ID: 1089699828

View in Genome Browser
Species Human (GRCh38)
Location 11:120237903-120237925
Sequence GGCCTCCAATAAGCCCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089699823_1089699828 -4 Left 1089699823 11:120237884-120237906 CCTGAGAGGGACCCCCTTGGGCC 0: 1
1: 0
2: 0
3: 16
4: 150
Right 1089699828 11:120237903-120237925 GGCCTCCAATAAGCCCTTGCTGG 0: 1
1: 0
2: 1
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089699828 Original CRISPR GGCCTCCAATAAGCCCTTGC TGG Intronic