGAGGAAGG + Intronic
912536651 1:110378480-110378502 CAGCACAGTGCAGTGGCTCAAGG - Intronic
912968226 1:114255995-114256017 TATCACAGTGCAGTTGAGGAAGG + Intergenic
913188251 1:116389940-116389962 CTGAACAGTGCAGTGGAGAAAGG + Intronic
914815259 1:151058361-151058383 TAGCGCAGGGCAGTGGGGGATGG + Exonic
916637000 1:166682209-166682231 CAGCACAGACTAGAGGAAGAAGG - Intergenic
916674481 1:167054303-167054325 CAGCAGAGGGCGGCGGAGGAAGG - Exonic
917799080 1:178553787-178553809 CACCTCAGAGCAGGAGAGGAAGG - Intergenic
920195439 1:204223339-204223361 CAGCACAGGGCACTGGGGTAGGG + Intronic
920309183 1:205038554-205038576 GGTCACAGAGCAGTGGAGGTGGG - Intergenic
920312341 1:205056125-205056147 CAGCTGAGAGCAGAGGAGAAAGG + Intronic
920530834 1:206701114-206701136 GAGCCCAGAGGAGTGGTGGAGGG + Intronic
920563595 1:206956735-206956757 CAGAACATAGCTGTGGAGGTGGG + Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921738539 1:218656668-218656690 CAGCACTGAGCACTGGTGGCAGG + Intergenic
921955783 1:220982024-220982046 CAGCATAGCGCAGGGGAGAAGGG - Intergenic
922196108 1:223362445-223362467 CAGCAATGAGCAGTGGAGGCAGG + Intronic
922857452 1:228787261-228787283 AAGAACAGAGCAGTTGAGCATGG - Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923158035 1:231295513-231295535 CAGCACAGAGCAGGAGAGCTAGG + Intergenic
1062892212 10:1072242-1072264 CAGCTCGGAGCAGGAGAGGACGG + Exonic
1062952460 10:1515237-1515259 CAGCACAGAGCAGGGGCAGGCGG + Intronic
1062961357 10:1575847-1575869 GAGCAATGTGCAGTGGAGGAGGG - Intronic
1063002365 10:1936325-1936347 CAGCACACAGGAGTGGATGCTGG + Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066754887 10:38701076-38701098 CAGCACAGGGCAGTGATGCATGG + Intergenic
1067163066 10:43843292-43843314 CAGCACAGATCAATCCAGGAAGG - Intergenic
1067552837 10:47247319-47247341 AGGCACCCAGCAGTGGAGGAGGG + Intergenic
1067569332 10:47360107-47360129 CAGCACAGAGCTGGGGGGCATGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068912143 10:62389668-62389690 CAGCAGAGAGGAAGGGAGGAAGG + Intronic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1069795783 10:71050895-71050917 CAGCACAGAGCTGGGAAGGCAGG - Intergenic
1070534078 10:77362183-77362205 CATCACAGAGGAGAGGAGGGTGG + Intronic
1070551672 10:77495294-77495316 CATCACAGAGCAGTGCAGGCGGG - Intronic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071160199 10:82736556-82736578 CAGCACAGAGTTATGGAGGCAGG + Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1073150732 10:101309815-101309837 CAGCACAGAGCCTGGGAGGCTGG - Intergenic
1073163322 10:101420510-101420532 CCACACAGGGCAGTGGAGGGTGG - Intronic
1073604766 10:104883083-104883105 CAGAGCAGAGCAGTGGATGTCGG + Intronic
1073965281 10:108981801-108981823 AAGAAGAGAGCAGTGAAGGATGG - Intergenic
1074379253 10:112965336-112965358 CAGCAGAATGCAGTAGAGGAGGG + Intronic
1074400822 10:113140221-113140243 TAGCACAGAGTAGTGGAGTGGGG + Intronic
1074766313 10:116702471-116702493 CAGCAAATATCAGTGGAGGCCGG - Intronic
1075090186 10:119439873-119439895 CAGCACTGAGCAGTGGGAGTGGG - Intronic
1075222995 10:120600798-120600820 CAGCACAGAGCAGGGGGAGAAGG - Intergenic
1075454405 10:122575900-122575922 CAGCACAGAGCTGTGGAGATGGG - Intronic
1076178640 10:128388035-128388057 CAGAACAGTGCAGTGGAGGTGGG + Intergenic
1076296748 10:129391657-129391679 GAGCACAGAACAGGGAAGGAGGG + Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076598006 10:131637900-131637922 CAGCACTGAGCTGCAGAGGAGGG - Intergenic
1076731635 10:132442326-132442348 CAGCACAGAGCAGGGGCGCTGGG + Intergenic
1077110406 11:859711-859733 CAGCACAGCCCGGTGGAGGGCGG - Intronic
1077360218 11:2137513-2137535 CTGCACAGGGCAGTGAAGGGGGG + Intronic
1077364037 11:2154395-2154417 GAGCTCAGAGCAGAGGAGGCAGG - Intronic
1077538617 11:3136041-3136063 CAGCCCAGAGCAGATGGGGAGGG + Intronic
1077746747 11:4915304-4915326 TAGCACAGAGGACTCGAGGAAGG + Exonic
1077756616 11:5036994-5037016 CAGAACAATGCAGTGCAGGATGG + Intergenic
1077836795 11:5933281-5933303 AAGCACACAGGAGTGGGGGAAGG - Intronic
1078430371 11:11283517-11283539 GGGCACAGAGCATTGGAGGAAGG + Intronic
1078458711 11:11496587-11496609 CATCACAGAGAAGTAGATGAAGG + Intronic
1078507761 11:11965244-11965266 CTGCACAGAGCCGTGGGGAATGG + Intronic
1078521769 11:12069304-12069326 CGGGACAGAGCAGTGGCTGATGG - Intergenic
1080122926 11:28698088-28698110 CAGCAAATAGCAGTTGAGGCTGG - Intergenic
1080447093 11:32347293-32347315 CAGCCCTGAACAGTGGAGAAGGG + Intergenic
1080907725 11:36563313-36563335 TAGAACAAAGAAGTGGAGGAAGG + Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081570415 11:44287134-44287156 GAGGGCGGAGCAGTGGAGGACGG - Intronic
1083167314 11:60898617-60898639 CAGGTGAGAGCTGTGGAGGAGGG + Exonic
1083297787 11:61724587-61724609 CCGAACACAGCAGTGCAGGAGGG - Intronic
1083315483 11:61812486-61812508 CAGCACCGCACAGAGGAGGAAGG + Exonic
1083328853 11:61887571-61887593 CAGCAGAGAGCAGTGGAGAGAGG - Intronic
1083417339 11:62534218-62534240 CAGCACAGGGGAGTGAAGAAAGG + Intronic
1083641965 11:64150472-64150494 CTGCACCAAGCATTGGAGGAAGG - Intronic
1083712861 11:64559584-64559606 AAGGACAGAGGAGAGGAGGATGG - Intronic
1084000719 11:66294081-66294103 TAGCACGGCACAGTGGAGGATGG + Intronic
1084097303 11:66920147-66920169 TGGCACAGAGGAGGGGAGGAGGG + Intronic
1084702252 11:70795076-70795098 CAGCACAGAGGAGTCGAGGAGGG - Intronic
1084766397 11:71311787-71311809 AAGCACAGAGCAGGTGTGGAGGG - Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085220252 11:74867879-74867901 CAGCACAAACCAGAGGAGAATGG + Intronic
1085534914 11:77211950-77211972 CTTCTCAGAGCAGAGGAGGAGGG + Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1086547489 11:88014861-88014883 TAGTACTGAGCAGTGAAGGACGG + Intergenic
1086573002 11:88306519-88306541 CGGCACAGAGCTGTGGAGAGTGG + Intronic
1087017050 11:93564133-93564155 GAACAGAGAGCTGTGGAGGAAGG - Intergenic
1088182696 11:107129941-107129963 CAGCACAGTCCAGAGGAGGAAGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089185884 11:116614426-116614448 CAGCACAGAGCCGTCAAAGAAGG - Intergenic
1089253404 11:117180936-117180958 GAGCCCAGAGGAGTTGAGGAGGG - Intronic
1089639575 11:119838901-119838923 CAGCCCCGAGCTGAGGAGGAAGG + Intergenic
1089642058 11:119854234-119854256 CTGCACAGAGGAGTGAAGGAAGG - Intergenic
1089659634 11:119977632-119977654 CAACACAGAGGAATGGAGTAGGG + Intergenic
1089697904 11:120227053-120227075 CAGCACAGAGCAGTGGAGGAGGG + Intronic
1089882592 11:121789146-121789168 CAGCACACAGTGGGGGAGGAGGG + Intergenic
1090736090 11:129613300-129613322 AGCCACAGAGCAGTGGAGTAGGG + Intergenic
1091366818 11:135029107-135029129 CTGGGCAGGGCAGTGGAGGAAGG - Intergenic
1091403998 12:197630-197652 AGGCACAGAGGAGGGGAGGAAGG + Intronic
1092861528 12:12724104-12724126 CAGCGCAGAGGAGAGGAGGAGGG - Intergenic
1093053557 12:14532412-14532434 CAGCATGCAGCAGGGGAGGACGG - Intronic
1094008116 12:25777230-25777252 CAGCAAAGCACAGTGGAAGATGG + Intergenic
1095215878 12:39546896-39546918 AAGAACAGAGGAATGGAGGAAGG + Intergenic
1096123224 12:49102182-49102204 CTGCACAGAGAAGAGGCGGAAGG - Exonic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096488200 12:51998105-51998127 CAGGATAGTGCAGTGGGGGAAGG - Intergenic
1096928435 12:55175381-55175403 CAGCATCAAGGAGTGGAGGAAGG - Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097938394 12:65278535-65278557 GAGGACAGGGCAGAGGAGGAGGG + Intergenic
1098553037 12:71785633-71785655 AAGCCCAGACCAGTGGTGGAGGG + Exonic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1101013876 12:100479446-100479468 CAGCTCAAATCAGTGGAAGAAGG - Intronic
1101557190 12:105821440-105821462 CAGCCTAGAGGAGTGGAGGAAGG - Intergenic
1102519832 12:113471445-113471467 CAGCAGAAAGCGGTCGAGGATGG + Exonic
1102833045 12:116025066-116025088 CAGAACAAAGCAGTGGTGGGGGG - Intronic
1102903022 12:116653393-116653415 GAGCACAGAGCCATGCAGGAAGG + Intergenic
1103224462 12:119274869-119274891 CAGCATGGGGCAGTAGAGGATGG - Intergenic
1103573241 12:121858590-121858612 CAGCAGAGAGCAGAAGAGGAAGG - Intronic
1103722345 12:122981520-122981542 CAGGCCAGAGCAGGGGACGAAGG + Exonic
1103793632 12:123488733-123488755 CAGCACGGGGCAGCAGAGGAGGG + Intronic
1104350352 12:128039812-128039834 CAGCACGGAGGACTGGAGGGAGG + Intergenic
1104547264 12:129723590-129723612 GAGGACAGAGCCATGGAGGAAGG - Intronic
1104835031 12:131784180-131784202 CTGCACTGAGCAGTCCAGGAAGG + Intronic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1105603675 13:21909636-21909658 CCCCAGAGAGCTGTGGAGGAAGG + Intergenic
1106052310 13:26203241-26203263 CAGAGGAGAGCAGTGGAGAAGGG + Intronic
1106093927 13:26625563-26625585 CAGAACAAAAGAGTGGAGGAAGG - Intronic
1106209051 13:27624094-27624116 AAGCACAGAGCACTGGCGGGTGG - Intronic
1106810018 13:33350196-33350218 GAGCCCAGAGCAGAGGAGGGCGG + Intronic
1106848981 13:33767992-33768014 GAGCACAGAGAAGTGGCAGAGGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107719263 13:43230714-43230736 CAGCCCTGAGCGGTGGGGGAGGG - Intronic
1108081220 13:46738211-46738233 CAGCTCAGAGTGCTGGAGGAAGG + Intronic
1108525965 13:51286319-51286341 CAGAACAGGGCAGTGGGGCATGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109814032 13:67555859-67555881 CAACACAGAGCTGTGAAGGTAGG - Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110502491 13:76244708-76244730 CAGCATAACTCAGTGGAGGATGG + Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111855816 13:93635899-93635921 GAGCACAGAGCGCTGGAGAAAGG - Intronic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113380069 13:109796202-109796224 CAGCAGAGAGCATTGCAGCAGGG + Intergenic
1113755617 13:112808811-112808833 CTGCACATAGCAGGGGAGGCTGG - Intronic
1113852828 13:113427746-113427768 GAGCACAGAGCAGTGGCTCAAGG + Intronic
1113982525 13:114288423-114288445 CCGTGCTGAGCAGTGGAGGAAGG + Intronic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114531702 14:23400533-23400555 CATGTCAGGGCAGTGGAGGAGGG + Intronic
1115570653 14:34663568-34663590 CAGCACAGAGCAGAGAACCAGGG - Intergenic
1115875781 14:37859650-37859672 CATCACAAAGCAGTGGACAAAGG - Intronic
1118437009 14:65780642-65780664 CAGGGCAAAGCAGTGGTGGAAGG + Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119623023 14:76147155-76147177 AAGCAGGCAGCAGTGGAGGAGGG - Intergenic
1119781040 14:77277112-77277134 GTGCACAGCGCAGGGGAGGATGG - Exonic
1119946992 14:78705393-78705415 CTGCACAGAGCAGGTGGGGAAGG + Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120110809 14:80553406-80553428 CATCACATACCAGTGGAGTAAGG - Intronic
1121221972 14:92292372-92292394 CACCAAAGGGCAGTGTAGGATGG + Intergenic
1121725046 14:96141230-96141252 GAGGACAGACTAGTGGAGGAAGG + Intergenic
1122366680 14:101198584-101198606 GGGCACAGAGGAGCGGAGGAAGG - Intergenic
1122888586 14:104722566-104722588 CAGCAGAGAGCTGTGCAGGTAGG - Intergenic
1122937376 14:104966437-104966459 CAGGACAGAGCTGTGCAGAAGGG - Intronic
1122997191 14:105271648-105271670 CAGCACAGAGCAGAGGAGGCTGG + Intronic
1123941158 15:25217318-25217340 CAGCACAGTGCAGGAGAGCAGGG - Intergenic
1124030713 15:26008686-26008708 CATCAAAGACCAGTGGAGCACGG - Intergenic
1124460720 15:29888828-29888850 CAGCACAGAGGAATGCGGGATGG + Intronic
1124638694 15:31381573-31381595 CAGCTCAGGGGAGTGCAGGAAGG - Intronic
1124722506 15:32122163-32122185 CAGCACATCGCAGTGGGTGAGGG + Intronic
1124801036 15:32833051-32833073 AAGAGCAGAGCAGAGGAGGAGGG - Intronic
1125581267 15:40787676-40787698 GAACCCAGAGCAGGGGAGGAGGG + Intronic
1125714289 15:41810418-41810440 CAGGAGAAAGCAGTGGAGGCTGG + Intronic
1125932090 15:43607654-43607676 CAGCACAGGGCAGCTGAGGGTGG - Intronic
1125945189 15:43707128-43707150 CAGCACAGGGCAGCTGAGGGTGG - Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126346246 15:47697256-47697278 CAGAACAGAGAACTGCAGGAAGG + Intronic
1126534753 15:49749429-49749451 CAACAGAGAGCAGTGGAGTCTGG + Intergenic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127285220 15:57526845-57526867 CTGTGCTGAGCAGTGGAGGAGGG + Intronic
1129060011 15:72853236-72853258 GGGCTCACAGCAGTGGAGGAGGG + Intergenic
1129221020 15:74131604-74131626 CACCGCAGAGCTGTGGAGAAAGG + Intronic
1129457377 15:75683090-75683112 CAGCCCAGGGCCGGGGAGGAAGG - Intronic
1129519644 15:76177754-76177776 CAGCACAGAGCAGCTCTGGACGG - Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129985470 15:79916378-79916400 TAGCACAGAGCAGAGGAGGCTGG + Intronic
1130274449 15:82469203-82469225 CAGCCCAGGGCCGGGGAGGAAGG + Intergenic
1130466796 15:84196577-84196599 CAGCCCAGGGCCGGGGAGGAAGG + Intergenic
1130497468 15:84476959-84476981 CAGCCCAGGGCCGGGGAGGAAGG - Intergenic
1130589091 15:85201170-85201192 CAGCCCAGGGCCGGGGAGGAAGG + Intergenic
1130819456 15:87479090-87479112 CAGAACAGAGCACAGGAGGGAGG - Intergenic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131675851 15:94669211-94669233 GAGGGCAGAGCTGTGGAGGATGG + Intergenic
1132290310 15:100696117-100696139 CTGAACAGAGCAGGAGAGGATGG - Intergenic
1132295719 15:100732786-100732808 CAGGACACAGCACTGCAGGAGGG + Intergenic
1132777630 16:1604565-1604587 CAGCACAGGGCCGGGGAGGTGGG + Intronic
1133206147 16:4235013-4235035 CAGCTCATTGCAGTGGAGGCTGG - Intronic
1134129204 16:11637228-11637250 CACCACAGAGAAGTGGAGAAGGG + Intergenic
1135388744 16:22070189-22070211 CAGCAAAGAACAGTGAAGCACGG + Intronic
1136727799 16:32375762-32375784 CAGCACAGGGCAGTGATGCATGG - Intergenic
1137624225 16:49897472-49897494 CAGGAAAGAGCAGGGCAGGAAGG - Intergenic
1137709675 16:50557814-50557836 AAGCACAGGGCTGTGGAGGTTGG + Intronic
1138956030 16:61971477-61971499 AAGCACAGAGCAAGGGAGGTGGG + Intronic
1139355530 16:66365221-66365243 CAGGAGAGGGCAGAGGAGGAGGG - Intergenic
1139595431 16:67955052-67955074 GTGCACAGGGCATTGGAGGATGG - Intronic
1139743217 16:69053555-69053577 CAGACAAGAGCAGTGGATGAAGG - Intronic
1140192206 16:72827724-72827746 TAGGACCGAGGAGTGGAGGATGG - Intronic
1140840529 16:78834280-78834302 CAGCACAGAGCAGTGTTCAATGG - Intronic
1140953374 16:79839972-79839994 CAGCACACAGCCGTGGAAGCTGG - Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141422689 16:83926857-83926879 AAGCGCAGAGCAGAGGAGGCTGG - Exonic
1141461152 16:84179534-84179556 CAGCACAGAGCTGCGGAGGGAGG - Exonic
1141522600 16:84591136-84591158 TAATACAGAGCAGTGGAGGGTGG - Intronic
1141909908 16:87051732-87051754 CAGGACAGGGCTCTGGAGGAGGG - Intergenic
1141987840 16:87591346-87591368 GGGCACGGAGCAGAGGAGGATGG + Intergenic
1142226433 16:88879966-88879988 CAGCACAGAGCCCTGGACGAGGG - Intronic
1142257829 16:89023798-89023820 CAGCCCCGAGCAGTGGAGGTGGG - Intergenic
1142260367 16:89039966-89039988 CACCCCAGAGCAGTGGGGGCGGG + Intergenic
1142424545 16:89994356-89994378 CAGCAAAGAGCTGCGGAGCATGG - Intergenic
1202998636 16_KI270728v1_random:141992-142014 CAGCACAGGGCAGTGATGCATGG + Intergenic
1203130233 16_KI270728v1_random:1678396-1678418 CAGCACAGGGCAGTGATGCATGG + Intergenic
1142508985 17:382836-382858 CTGCACAGAGAAGGGAAGGACGG + Intronic
1142621512 17:1168462-1168484 GAGCACAGAGCTTTGCAGGATGG + Intronic
1142864474 17:2782281-2782303 CAGCTCAGAGCTCGGGAGGATGG - Intronic
1143361460 17:6374953-6374975 CAGCACAGGGGAGTGAGGGATGG + Intergenic
1143771294 17:9170636-9170658 CAGCACAGAGAGGTGGGGGCGGG + Intronic
1143982876 17:10885075-10885097 CAGCCCTGAGCAGGTGAGGATGG - Intergenic
1144085272 17:11802671-11802693 TAGGACAGAGCAGACGAGGAAGG + Intronic
1144190940 17:12845115-12845137 TAACTCAGAGAAGTGGAGGATGG - Intronic
1144458418 17:15437556-15437578 CACCAGAGAGCAGTGTGGGAGGG + Exonic
1144623874 17:16834572-16834594 CAGCACCGAGGACTGGAGGGAGG + Intergenic
1144842677 17:18197843-18197865 AAGCACAGAGCTGTGGTGTAAGG + Intronic
1144882555 17:18438144-18438166 CAGCACCGAGGACTGGAGGGAGG - Intergenic
1145149679 17:20506242-20506264 CAGCACCGAGGACTGGAGGGAGG + Intergenic
1145247644 17:21280079-21280101 CAGCACAGAGAAGAGGAGGCTGG + Intergenic
1145733349 17:27210401-27210423 CATGTCTGAGCAGTGGAGGAAGG + Intergenic
1146684050 17:34828412-34828434 GAGCACAGGGGAGGGGAGGATGG - Intergenic
1147399019 17:40168016-40168038 CAGCACAAAGCTCAGGAGGATGG - Intronic
1147464362 17:40599351-40599373 CGTCACAGAGCAGGGGAGAAAGG + Intergenic
1147578167 17:41614276-41614298 CAGCACCGAGGACTGGAGGGAGG + Intronic
1147602204 17:41753771-41753793 GAGCTCAGGGCAGTGGAGGGAGG - Intergenic
1147658727 17:42105641-42105663 CAGCACAGAGAGGTGGGGGCAGG - Intronic
1147727036 17:42572220-42572242 CCACCCAGAGCAGAGGAGGAAGG - Exonic
1147757082 17:42775800-42775822 CATAACAGTGCAGTGGGGGAGGG - Intronic
1148229740 17:45924439-45924461 CAGCAAAGAGGAGTGGAGGCCGG - Intronic
1148745109 17:49913802-49913824 CAGCACCCAGAAGAGGAGGATGG - Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1148863852 17:50618557-50618579 TGTCACAGAGCATTGGAGGATGG - Intronic
1149129595 17:53282094-53282116 CCCCACAGAGCAGTGGACCACGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149515208 17:57275926-57275948 GAGCACAGAGAACTGAAGGAGGG - Intronic
1151376591 17:73693208-73693230 CAGGAGAGAGGAGAGGAGGAGGG - Intergenic
1151654057 17:75487358-75487380 CAGCAGAGAACAGTGGAGAGAGG - Intronic
1151957241 17:77386494-77386516 CAGCTCAGGGCAGTGGGGGTGGG + Intronic
1152167128 17:78717076-78717098 CAGCACGTGGCAGTGGGGGAGGG - Intronic
1152218475 17:79048118-79048140 CAGCACAGCGCAGGGGTGGAAGG - Exonic
1152272264 17:79331544-79331566 CAACACTGAGCAGTGCAGGCTGG - Intronic
1152529652 17:80910110-80910132 CAGGACAGAGCACTGGAGAGGGG - Intronic
1152630661 17:81409434-81409456 CAGCCCACAGCTGTGAAGGAGGG + Intronic
1153264708 18:3258743-3258765 CAACACAGAAAAGTGGAGTATGG + Intergenic
1153326598 18:3826880-3826902 CAGGGCAGAGCAGCGGTGGAGGG + Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1155212969 18:23619095-23619117 CAGCAGAGGCCAGTGGATGACGG + Intronic
1155558561 18:27049863-27049885 CAGCACAGAGGAGTGGGTGGAGG + Intronic
1156074250 18:33254139-33254161 TAGCACAGAGAATAGGAGGACGG + Intronic
1156526116 18:37768848-37768870 CAGCAGGGAGCACTGAAGGAAGG + Intergenic
1156752433 18:40475380-40475402 CAGCACAGAGGAAAGGTGGAAGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157675041 18:49562429-49562451 CAGCACAGAGAAGTGGCTGGGGG - Intronic
1157831532 18:50861032-50861054 CAGAACCGAGGAGTGGAGGTGGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158615258 18:58981156-58981178 CAGCACAAAGGAGTCAAGGAGGG + Intronic
1159884842 18:73894157-73894179 CAGCAGAGAGCAGTGTACTAAGG - Intergenic
1159902776 18:74063618-74063640 CATCTCAGAGCAGTGGGGGAAGG - Intergenic
1160420868 18:78742949-78742971 CACCTCAGAGCAGGGGTGGAGGG - Intergenic
1160906294 19:1453196-1453218 CAGCCCAGTGCAGTGGCTGATGG + Intronic
1161051419 19:2165628-2165650 CAACAGAGAGAAGTGGAGGCTGG - Intronic
1162046274 19:8002428-8002450 CAGGACACAGCAGCGGAGCAGGG + Intronic
1162183877 19:8889529-8889551 CAGGCCTGAGCTGTGGAGGAGGG + Exonic
1162470392 19:10869509-10869531 CATCACAGAGGAGTGGGAGAGGG + Exonic
1162939134 19:13997580-13997602 CAGCACAAAGCTCTGGAGGCTGG - Intronic
1163497021 19:17652535-17652557 CAGCCCAGAGAGGAGGAGGAGGG - Intronic
1163505440 19:17703249-17703271 CAGCACAGGGAATTGGAGGAAGG + Intergenic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165031470 19:33000729-33000751 GAGCACAGAACAGAGGCGGAGGG - Intronic
1165221194 19:34317954-34317976 TAGCACAGAGCACTGGGGGAAGG + Intronic
1165859440 19:38899587-38899609 CAGGACAGAGCAGTCGGTGACGG - Exonic
1166359997 19:42249101-42249123 CAGCCCAGGGTAGTGCAGGAAGG + Exonic
1167445225 19:49533646-49533668 CAGCACAGGGCAGGGCTGGAGGG + Intronic
1167601418 19:50457216-50457238 GAGCACGGAGGAGAGGAGGAGGG - Intronic
1167647610 19:50714124-50714146 CAGGACAGAGCTGGGGAGCAGGG - Intronic
1167722821 19:51190574-51190596 CAGAACAGAGCAGTGGGGCCAGG - Intergenic
1167761492 19:51452658-51452680 CAGAACAGAGCAGTGGGGCCAGG + Intronic
1167798537 19:51726304-51726326 CAGCCCAGAGCAGAAGGGGAGGG + Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168649914 19:58086360-58086382 CAGTACAGAGAAGAGGAGGTGGG - Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925049201 2:798044-798066 CAGCAGAGAGCGGTGGAGAGAGG - Intergenic
926220802 2:10934479-10934501 CAGCACAGGGCAGGTGAGGCAGG - Intergenic
926253304 2:11168658-11168680 CTGGACAGAGCAGAGGAGGGAGG - Intronic
926258718 2:11236350-11236372 CAGAAAAGAGCAGAGGAGGTAGG + Intronic
926682899 2:15677450-15677472 CTGCCCAGAGCAGGGGAGGCTGG + Intergenic
927201722 2:20582439-20582461 CAGCACAGATAAGTGAGGGAGGG + Intronic
927494056 2:23540751-23540773 CCACAGAGGGCAGTGGAGGAGGG - Intronic
927888502 2:26733144-26733166 CAGCACAGCAGAGTGGAGGTGGG + Exonic
928220915 2:29402065-29402087 CACAAGAGATCAGTGGAGGAAGG + Intronic
929106268 2:38368840-38368862 CAGCACTGAGAGGTGGAGGTTGG + Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
930796453 2:55397020-55397042 CACCACAGTGAACTGGAGGAGGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931266193 2:60662320-60662342 GAGCAGAGAGCAGTGGAAGCAGG - Intergenic
931852897 2:66270911-66270933 CAAGACTCAGCAGTGGAGGAGGG - Intergenic
932073545 2:68643719-68643741 GAGCCCCGAGCAGAGGAGGAAGG + Exonic
932132072 2:69196952-69196974 CAGCACAGAGCAGGGGCTCAGGG + Intronic
932705377 2:74020604-74020626 CAGCAGAGACCAGTGGGGGCAGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933695157 2:85212220-85212242 CACCACAGAGCTCTGCAGGAGGG - Intronic
933800029 2:85953361-85953383 AAGCACAGAGCAGAGAATGAAGG + Intergenic
934318171 2:91945311-91945333 CAGCACAGGGCAGTGATGCATGG + Intergenic
935575333 2:104703656-104703678 CTGCAAAGAGGAGAGGAGGATGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936826179 2:116584170-116584192 TTGCACAGAGCAGAAGAGGAAGG + Intergenic
936979362 2:118249934-118249956 CAGCCCAGAGCAGTCTGGGAAGG + Intergenic
937324982 2:120985073-120985095 CAGGACAGAGGAGTGGGGGCTGG - Intronic
937340641 2:121088565-121088587 CAGGACAGATAAGTGGTGGAAGG + Intergenic
937612678 2:123881014-123881036 CAACACACAGCAGTGCAGAAAGG - Intergenic
937862646 2:126723000-126723022 CAGCAGACAGCAGTGGCAGAGGG + Intergenic
937886491 2:126902806-126902828 CAGCCCAGAGAAGGGCAGGAAGG + Intergenic
937913490 2:127087615-127087637 CAGCCAAGGGCAGTGCAGGACGG + Intronic
937927915 2:127182141-127182163 CAGCTCAGGGCGGTGGAGGCTGG - Intergenic
937987372 2:127644093-127644115 GAGCACAGTGCTGTGCAGGATGG - Intronic
938124993 2:128664925-128664947 CATGGCAGAGCAGTTGAGGATGG - Intergenic
938565735 2:132516723-132516745 CATCACAGGCCAGTGGAAGAAGG - Intronic
938958381 2:136319392-136319414 CAGCCCTGCGGAGTGGAGGAAGG - Intergenic
939041710 2:137197270-137197292 CAGCAGAGAGAGATGGAGGAAGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940021036 2:149156145-149156167 CAGCACAGAGCATTTGAGAAGGG + Intronic
944203743 2:197135755-197135777 AGGCACAGAGCAGGGGAGCAGGG - Intronic
945949245 2:216023210-216023232 CAGCACAGAGGATTATAGGAAGG - Intronic
946876312 2:224133108-224133130 CATCACAGGCCAGTAGAGGAAGG + Intergenic
947107517 2:226682976-226682998 TAGGGCAGAGCAGTGGAGGAAGG - Intergenic
947851416 2:233291606-233291628 CAGCACAGAGAAGAAGAGGGAGG + Intronic
948301917 2:236914028-236914050 CAGGGCAGAGCAGGGGTGGATGG + Intergenic
948423580 2:237874930-237874952 GAGGACAGGGCAGCGGAGGAGGG + Intronic
948729785 2:239955684-239955706 CAGGACAGACCAGGGCAGGAAGG + Intronic
948903972 2:240969105-240969127 CAGCACAGTGCAGAGGAGACAGG + Intronic
948981143 2:241495480-241495502 CAGCACACTGCAGGGGTGGAAGG + Exonic
949036128 2:241816505-241816527 CAGGACCGAGGAGTGGAGGCTGG - Exonic
1168771435 20:419334-419356 AAGCCCAGATCTGTGGAGGAGGG - Exonic
1168878525 20:1186666-1186688 CTGCACAGAACTTTGGAGGAGGG - Intronic
1170397000 20:15936984-15937006 CAGCACAGAGGCCTGGAAGAAGG - Intronic
1170421987 20:16202157-16202179 CAGCACAGCACAGAGGAGAATGG - Intergenic
1170703857 20:18727682-18727704 CAGCTCAGGGCTGGGGAGGATGG - Intronic
1170730480 20:18970624-18970646 CAGAACAGAGCAGTGGCAGGAGG - Intergenic
1170733684 20:18995208-18995230 CAGCACAGAATAGGGGAGCAAGG + Intergenic
1170791114 20:19510377-19510399 CAGCACACAGCAGTGGGGCATGG - Intronic
1171167000 20:22980898-22980920 CAGAGCAGAGCAGAAGAGGATGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172614014 20:36271737-36271759 CAGAGCAGCGCAGTGAAGGATGG - Intergenic
1172694638 20:36813933-36813955 CAGCTCAGATCAGAGGCGGAAGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173224306 20:41152993-41153015 CTGCAGAGGGCACTGGAGGAAGG - Intronic
1173558364 20:43983853-43983875 CAGCACAGAGAGGCAGAGGAGGG + Intronic
1174375944 20:50126817-50126839 ATGCCCAGTGCAGTGGAGGAAGG - Intronic
1175120272 20:56711146-56711168 CAGCAAGGAGGAGAGGAGGAGGG - Intergenic
1175339699 20:58220628-58220650 CAGCACAGCTCTGTGGTGGATGG - Intronic
1175366635 20:58460686-58460708 CATGACAGAGCAGAGGAGAATGG + Exonic
1175590073 20:60182364-60182386 CAGCCCAGAGCAGCTGAGGTGGG - Intergenic
1176063786 20:63183697-63183719 CACCTCAGACCAGGGGAGGAGGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178156182 21:29856803-29856825 CAGCACAAAGAACAGGAGGATGG + Intronic
1178707352 21:34886888-34886910 CAGCACGGAGCAGAGGAAGTTGG + Exonic
1178853922 21:36235397-36235419 CAGAACAGAGGAGTAGAGTAAGG + Intronic
1178978766 21:37243630-37243652 CAACCCAGAGAAGGGGAGGACGG - Intronic
1179008073 21:37531766-37531788 CAGGGCAGAGGAGGGGAGGAAGG + Intergenic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1179554138 21:42162025-42162047 CAGCCCAGAGAAGGGGAGCAGGG + Intergenic
1179666092 21:42913544-42913566 GAGCACAGGGCACTGGTGGAGGG + Intergenic
1180150390 21:45944215-45944237 GAGCCCAGAGCAGGTGAGGAGGG + Intergenic
1180200383 21:46220567-46220589 CAGCAGAGAGCAGGGCAGGTGGG + Intronic
1180306347 22:11128995-11129017 CAGCACAGGGCAGTGATGCATGG + Intergenic
1180544866 22:16491178-16491200 CAGCACAGGGCAGTGATGCATGG + Intergenic
1180734952 22:18009539-18009561 CATGTCTGAGCAGTGGAGGAAGG - Intronic
1180737077 22:18025069-18025091 CAGCGCAGAGCCCTGGGGGAGGG + Intergenic
1180904045 22:19396045-19396067 AAGCACAGCACAGTCGAGGATGG + Intronic
1181234968 22:21443211-21443233 CAGCCCACAGCAGTTCAGGAGGG - Intronic
1181563218 22:23717541-23717563 CAGCACAGAGCAGACGACGATGG - Intergenic
1181595602 22:23912580-23912602 CAGCACAAACCTGTGGAGGGGGG - Intergenic
1181804271 22:25365639-25365661 CAGCAGAGAGCCGTGGCGGGCGG - Intronic
1181864752 22:25846328-25846350 CAGCCCAGAGGAGATGAGGATGG - Intronic
1181885534 22:26019144-26019166 CAGCACATAGCAGCAGAAGATGG - Intronic
1182551357 22:31102521-31102543 GAGCACAGATGAGTGGCGGATGG + Intronic
1182681325 22:32082289-32082311 GAGCACAGGGGAGTGGAGGCAGG + Intronic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1183319584 22:37156911-37156933 CAGCACCGAGCAGGGGTGGGCGG - Intronic
1183516617 22:38270573-38270595 CAGCACAGTGCAGGGCAGCATGG + Intronic
1183786004 22:40029600-40029622 CAGCACAGGGCAGGGCAGGCAGG - Exonic
1184074659 22:42168658-42168680 CAGCACAGAGCAGTCGGAGCGGG - Exonic
1184285336 22:43467713-43467735 CAGAACACAGCAGAGGGGGATGG - Intronic
1184382302 22:44152551-44152573 CAGCACTGAGCAGAGGCTGAAGG - Intronic
1184714432 22:46272929-46272951 CAGCACAGTGCATTGCAGGTGGG + Intronic
1184919156 22:47593441-47593463 CAGCACAGAGCCGTTCATGAGGG - Intergenic
1184938450 22:47741900-47741922 CAGCTCAGACCAGAGCAGGAGGG - Intergenic
1184950247 22:47836820-47836842 CAGCACAGCGTAGTTGTGGAAGG + Intergenic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950180991 3:10913018-10913040 TACCACAGAGTAGTGGAGAAAGG + Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951643817 3:24865583-24865605 CAGGACAGAGAGGTGGAAGAGGG - Intergenic
952342924 3:32460198-32460220 CAGCACAGGGCAGTGGCACAGGG - Intronic
952494832 3:33906784-33906806 CACCACACAGCACTGGAGCACGG - Intergenic
953022168 3:39121573-39121595 CAGCTCAGAGCCCTGAAGGAGGG - Intronic
953579964 3:44144940-44144962 CTGCACAGGGCAATGGAGAAAGG - Intergenic
954130958 3:48560771-48560793 CAGCAAAGAGCAGAGCAGGAGGG + Intronic
954361815 3:50126206-50126228 CAGCACAGTTCTGGGGAGGAAGG + Intergenic
954613393 3:51957814-51957836 AAGCACAGAGCTGAGGAGGTAGG + Exonic
955398281 3:58573065-58573087 CAGCAGTGAGCTGTGGATGATGG + Intronic
955554845 3:60125963-60125985 CAGCACAGAACAGAGAAAGAAGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
959255477 3:104006393-104006415 CAGCACAAAGTCCTGGAGGAAGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960270930 3:115673772-115673794 GAGAACTGAGCAGTGGAGGAGGG + Intronic
960988812 3:123297291-123297313 CAGCACAGAGCAGACAGGGAGGG - Intronic
961656843 3:128447352-128447374 CTGCACTGAGCACTGGAGGAGGG - Intergenic
961749009 3:129084756-129084778 CAGCACATGGCAGAGGAGGCCGG - Intergenic
962655715 3:137542377-137542399 CAGCACAGTGCAGGGGATGGGGG + Intergenic
962876161 3:139537742-139537764 CAGCACAGCACAGTGAGGGAGGG - Intronic
963052544 3:141154237-141154259 CAGAGCAGGGCAGAGGAGGAGGG + Intergenic
963062167 3:141233905-141233927 CATCACAGAGCGGTGTAGGGAGG - Intronic
963296127 3:143548412-143548434 CAGCACACAGCAGTGTAGCCCGG - Intronic
964295969 3:155233454-155233476 CAGCACATAGCAGTGACAGAAGG + Intergenic
964435254 3:156644310-156644332 CAGAGCAGAGCAAGGGAGGAGGG - Intergenic
964890945 3:161533663-161533685 CAGAAGATAGCACTGGAGGAAGG + Intergenic
965403256 3:168239065-168239087 AAGCACAGAGGAGAGGAAGAAGG - Intergenic
966403939 3:179575655-179575677 CAGCACAGAACTGTGGAAAATGG + Intronic
966697301 3:182803747-182803769 CAACACAGACTCGTGGAGGAAGG - Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
967290489 3:187915049-187915071 AAGTACAGAGCAGTGGGGGAAGG + Intergenic
967662766 3:192133292-192133314 TAGGACAGAAAAGTGGAGGAAGG - Intergenic
967703726 3:192624451-192624473 GAGCAGAGAGAAGAGGAGGAAGG + Intronic
968195101 3:196699986-196700008 CAGCGCAAAGCAGTGGAGCTTGG - Intronic
968447853 4:661411-661433 GGGCACAGAGCTGTGGACGAGGG - Intronic
968497809 4:927920-927942 CAGCACAGAGCTGCAGAGGCTGG + Intronic
968544641 4:1192579-1192601 CAGCACAGAGCAGCAGAGGGTGG + Intronic
968844530 4:3032901-3032923 CAGCACAGAGCAGAGGAGAGGGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969208328 4:5665584-5665606 CAGCACAAGGGAGAGGAGGAAGG + Exonic
969238860 4:5887024-5887046 CAGGACAGTGCAGGGGAGGCAGG + Intronic
969280487 4:6167340-6167362 CAGGCCAGAGCAGAGGAGGCTGG - Intronic
969345687 4:6568385-6568407 CAGCACGGAGCAGTGGGGGTGGG + Intergenic
969519087 4:7665384-7665406 CAGCAGAGAGCAGTGGAGACTGG - Intronic
969561451 4:7950701-7950723 CAGCCCAGAGCAAAGGAAGAGGG + Intergenic
969640877 4:8397728-8397750 CAGCACGGGGCAGGGCAGGAAGG - Intronic
969926452 4:10590284-10590306 CAGGAGAGAGAAGTGGAAGAGGG - Intronic
969948062 4:10805227-10805249 CAGAACAGAAAGGTGGAGGAAGG + Intergenic
970049255 4:11895163-11895185 CATCGCAGAGCAGTGGTGGAAGG - Intergenic
970581921 4:17481497-17481519 CAACACAGAGTGTTGGAGGAGGG + Intronic
970909172 4:21254638-21254660 CAGCATTAAGCAGTGGAGGTAGG - Intronic
971350010 4:25847050-25847072 CAGAACAGAGGAGCTGAGGAAGG - Intronic
972619974 4:40738020-40738042 GGGCACAGAGCATTGGAGGATGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975381378 4:73704095-73704117 TAACATAGAGCAGTGGAGCATGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977950658 4:102966598-102966620 CAGCACAGGGCAGTGATGCATGG + Intronic
979096865 4:116562184-116562206 CATCACAGAGCAGGAGAAGAAGG + Intergenic
980077163 4:128306161-128306183 CAACCCAGAGCAGAGGAGGTGGG + Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
981157070 4:141450820-141450842 CAGGACAAAGAAGAGGAGGAAGG - Intergenic
981421652 4:144556927-144556949 CATCACAGAGCAGTGTAGAGGGG + Intergenic
981719447 4:147786861-147786883 CAGCAGAGAACTGTGGAGCAGGG - Intronic
982056853 4:151559415-151559437 CAGCACAGGGCAGTGGGGGCTGG - Intronic
982706025 4:158710934-158710956 TTTCACAGAGCAGTGAAGGATGG - Intronic
983354960 4:166645231-166645253 CATCACATGGCAATGGAGGAAGG + Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984127211 4:175826307-175826329 CGCCACTGAGCAGGGGAGGAGGG - Intronic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
984559056 4:181246934-181246956 CAGCAGAGAGCAAAGGAGGATGG + Intergenic
984587159 4:181577966-181577988 CATGAAAGAGCAATGGAGGATGG - Intergenic
984594125 4:181648157-181648179 CAGAACAGACCAATGGAGCAGGG - Intergenic
984771075 4:183436580-183436602 CAGCACAGTGCAGTAGGCGATGG + Intergenic
985369285 4:189268056-189268078 TTGCACAGAGGAGTGGACGATGG + Intergenic
985369293 4:189268106-189268128 TTGCACAGAGGAGTGGATGATGG + Intergenic
985369313 4:189268231-189268253 TTGCACAGAGGAGTGGATGATGG + Intergenic
985369317 4:189268256-189268278 TTGCACAGAGGAGTGGATGATGG + Intergenic
985369323 4:189268306-189268328 TTGCACAGAGGAGTGGATGATGG + Intergenic
985487989 5:162680-162702 CTGCTCAGTGCAGTGGAGGAGGG - Intronic
985552840 5:542024-542046 CAGCCCTGAGCAGAGGACGAAGG + Intergenic
986035566 5:3933761-3933783 CAAGACCAAGCAGTGGAGGAGGG - Intergenic
986272295 5:6243897-6243919 CTGCATGGAGCACTGGAGGAAGG - Intergenic
986283830 5:6345590-6345612 CAGCAGAGAACAGAGGAGGAGGG + Intergenic
986290447 5:6395294-6395316 CAGCACAAGGCAGGGGAGGCAGG + Intergenic
986420075 5:7571411-7571433 CAGAACAGAAAGGTGGAGGAAGG - Intronic
987829509 5:23077206-23077228 AAGCACAGAGCAATGGAGCTTGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
988983497 5:36595105-36595127 GAGTATAAAGCAGTGGAGGAAGG + Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990805351 5:59654236-59654258 GAGCACAGGGGAGGGGAGGAAGG + Intronic
990833703 5:59990343-59990365 CAGCATAGAGCTATGGAGAAAGG - Intronic
991281630 5:64921092-64921114 GAACACAGAGCAGTGTAGGGAGG - Intronic
992120828 5:73590249-73590271 GAGGATAGAGCAGAGGAGGATGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992565352 5:77990557-77990579 CGGCACAGAGCAGTGCATGCTGG + Intergenic
992980524 5:82166333-82166355 CAACACAAAGCAGTGGTGGTGGG - Intronic
993524963 5:88954069-88954091 CAGCACAGAGGAGGGAGGGAGGG - Intergenic
993850098 5:92997561-92997583 ATGCACAGGGCAGTGAAGGAAGG + Intergenic
994363783 5:98886977-98886999 CAACACAGGGCAGAAGAGGAAGG + Intronic
997183456 5:131857703-131857725 CAGCAAAGTGAGGTGGAGGAAGG - Intronic
997422389 5:133779755-133779777 CAGCAGAGAGCTGGGGAGGTGGG - Intergenic
997564344 5:134875374-134875396 CAGCAGAGAGTTGTGGAGAAGGG + Intronic
999133364 5:149301067-149301089 CAGCACAGACCAGGGGAAGAGGG - Intronic
1000776585 5:165427149-165427171 CAGCAGTGAGCAATGGAGAATGG + Intergenic
1001403658 5:171461181-171461203 CAGCAGAGGGCAGTGGGGAAGGG + Intergenic
1001673797 5:173495948-173495970 CAGTACAGAGCAGTGGATGGTGG + Intergenic
1001928541 5:175657170-175657192 CAGCCCAGTGCAGGGGAGGCAGG - Intergenic
1002254670 5:177950430-177950452 CAGGACAGAGCAGTGAAGGACGG - Intergenic
1002440514 5:179262095-179262117 CAGTGCAGAGCAGTGGAAGCGGG + Intronic
1002759204 6:188888-188910 CAGCCCAGAGCTGTGGGGAAAGG - Intergenic
1002926060 6:1606334-1606356 CATCACAGACCACTGGAGCAAGG - Intergenic
1003460794 6:6325847-6325869 CAGTAGTGAGCAGTGGGGGAAGG + Intergenic
1003496020 6:6663871-6663893 GAGCACAGAGCGCTGGAGGAGGG - Intergenic
1003746252 6:9005739-9005761 TAGCACAGAGCAGGGGGAGATGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004324702 6:14664462-14664484 AAGCACAGATGAGTGGAGGGCGG + Intergenic
1004721886 6:18274983-18275005 CAGAACAGGGCAGGGTAGGAGGG - Intergenic
1004978844 6:20999322-20999344 CAGCATGCAGCAGTGGAGAAGGG + Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006312480 6:33270652-33270674 CAAGACAGTGCAGTGGAGGCCGG + Intronic
1006656866 6:35602706-35602728 CAAAACAGTGCAGAGGAGGAAGG - Intronic
1006877230 6:37308377-37308399 CAGCAAAAAGCAGTGGAGAAAGG - Intronic
1006942724 6:37763568-37763590 CAGCTCAGCCCAGGGGAGGATGG - Intergenic
1007052221 6:38843953-38843975 CACCACAGCACAGTAGAGGAAGG - Intronic
1007224789 6:40305399-40305421 CTGCACCCAGCATTGGAGGAAGG + Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008893157 6:56519533-56519555 CACCCCAGAGGAGTGGAGGGAGG - Intronic
1008955002 6:57205901-57205923 CAGCAGAGTGGAGAGGAGGAAGG + Intronic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011746356 6:90411305-90411327 AAGGCCAGAGAAGTGGAGGAAGG + Intergenic
1012665752 6:101966687-101966709 CAGCTCAGAGCAAGTGAGGAGGG - Intronic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013475899 6:110507047-110507069 CAGAACAGAGCTCTGAAGGAAGG + Intergenic
1014108274 6:117591517-117591539 GAGCAGAGAGGAGTGGAGTAAGG + Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014215035 6:118745176-118745198 CAGCCCAGGGCAGAGGGGGAAGG + Intergenic
1015059936 6:128951017-128951039 CAGGATAGAGAAGGGGAGGAAGG + Intronic
1015216710 6:130758591-130758613 AAGCACAGTCCAGTGGAGAATGG - Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1015907900 6:138136519-138136541 TAATACAGAGTAGTGGAGGAAGG + Intergenic
1016295291 6:142566875-142566897 CAGAAGAGAGCAGGGCAGGAAGG + Intergenic
1017127609 6:151080416-151080438 CAGGAGAGGGCAGAGGAGGAGGG + Intronic
1017862410 6:158411307-158411329 CAGCACAGACCTGTGGGGGGTGG + Intronic
1017924299 6:158897363-158897385 GGGCACAGAGCTGTGAAGGAGGG - Intronic
1018999364 6:168735788-168735810 CAGCACAGAGCAGAGAGGGCTGG + Intergenic
1019135929 6:169907711-169907733 CAGCAGGAAGCAGTGGAGGAAGG + Intergenic
1019201583 6:170320796-170320818 CAGGAGTGAGCAGAGGAGGAAGG + Intronic
1019317694 7:397411-397433 CAGCACAGAGCCAAGGAGGATGG + Intergenic
1019641324 7:2105323-2105345 CAGCTAAGAGCAGGGGAGGAAGG + Intronic
1020473060 7:8561416-8561438 CAGCCCAGAGGAGGGAAGGAGGG - Intronic
1020473785 7:8570738-8570760 GAGCAGAGAGAAGTGGAGTAGGG + Intronic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021785814 7:24151501-24151523 AAGCACAGAGAAGGGCAGGATGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1021991293 7:26143860-26143882 CAGTGCAGAGGAGTGGCGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022272572 7:28824056-28824078 CCGCTCAGAGCCTTGGAGGAGGG - Exonic
1022892889 7:34719081-34719103 CAGCTGAGAGAAGTGGGGGATGG + Intronic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023814491 7:43939182-43939204 CAGAGCAGGACAGTGGAGGAGGG + Intronic
1023818827 7:43969144-43969166 CATCACAGAGGAGTGGAGTAGGG - Intergenic
1023858674 7:44202851-44202873 CAACACAGAGCAGTGAATGTAGG - Intronic
1023863895 7:44229748-44229770 CAGCACAGGCCAGTGCAGGCTGG + Intronic
1024081962 7:45863624-45863646 CAGCACAGGGAAGACGAGGATGG + Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024156766 7:46633986-46634008 AGGCAATGAGCAGTGGAGGAAGG - Intergenic
1024248808 7:47490929-47490951 CGACACAGAGCACTGAAGGATGG - Intronic
1024470774 7:49767194-49767216 CAGCAGAAAGCAGTGCAGGAAGG - Intergenic
1025842695 7:65165873-65165895 CAGCTGAGGGCATTGGAGGAGGG + Intergenic
1025880350 7:65530095-65530117 CAGCTGAGGGCATTGGAGGAGGG - Intergenic
1025893087 7:65672509-65672531 CAGCTGAGGGCATTGGAGGAGGG + Intergenic
1026258741 7:68735868-68735890 CAGCACAGGGCAATGCAGGGAGG - Intergenic
1026497727 7:70918317-70918339 CAGTATAGATAAGTGGAGGATGG + Intergenic
1026727416 7:72880145-72880167 GAGCACAGAGAGGAGGAGGAAGG - Intronic
1027475136 7:78620935-78620957 AAGCACAGATCAGGGGAGGTAGG + Intronic
1027725632 7:81802159-81802181 CAGGCCAGAGTAGAGGAGGAAGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028929955 7:96401914-96401936 CAGAATAGAAAAGTGGAGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029082884 7:97988783-97988805 AGGCACAGAGGAGAGGAGGAGGG - Intronic
1029219699 7:98978535-98978557 CAGCCCAGAGCACTGGAGCCAGG - Intronic
1029743875 7:102506110-102506132 CATCACAGAGGAGTGGAGTAGGG - Intronic
1029761864 7:102605273-102605295 CATCACAGAGGAGTGGAGTAGGG - Intronic
1030338936 7:108355673-108355695 CAGCACAGTACAGTGGACAAAGG - Intronic
1030781431 7:113605403-113605425 GAACACAGAGCAGGGGAGAAAGG + Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032257977 7:130311965-130311987 CAGAGCAGAGCAGCTGAGGAAGG + Intronic
1033290718 7:140080517-140080539 CGGTAGAGAGCAGCGGAGGAGGG + Intergenic
1033309119 7:140247160-140247182 CAGAACAGGGCTGTGGAGGGGGG - Intergenic
1033318258 7:140316202-140316224 CAGAACCGAGCCATGGAGGAAGG + Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034336755 7:150328886-150328908 TAGCACAGTCCAGTGAAGGACGG + Intronic
1034455872 7:151169432-151169454 CAAGACAGAGCAGGGCAGGAGGG + Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034736980 7:153438636-153438658 CTTCACAGAGCAGTGTGGGAAGG - Intergenic
1034950084 7:155291094-155291116 CAGCAGATAGCAGTGGCAGAGGG - Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035685318 8:1519858-1519880 GGGCACAGAGCAGGGGAGCATGG + Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037581012 8:20246026-20246048 CAGCACAGGGCAGTGGGAAAGGG - Intergenic
1037765053 8:21767595-21767617 CAGCACAGAGCAGGGGCGTCCGG + Intronic
1037885816 8:22595700-22595722 TAGCTCAGAGCAGTGGCTGATGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040602929 8:48902290-48902312 CAGCACAAAGCTAGGGAGGATGG - Intergenic
1041043203 8:53867116-53867138 AAGCACAGAGCGATGGAGGAAGG - Intronic
1041090502 8:54297095-54297117 CAGGGCAGGGCAGTGGAGGGGGG + Intergenic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1042058017 8:64787040-64787062 CTGCACAGAGCAGTGGGGCAGGG + Intronic
1044434781 8:92149018-92149040 CAGAACAGAGCTGAGGAGGCTGG + Intergenic
1044755961 8:95461503-95461525 CACCACAGAGCGATGGAGAAAGG - Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1045966247 8:108028204-108028226 AAGCACAGAGCAGTTTAGGGGGG - Intronic
1046542512 8:115604536-115604558 CAGCACGGAGCAGTGCAGTCAGG - Exonic
1046823747 8:118663791-118663813 CAGCACAGAGCAGGGTAGAGGGG + Intergenic
1047254137 8:123203038-123203060 CATGACAGAGCAGTGGGGAAAGG + Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047959586 8:130001228-130001250 CACCACAGAGCACAGGAAGAGGG + Intronic
1048384561 8:133899608-133899630 CAGCACAGAGCATTGGATTAAGG + Intergenic
1048559288 8:135515497-135515519 GGGCACAGAGCAGAGTAGGAAGG - Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1048898822 8:139018750-139018772 CAGCACAGAACAGAGGAGGCAGG - Intergenic
1049305283 8:141899571-141899593 GAGCACAGTGCTGTGGAGGGTGG - Intergenic
1049318397 8:141981956-141981978 GAGAAGAGAGGAGTGGAGGAGGG + Intergenic
1049943677 9:574000-574022 AAGCACAGAGCTGCGGCGGATGG - Intronic
1050432806 9:5578994-5579016 CAGAGCAGAGGAGAGGAGGATGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1052591218 9:30497938-30497960 CAGCACAGCTCAGGGGAGGCAGG + Intergenic
1055292056 9:74792461-74792483 TAGCAAAGAGGACTGGAGGAAGG - Intronic
1055611015 9:78024300-78024322 CAGCAAAGAGGAGTGGAAAATGG + Intronic
1056673850 9:88656197-88656219 CACCACATAGCAGTTGAGGACGG - Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1057027937 9:91749543-91749565 CAGTCCATAGCAGTAGAGGAGGG + Intronic
1057702992 9:97376993-97377015 CGGCACAGAGCAGGGGTGGAGGG - Intronic
1057849727 9:98556087-98556109 CAAAACAGAACAGAGGAGGAAGG + Intronic
1058218329 9:102262826-102262848 AGGCGCAGAGCAGAGGAGGAGGG - Intergenic
1059329303 9:113524893-113524915 CATCACAACCCAGTGGAGGATGG - Intronic
1060173402 9:121479721-121479743 CACCACAGAGGAGTGGACAAAGG + Intergenic
1060199759 9:121645590-121645612 CAGCACAGAGCAGTCAGGGTGGG - Intronic
1060229454 9:121815857-121815879 CAGCACAGAGCGGAGGGGGCTGG + Intergenic
1060673290 9:125489723-125489745 AAGCAGAGAGGAGTTGAGGAAGG + Intronic
1060793939 9:126502514-126502536 CAGGGCTGAGCCGTGGAGGAAGG + Intronic
1061027903 9:128062483-128062505 CAGCAGAGAGGAAAGGAGGATGG + Exonic
1061050096 9:128190360-128190382 CAGCATGGAGCCGTTGAGGAGGG + Exonic
1061095088 9:128451988-128452010 GAGCACGGAGCAGTCGGGGATGG - Intergenic
1061290789 9:129649340-129649362 CAGCCCAGAGCAGGGTGGGAAGG + Intergenic
1061764726 9:132874576-132874598 GAGCACAGAACTGGGGAGGAGGG - Intronic
1062047662 9:134431889-134431911 CAGCACCCTGCAGAGGAGGAGGG - Exonic
1186340070 X:8635452-8635474 CAAGACAGAGCAGTAAAGGAGGG + Intronic
1186570318 X:10708444-10708466 AAGTTCAGAGCAGAGGAGGATGG + Intronic
1187477041 X:19620574-19620596 CAGAACAGACCACTGGAGTATGG + Intronic
1187701848 X:21970419-21970441 CAGCAGAGAGGAGAGGGGGAAGG - Intronic
1187926100 X:24251740-24251762 CAGCACAGGGTAGAGGAGGATGG - Intergenic
1188104943 X:26138534-26138556 CAGGACAGAGCAGAGAAGGATGG - Intronic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188319580 X:28719843-28719865 CAGCACACAGGAATGGGGGATGG + Intronic
1189160354 X:38804017-38804039 CAGGGCAGAGCAGAGGAGGAGGG - Exonic
1189390450 X:40571870-40571892 AAGCACACAGCAATGGATGAAGG - Intergenic
1189659945 X:43286169-43286191 CAGCATGGAGCAGTGGATGTGGG + Intergenic
1190094947 X:47471480-47471502 CACTACAGAGCAGTGGAGAAAGG - Intronic
1190634048 X:52417345-52417367 CAGCACAGAACTGCGGACGAGGG - Intergenic
1190683545 X:52850639-52850661 CAGCAGTAAGCAGTGGAGCATGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191726907 X:64291453-64291475 CAGCACGCAGAAGGGGAGGAAGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193603589 X:83538908-83538930 AAGCAGAGACCAGTGGAGGTTGG + Intergenic
1193606661 X:83576816-83576838 CAGCACAGAGAAATGAAGAAAGG + Intergenic
1195110499 X:101643534-101643556 CAGCACAAATCAATGGAGAAAGG - Intergenic
1195177884 X:102328525-102328547 AAGAACAGAGCAGTTGTGGATGG - Intergenic
1195180980 X:102358568-102358590 AAGAACAGAGCAGTTGTGGATGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1195705179 X:107733354-107733376 AAGCACATTGCAGTGGAGGTGGG - Intronic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196769047 X:119274466-119274488 CAGCACAGAGGAGACCAGGATGG + Intergenic
1196971800 X:121117785-121117807 CAGCACTGTGCAGTGGATAAAGG - Intergenic
1197581865 X:128294114-128294136 CTGCACAGAGCAGAGAAGGGGGG - Intergenic
1197769947 X:130083299-130083321 CTTCACAGACCAGTGGAGAATGG - Intronic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199712985 X:150484996-150485018 CATCACAGAGCACTGGAGTGAGG + Intronic
1199785009 X:151097632-151097654 AACTGCAGAGCAGTGGAGGAAGG + Intergenic
1199829980 X:151539863-151539885 CACCACAGAGATGGGGAGGAAGG - Intergenic
1200235896 X:154467579-154467601 CAGCACAGTGTAGTTGAGGCGGG - Exonic
1200385059 X:155881875-155881897 CAATACTGAGCAGTGGAGGAAGG - Intronic
1201185728 Y:11400393-11400415 CAGCACAGGGCAGTGATGCATGG + Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic