ID: 1089700848

View in Genome Browser
Species Human (GRCh38)
Location 11:120242932-120242954
Sequence GAAAACAGTGGGAAGCCAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 340}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089700843_1089700848 6 Left 1089700843 11:120242903-120242925 CCAGCTAGGGAGGCAGATAAGAG 0: 1
1: 0
2: 0
3: 16
4: 168
Right 1089700848 11:120242932-120242954 GAAAACAGTGGGAAGCCAGCGGG 0: 1
1: 0
2: 4
3: 22
4: 340
1089700842_1089700848 15 Left 1089700842 11:120242894-120242916 CCGAGACAGCCAGCTAGGGAGGC 0: 1
1: 0
2: 3
3: 18
4: 398
Right 1089700848 11:120242932-120242954 GAAAACAGTGGGAAGCCAGCGGG 0: 1
1: 0
2: 4
3: 22
4: 340
1089700840_1089700848 16 Left 1089700840 11:120242893-120242915 CCCGAGACAGCCAGCTAGGGAGG 0: 1
1: 0
2: 6
3: 24
4: 240
Right 1089700848 11:120242932-120242954 GAAAACAGTGGGAAGCCAGCGGG 0: 1
1: 0
2: 4
3: 22
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089700848 Original CRISPR GAAAACAGTGGGAAGCCAGC GGG Intronic
900322519 1:2092199-2092221 GAAAACAGGGGGAGGGCGGCGGG - Intronic
900668811 1:3836214-3836236 GAGAACAGGGTGAAGCCAGGAGG + Intronic
900706105 1:4081319-4081341 GAAGGCAATGGGGAGCCAGCAGG + Intergenic
901812231 1:11774426-11774448 GCAGACAGTGGGAAACTAGCAGG - Intronic
902068879 1:13714592-13714614 CAAAACAGTGGGTAGGCAGTAGG + Intronic
902768961 1:18634665-18634687 GAAAACAATGGGAGGACATCTGG - Intronic
904084076 1:27891743-27891765 GAAAACAGGCAGAGGCCAGCAGG + Exonic
904855151 1:33492273-33492295 GAAAACCATGTGAAACCAGCAGG - Intronic
905407594 1:37746002-37746024 GAATACAGTGGGAAGGTGGCTGG - Intronic
907442355 1:54487004-54487026 GAAACCAGTGAGAAGAGAGCTGG - Intergenic
907704180 1:56818942-56818964 AAACACAGAGAGAAGCCAGCGGG + Intronic
908049739 1:60216151-60216173 GAAATCAGAGTGAAGGCAGCTGG - Intergenic
908418720 1:63938526-63938548 GAATACAGTGGGGAGCAAGTGGG - Intronic
910037708 1:82807955-82807977 GAGAAAAGTGGCAAGGCAGCTGG - Intergenic
912320255 1:108706350-108706372 GAAAAAACTAGAAAGCCAGCAGG - Intergenic
913149227 1:116024034-116024056 AAGTACAGTGGGAAGCCAGTGGG + Intronic
913173111 1:116249978-116250000 GGACACAGTGAGAAGACAGCTGG + Intergenic
913286663 1:117232960-117232982 GAGGACAGAGGGCAGCCAGCAGG - Intergenic
914864206 1:151412677-151412699 GGAAACAGTGGTAAGACAGGAGG - Intronic
914865942 1:151428711-151428733 GAAAAGAGTGGGAAGCAATATGG + Intronic
916115162 1:161479852-161479874 GCCAGCAGTGGGCAGCCAGCAGG + Intergenic
916206859 1:162323193-162323215 GAATGCCGTGGGAAGGCAGCGGG + Intronic
916233517 1:162562365-162562387 GAAAAAAGTGGCAAGCAAACAGG - Intronic
916657154 1:166886374-166886396 GGAAACAGAGCAAAGCCAGCTGG - Intergenic
918841608 1:189548016-189548038 GAAAACAGTGGAAAACCTTCAGG - Intergenic
919662098 1:200257330-200257352 GAAAGCTGTGAGATGCCAGCCGG + Intergenic
919676838 1:200392374-200392396 GAACACAGTGGGAAGCCTCAGGG + Intergenic
920265193 1:204716333-204716355 GAGAATAGTGGGAACCCAGGAGG + Intergenic
920955906 1:210619930-210619952 GAAGACAGTGAAAAGCCATCAGG - Intronic
920974790 1:210775599-210775621 GGGAATAGAGGGAAGCCAGCTGG - Intronic
922862937 1:228834847-228834869 GAAAGCTGTGAGAAGCCAGCTGG + Intergenic
923475592 1:234328434-234328456 TAAAATAGTGGTAAACCAGCTGG + Intergenic
923854051 1:237827219-237827241 GAAGAAAGTGTGAAGCCAGCAGG + Intronic
924112937 1:240717724-240717746 GAAAACAGCGTGAACCCAGGAGG - Intergenic
1063150442 10:3331971-3331993 GAATTCAACGGGAAGCCAGCAGG + Intergenic
1064216072 10:13401637-13401659 AAAAAGGCTGGGAAGCCAGCTGG + Intergenic
1065015246 10:21456832-21456854 GAAGACAGTGTGAAGACACCAGG - Intergenic
1065546477 10:26826784-26826806 AAGAAAAGTTGGAAGCCAGCGGG - Intronic
1067916942 10:50410299-50410321 GCAAACCTGGGGAAGCCAGCTGG + Intronic
1068071999 10:52207194-52207216 AAAAACAGTGGGAAGGCTGTAGG + Intronic
1069783763 10:70974955-70974977 GTAGACAGTGGGAAGCCACGAGG + Intergenic
1070023617 10:72610518-72610540 AGAAACAGTGGGAAGACAGTAGG + Intronic
1071339442 10:84630440-84630462 GAGAACAGTGTGAATCCAGGAGG - Intergenic
1071787981 10:88924391-88924413 GAAGACATTGGGAAGACAGAAGG - Intronic
1072070876 10:91916055-91916077 GAATTCAGTGTGAAGCCATCTGG + Intergenic
1072728235 10:97827940-97827962 GAAATCAGTGGGATGACTGCAGG - Intergenic
1072960021 10:99920974-99920996 TAAAAGAGTGGGAAGTCGGCTGG - Intronic
1074892764 10:117749118-117749140 GATAACAGTGAGCAGCCGGCAGG - Intergenic
1076045089 10:127286031-127286053 GAGCCCAGTGGGAAGCCAGCTGG - Intronic
1078070192 11:8103321-8103343 GAAATTGGTGGGAAGCAAGCAGG + Exonic
1078580804 11:12538259-12538281 GAAAACAGAGGTTCGCCAGCTGG + Intergenic
1080223855 11:29937611-29937633 GAAAGAAGTGCGAAGCCACCGGG - Intergenic
1080740083 11:35055739-35055761 GAGTACAGAGTGAAGCCAGCGGG - Intergenic
1082778315 11:57265458-57265480 TAAAATAGTGTGAAGCAAGCAGG - Intergenic
1083240721 11:61386289-61386311 GAAAACACTTTGAACCCAGCTGG + Intergenic
1087080634 11:94167989-94168011 GAAAATATTGGGGATCCAGCAGG + Intronic
1087910864 11:103752019-103752041 GAAAACAGTGGGCACTCAGAGGG - Intergenic
1087915119 11:103800874-103800896 GACAACAGGGGGGCGCCAGCTGG + Intergenic
1088082518 11:105935895-105935917 GAAAAGAGGGGGAAGCCAATGGG - Intronic
1088314817 11:108497468-108497490 GACAACAGCGTGAAACCAGCAGG + Intronic
1088597271 11:111449849-111449871 GAAATCTGTGGGATGCCATCAGG - Intronic
1089700848 11:120242932-120242954 GAAAACAGTGGGAAGCCAGCGGG + Intronic
1089788736 11:120926987-120927009 CAGAACGGTGAGAAGCCAGCTGG + Intronic
1090153419 11:124409917-124409939 GAACACAGGGGAAAGACAGCAGG + Intergenic
1091457318 12:617671-617693 GAAAACACGGCGACGCCAGCGGG - Intronic
1091524147 12:1280227-1280249 AAAATCAGCGGGAAGCCATCTGG - Intronic
1091880200 12:3970946-3970968 CAAAGCTGTGGGAAGCAAGCTGG + Intergenic
1092621844 12:10280685-10280707 GAAAACAGACAGAAGCCAGAGGG + Intergenic
1093581185 12:20785586-20785608 GAAAACAGTGGGAAACTCTCTGG - Intergenic
1093842548 12:23922069-23922091 GAAAAAAGTGGGAGCCCAGGGGG - Intronic
1094417212 12:30230046-30230068 GAAGAAAGTGGGAAGCAAGAGGG - Intergenic
1096871032 12:54592244-54592266 GAAGACAGAGGGAGGCCAGGTGG + Intergenic
1096882289 12:54682864-54682886 AAAACCAGAGGGAACCCAGCAGG - Intergenic
1097092140 12:56515050-56515072 GAGAATAGTGGGAACCCAGAAGG - Intergenic
1097929991 12:65172296-65172318 GAAAAGAGTAGGAAGCCTTCAGG - Intronic
1098080520 12:66780245-66780267 GAAAGCAGAGAGAAGCAAGCAGG + Intronic
1099135791 12:78898677-78898699 GAGAGCAGTGCAAAGCCAGCTGG - Intronic
1099610006 12:84856758-84856780 GAACACAGTTGGTAGCCAGGTGG - Intergenic
1100302934 12:93324728-93324750 GAGAACAGTGTGAACCCAGGAGG - Intergenic
1100691373 12:97041770-97041792 GAGAACAGTGTGAACCCAGGAGG + Intergenic
1101795110 12:107965889-107965911 GAGAACAGTGGGCAGCCACTAGG - Intergenic
1101917980 12:108911098-108911120 GGAAGCAGTGGGAGGCCAGTTGG - Exonic
1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG + Intronic
1103011916 12:117464541-117464563 GAATAAAGATGGAAGCCAGCAGG + Exonic
1104202886 12:126609120-126609142 AAAAACAGTGTGAGGCCTGCTGG - Intergenic
1104384093 12:128334416-128334438 GAACACAGTTGGAAACCATCAGG - Intronic
1104591914 12:130091102-130091124 GTAGACAGTGGGCAACCAGCAGG - Intergenic
1104722438 12:131052320-131052342 TGAAACAGCAGGAAGCCAGCAGG - Intronic
1104799961 12:131547725-131547747 CAAAAGAGTGAGAAGCCAGCTGG - Intergenic
1105231027 13:18495978-18496000 GAAAACACTCTGAACCCAGCAGG + Intergenic
1107632320 13:42355188-42355210 GATAAGAAAGGGAAGCCAGCAGG - Intergenic
1108128749 13:47274146-47274168 CAAACCAGTGGGACTCCAGCAGG - Intergenic
1109193241 13:59350422-59350444 GGAAACAGTGAGAAGCAAGGAGG - Intergenic
1109523386 13:63542990-63543012 GAAAGCAGAAAGAAGCCAGCAGG - Intergenic
1112007704 13:95268305-95268327 CAAAACAGTGCGAAGGCTGCAGG + Intronic
1112078250 13:95936560-95936582 GAATACAGTGGGCAACCACCAGG + Intronic
1113281104 13:108788844-108788866 GAAAACTGTGGGAAGATGGCAGG - Intronic
1113649028 13:112021253-112021275 AAAAAAAGTTGGAAGCTAGCAGG + Intergenic
1113972748 13:114202529-114202551 GGAAGCAGTGGGGAGACAGCAGG - Intergenic
1114492405 14:23111646-23111668 GAGAACGGTGGGAACCCAGGAGG - Intergenic
1117210494 14:53493512-53493534 GAAAACAGTGAAAAGCCTGAGGG - Intergenic
1117959929 14:61152899-61152921 GTAGACAGTGGGGAGACAGCTGG + Intergenic
1118637168 14:67758502-67758524 ACAAACAGTGGCAATCCAGCAGG + Intronic
1120347599 14:83309902-83309924 GAAAACACTGGAAAGTCATCAGG + Intergenic
1120391934 14:83919865-83919887 GAAAATGGTGGGAACCCGGCAGG + Intergenic
1120480166 14:85039277-85039299 GAAATCACTGGGAAGTCAGGAGG + Intergenic
1120947945 14:90015657-90015679 GGACACAGTGAGAAGTCAGCAGG - Intronic
1121418843 14:93798250-93798272 GGAAACAGTAGGGTGCCAGCGGG - Intergenic
1122914243 14:104849890-104849912 GAAAACGGTGTGAACCCAGGAGG - Intergenic
1123059050 14:105586186-105586208 GGAAACACAGGGAAGCCAGAGGG + Intergenic
1123083379 14:105706417-105706439 GGAAACACAGGGAAGCCAGAGGG + Intergenic
1124232808 15:27960071-27960093 GGAAATATTGGGTAGCCAGCTGG - Intronic
1125959768 15:43819849-43819871 AAAATCAGTGGGCATCCAGCTGG + Intronic
1126722798 15:51599993-51600015 GTAGAAAGTGGGAAGGCAGCCGG - Intronic
1127289719 15:57559599-57559621 AAAAGCAGTGGGAAGCCAGAGGG - Intergenic
1127444933 15:59051366-59051388 GAGAACAGTGTGAACCCAGGAGG + Intronic
1127476855 15:59342426-59342448 GAAAACATTGGGAAGACTCCAGG - Intronic
1128681132 15:69652488-69652510 GGAGACAGTGTGAAGCAAGCAGG + Intergenic
1129589296 15:76900763-76900785 CAAAGCAGTGAGAAGCCTGCTGG + Intronic
1130841872 15:87708380-87708402 GAATGCATTGGGCAGCCAGCTGG + Intergenic
1132038095 15:98503090-98503112 GAAAACAATGGGAAGCCGTGGGG + Intronic
1132262098 15:100434619-100434641 GAAAACAGTGGGAGACTAGCAGG + Intronic
1132510540 16:338934-338956 AAAAAAAGTGGGATGCAAGCTGG + Intronic
1133467210 16:6039133-6039155 GAAATCAGTGGAAAACCAGCTGG + Intronic
1133976972 16:10606416-10606438 GAATGCAGTAGGAAGCCTGCAGG - Intergenic
1136626861 16:31466715-31466737 GGGCACAGTGGGCAGCCAGCCGG - Exonic
1137337158 16:47561234-47561256 AAAAACAGTGGGCAGGTAGCTGG + Intronic
1137930097 16:52578900-52578922 AAAGACAGAGGGAAGGCAGCGGG + Intergenic
1138346880 16:56325629-56325651 GAAACCAGGGGGAAGGCGGCTGG + Intronic
1138640230 16:58379980-58380002 GTAACCAGTGGGAAGCCATTTGG + Intronic
1139973882 16:70793554-70793576 GCACACAGTGGGCACCCAGCTGG - Intronic
1140524140 16:75608228-75608250 GAAAACAATTGGAAGCCTTCAGG - Exonic
1141373647 16:83509657-83509679 GCAAAGAGTGGGAAACCAGAGGG + Intronic
1142087567 16:88192077-88192099 GGACACTGTGGGAAGCCACCTGG + Intergenic
1203012163 16_KI270728v1_random:305198-305220 GAAAACAGAAGGAAGCTATCTGG + Intergenic
1203030498 16_KI270728v1_random:578357-578379 GAAAACAGAAGGAAGCTATCTGG + Intergenic
1203041223 16_KI270728v1_random:756074-756096 GAAAACAGAAGGAAGCTATCTGG - Intergenic
1143473181 17:7189020-7189042 GAGAACCGTGTGAACCCAGCAGG + Intergenic
1144516756 17:15923492-15923514 GAGAATAGTGTGAACCCAGCAGG - Intergenic
1144891112 17:18494832-18494854 GAGGCCAGTGGGAAGCCATCAGG - Exonic
1145193754 17:20869079-20869101 GGAAAAAGAGGGTAGCCAGCAGG + Intronic
1145351977 17:22091307-22091329 GGAAAAAGAGGGTAGCCAGCAGG + Intergenic
1145404176 17:22571089-22571111 GGAAAAAGAGGGTAGCCAGCAGG + Intergenic
1145794815 17:27649447-27649469 GAGGCCAGTGGGAAGCCATCAGG - Exonic
1146229716 17:31096250-31096272 GACAACAGAGCAAAGCCAGCTGG + Intronic
1146253881 17:31377497-31377519 GTAAACAGTTGTACGCCAGCAGG + Exonic
1147879302 17:43643630-43643652 GAGAACAGAGGGAAGCCGGAGGG - Exonic
1147967778 17:44202792-44202814 GTAAACAGGGAGAAGCCAGGAGG - Intergenic
1150146051 17:62770628-62770650 GAGAACAGTTTGAATCCAGCAGG - Intronic
1151217767 17:72589486-72589508 GTAAAAAGTGGGAACCCAGAGGG - Intergenic
1151387660 17:73764853-73764875 GAAGACAGTGGAAAGCCACAGGG - Intergenic
1151594176 17:75066833-75066855 GAGAACAGTGGGAAGACATTGGG + Intergenic
1152248498 17:79199087-79199109 GAAAACAGTGGGAAGCAAGTGGG + Intronic
1153377965 18:4402482-4402504 GAAAACTATGGGAAGCAGGCCGG + Intronic
1154522409 18:15244113-15244135 GAAAACACTCTGAACCCAGCAGG - Intergenic
1155454431 18:25996275-25996297 GAAAATGGTGTGAACCCAGCAGG + Intergenic
1156571227 18:38255641-38255663 GAAAACTGTAGGAAGTCATCAGG + Intergenic
1158021326 18:52845582-52845604 GAAAACAGTGGGAGGCCTCAGGG + Intronic
1160339319 18:78074012-78074034 GAAAACAACGGAAAGCAAGCTGG + Intergenic
1160361948 18:78290769-78290791 CAGAATAGTGGGAAGACAGCGGG - Intergenic
1161763701 19:6193963-6193985 GAAAGCAGTTGCAAGCCAGAGGG + Intronic
1162684156 19:12367756-12367778 GAGAACAGTGTGAACCCAGGAGG - Intergenic
1162770582 19:12946927-12946949 GATTACAGGCGGAAGCCAGCAGG - Intronic
1163170171 19:15525630-15525652 GGAGGCTGTGGGAAGCCAGCAGG - Intronic
1164322874 19:24166502-24166524 GAAAAAAGTGGGACACCAGGGGG + Intergenic
1164429533 19:28175011-28175033 GAAACCACAGGGAAGCCAGCAGG - Intergenic
1167501987 19:49853752-49853774 GGAAACATTTGGAAGACAGCTGG - Intronic
1167843366 19:52139960-52139982 GAAAAAACTGGGAGGCCAGGGGG + Intergenic
1168340923 19:55622490-55622512 GAAACCAGCCGGAAGGCAGCAGG + Exonic
925767549 2:7251206-7251228 GAGAACGGTGTGAACCCAGCAGG + Intergenic
928350282 2:30546107-30546129 GAGATCAGAGAGAAGCCAGCAGG + Intronic
928573622 2:32632303-32632325 GAAAGCAATGAGAATCCAGCCGG - Intronic
928936370 2:36683041-36683063 GCAAACAGTGGAAAGCCACTGGG + Intergenic
929177204 2:38992126-38992148 CAAAACAGTGGGTAGCAAGTTGG + Intronic
930069025 2:47350756-47350778 GAGAACAGTGTGAACCCAGGAGG - Intronic
930174166 2:48284667-48284689 GAAAACAGAAGGCAGCCAGAAGG + Intergenic
930210780 2:48634950-48634972 GAATCCAGTGGGCAGCCACCAGG + Intronic
931629375 2:64285306-64285328 GAAGTCAGTGCGAAGCCAGAGGG - Intergenic
932183806 2:69673995-69674017 AAGCACAGTGGGCAGCCAGCTGG - Intronic
933637921 2:84727167-84727189 GAAAACAGAGGTGAGCTAGCAGG - Intronic
933728160 2:85437943-85437965 GAAGACACTGGGATGCAAGCGGG + Intergenic
935307900 2:101755605-101755627 GAAAAGAGTGTGCAGCTAGCAGG - Intronic
935791458 2:106594821-106594843 GAAAACAGTGAGAAAACATCAGG - Intergenic
937926685 2:127173273-127173295 GAGAACATGAGGAAGCCAGCTGG - Intergenic
938521662 2:132076682-132076704 GAAAACACTCTGAACCCAGCAGG - Intergenic
939994765 2:148909493-148909515 AAAAACACTGGGAACCCAGCAGG - Intronic
940981207 2:160005702-160005724 GAATACACTTGGAAGCCAGTAGG - Exonic
940996919 2:160159531-160159553 GAAGGCAGTGGGAAGTAAGCAGG - Intronic
941314520 2:163975960-163975982 TGAAAAAGTGGGAATCCAGCAGG - Intergenic
942355171 2:175103625-175103647 GCACACAGTGGGTAGCCAGTAGG - Intronic
942580065 2:177408625-177408647 GAAAACAATGGGCAGCAAGAGGG - Intronic
943960552 2:194257216-194257238 GAAAACACTGGGAAGAGAGAAGG + Intergenic
944061589 2:195574587-195574609 GAAAACAGTGGCCAGTCAGATGG - Intergenic
944084490 2:195828493-195828515 GAAAACAGCGTGAACCCAGGAGG + Intronic
944333530 2:198501654-198501676 GAAAACAGTGGGAAGAAAATAGG - Intronic
945330431 2:208533403-208533425 AAAAAAAGTTTGAAGCCAGCAGG + Intronic
945700439 2:213162814-213162836 GAACATAGTGGGAAGCTAGTGGG - Intergenic
945796156 2:214366714-214366736 GAAAACAATTGGAACACAGCAGG + Intronic
946253727 2:218429095-218429117 GAAACCAGGGGGAAGGCAGCTGG - Intronic
946276175 2:218633497-218633519 GAATACAGTGGGGAGGCAGTGGG + Intronic
946426401 2:219600150-219600172 GAGAACAGCTGGAAGCCAGGAGG - Intronic
946813751 2:223554411-223554433 GAAAACAGATGGATGCCAGGTGG - Intergenic
946924033 2:224608448-224608470 GAAAAAAGGGCAAAGCCAGCAGG + Intergenic
947171079 2:227312202-227312224 GACAAATGTGGGAATCCAGCGGG - Exonic
947815371 2:233033067-233033089 GAAAACAGATGGAGGCCAGCTGG - Intronic
947849436 2:233273543-233273565 GAAAACAGTGGGAAGGGAAAGGG - Intronic
948119549 2:235518946-235518968 CCAAACAGTGTGAAGCCAACTGG - Intronic
948493549 2:238330322-238330344 GAAAACAGTTTGAAACCAACAGG - Intronic
948602862 2:239117152-239117174 GGGAGCTGTGGGAAGCCAGCAGG + Intronic
948750762 2:240131501-240131523 GAGAGCAGAGGGAAACCAGCCGG + Intronic
1170263779 20:14442608-14442630 GAATCCAGTGTGAAGGCAGCTGG - Intronic
1171810228 20:29741240-29741262 GAAAACAGAGGGAAGAGAGCCGG - Intergenic
1171990854 20:31695194-31695216 GAGACCAGTGAGAAGCCAGGTGG - Intronic
1172104613 20:32509239-32509261 GAAAATACAGGGATGCCAGCCGG + Intronic
1172175526 20:32969874-32969896 GAAGGCAGTGGGAAGGCAGGGGG + Intergenic
1173658018 20:44714514-44714536 GAAAACAGAGGGAAAACAGGTGG - Intergenic
1174035789 20:47667581-47667603 GAAGACAGTGGGCAGCCAAAGGG - Intronic
1175778727 20:61668959-61668981 GACAACCCTGGGAAGCCAGTGGG + Intronic
1176649016 21:9529061-9529083 GGAAAAAGAGGGTAGCCAGCAGG - Intergenic
1180014074 21:45071695-45071717 GCAGACAGTGGGAGCCCAGCTGG + Intergenic
1180522687 22:16224497-16224519 GAAAACACTCTGAACCCAGCAGG + Intergenic
1182052105 22:27321291-27321313 GAAAACAGAGGTCACCCAGCTGG + Intergenic
1182517731 22:30868560-30868582 GAAGACAGTGGCCAGCCAGGCGG - Intronic
1183323172 22:37177391-37177413 TTAGCCAGTGGGAAGCCAGCAGG - Intergenic
1183628339 22:39018229-39018251 GAAAACAGTGAGGGCCCAGCAGG - Intronic
1184572800 22:45337182-45337204 GACAAAACGGGGAAGCCAGCGGG - Intronic
949393052 3:3584278-3584300 CAACACAGTGGGAACACAGCAGG + Intergenic
950087578 3:10271401-10271423 GAAAACAGTTTGAACCCAGGAGG - Intronic
950507292 3:13403330-13403352 GACAACAGTGGGAAGACAGCAGG - Intronic
951477903 3:23127923-23127945 GAAAACTGGGGTAAGCCATCAGG + Intergenic
951549369 3:23861689-23861711 GAGCACACTGGGATGCCAGCAGG + Intronic
951614723 3:24529691-24529713 GAAAAAACTCAGAAGCCAGCTGG - Intergenic
952160515 3:30688846-30688868 GAAAACATTTGGAATCCAGAGGG - Intronic
954287622 3:49630039-49630061 GAAAGCAGTGGGATGCAGGCAGG - Intronic
955289071 3:57674084-57674106 AAAAATACTGGGAAGCCGGCCGG + Intronic
956749492 3:72334922-72334944 GAAGACAGTGAGAAGACACCAGG + Intergenic
960851359 3:122058351-122058373 GATGACAGTGGGAAGCCAAATGG + Intronic
961493560 3:127274366-127274388 GACAGCAGAGAGAAGCCAGCAGG - Intergenic
963197256 3:142546091-142546113 GAATTCAGTGGAAAGCCAGAGGG - Intronic
964423688 3:156530842-156530864 GAATACAGTGGAAAGACAGGAGG + Intronic
965232206 3:166069009-166069031 GAGAACGGCGGGAAGCCAGGAGG + Intergenic
965703382 3:171481227-171481249 GAACACATTGGGAATGCAGCTGG + Intergenic
966158767 3:176946439-176946461 GAAATCAGTTGGAAGCCATATGG - Intergenic
967338100 3:188366859-188366881 CAAAACAGTGAGAAGACATCAGG - Intronic
967656244 3:192053312-192053334 GAGAACAGTGTGAACCCAGGAGG + Intergenic
969677837 4:8624490-8624512 GAGAACAGTGTGAACCCAGGAGG + Intergenic
969678792 4:8630131-8630153 GAGAACAGTGTGAACCCAGGAGG + Intergenic
969679748 4:8635773-8635795 GAGAACAGTGTGAACCCAGGAGG + Intergenic
970010896 4:11457947-11457969 GAAAACTGTGTGAAGACAGAGGG - Intergenic
970538794 4:17056845-17056867 GAAAAGACTGGAAAGCCATCTGG + Intergenic
971971995 4:33633060-33633082 GAAAACGGTGTGAACCCAGGAGG - Intergenic
975379264 4:73679335-73679357 AAAAAGAGTGGGAAGACAGCAGG + Intergenic
976885726 4:89981284-89981306 GGACACAGTGAGAAGGCAGCTGG + Intergenic
978649244 4:110980647-110980669 GAAAAAAGTGGGAAGAAATCAGG - Intergenic
979168315 4:117565119-117565141 GAAAGCAGTGTGAAGTAAGCTGG - Intergenic
979641228 4:123014101-123014123 AAAAACAGAGGGAAGACAGAGGG - Intronic
980853277 4:138409997-138410019 GAAAACAGTGGCATGCCATCTGG - Intergenic
980953241 4:139402430-139402452 GAAAACAGTGGGAGCCCAAGGGG + Intronic
981800588 4:148650819-148650841 AAAAACAGGAGGAAGCCAGGAGG + Intergenic
981875121 4:149532941-149532963 GAGGTCAGTGGGAAGACAGCAGG + Intergenic
982240807 4:153297586-153297608 GAGATCAGTGGGGAGCCAGCAGG - Intronic
983474419 4:168196404-168196426 GAATCCAGTGGGTGGCCAGCAGG - Intergenic
983605257 4:169575611-169575633 GAACTCACTGGGAAGCCTGCTGG - Intronic
985481819 5:116945-116967 GAAAGCAGTGGGGCTCCAGCAGG - Intergenic
988721564 5:33884204-33884226 GAAGGCAGTGGGCAGCCAGCTGG - Intronic
992072164 5:73158196-73158218 AAAAACAGTGGGGAGGCACCAGG + Intergenic
992159847 5:73990653-73990675 GAAGACAGAGGGGAGTCAGCAGG - Intergenic
995552256 5:113293321-113293343 GAAAACAGTGTAAAAGCAGCCGG - Intronic
995875228 5:116782785-116782807 GCAAATTGTGGGAAGGCAGCTGG + Intergenic
997970182 5:138395152-138395174 GAAAATACTGAGAAGGCAGCTGG + Intronic
997978649 5:138455140-138455162 GCAAACAGTGGGGAGCCAGCTGG - Intergenic
998586229 5:143430642-143430664 GAGGACAGTGAGAAGACAGCGGG + Intronic
999865944 5:155700655-155700677 GAACCCACTGGGAAGCCAGCTGG - Intergenic
1000847763 5:166302920-166302942 GAAAGCACAGAGAAGCCAGCAGG - Intergenic
1001090611 5:168737493-168737515 GAACACTGTGGGAAGCAGGCTGG - Intronic
1001827000 5:174753058-174753080 GAAAAGCATGGGAACCCAGCGGG - Intergenic
1002160339 5:177311070-177311092 GAGAAGAGGAGGAAGCCAGCGGG + Intronic
1002698258 5:181104468-181104490 GGATACAGTGAGAAGGCAGCTGG + Intergenic
1002708635 5:181180442-181180464 GGATACAGTGAGAAGGCAGCTGG - Intergenic
1003047279 6:2745122-2745144 GAAAGCAGTGAGAAGCACGCAGG + Intronic
1003475894 6:6482377-6482399 GGACCCAGTGGGAAGCCAGTGGG + Intergenic
1003721332 6:8705870-8705892 GAAAACCACAGGAAGCCAGCAGG - Intergenic
1005340505 6:24839484-24839506 GAATCCAGAGGGAAGTCAGCAGG + Intronic
1006547666 6:34792692-34792714 GAAAGCAGAGAGAAGACAGCTGG - Intronic
1007112574 6:39321502-39321524 TAAAACAGTGGGAAGCAGGGTGG - Intronic
1007269663 6:40626915-40626937 GAGAGCTGTGGGAAGCCATCTGG - Intergenic
1007388135 6:41533167-41533189 AAAAAATGTGAGAAGCCAGCTGG + Intergenic
1007725476 6:43913341-43913363 GAAGACAGAGGGAAGGGAGCGGG - Intergenic
1009884233 6:69605183-69605205 GGGAAAAGTGGGAAACCAGCAGG + Intergenic
1009947653 6:70358342-70358364 GAACACAGTGAGAAGGCAGCTGG + Intergenic
1011977137 6:93316884-93316906 GAAAACATTTAGAAGCCAGTTGG + Intronic
1012039882 6:94190583-94190605 AAACATAGTGGGAAGCCAGATGG + Intergenic
1012237851 6:96838216-96838238 AAATCCAGTGGGAGGCCAGCTGG - Intergenic
1012255246 6:97023681-97023703 GAAAACAGTGAAAAGCCTGCTGG - Intronic
1013822526 6:114172588-114172610 GAAAAGAATGGGAAACCAGATGG - Intronic
1015207798 6:130660159-130660181 GAAAACAGTGCCAAGCCATGAGG - Intergenic
1015671397 6:135693993-135694015 GGAAACAGCGGGAAGACAGATGG - Intergenic
1016004252 6:139073252-139073274 GAAAAGAGTTGGAAACCACCTGG - Intergenic
1017165849 6:151407815-151407837 GAGAATAGTGTGAACCCAGCCGG + Intronic
1017534617 6:155333523-155333545 GGAAGCAGTGGGAAGCCATGTGG + Intergenic
1018727493 6:166625340-166625362 GAATACAGTGGGAAACAAGCGGG - Intronic
1019184367 6:170212548-170212570 GAAGGCACTGGGGAGCCAGCAGG - Intergenic
1019641608 7:2106463-2106485 GAAACCTGTGCCAAGCCAGCAGG + Intronic
1020409384 7:7874289-7874311 GAAAGAAGTGGGAAGATAGCTGG - Intronic
1021585533 7:22203570-22203592 GAAAGCAGTGGCATTCCAGCTGG - Intronic
1022375699 7:29808743-29808765 AAGAACAGGGGAAAGCCAGCTGG + Intronic
1023547518 7:41334220-41334242 GAAAACAGAATGAAGACAGCTGG - Intergenic
1023751012 7:43372510-43372532 GAAAACAGTGGGGAGCGGGGAGG - Intronic
1023885965 7:44356272-44356294 CAAAACACTTGGAAACCAGCCGG - Intergenic
1024334835 7:48196609-48196631 CAAAACAGTGGGAAGCATGAGGG - Intronic
1027528276 7:79298843-79298865 GAAAACTGTGTGAAGACAGAGGG + Intronic
1031106739 7:117553053-117553075 GAACACAGCAGGAAGACAGCTGG + Intronic
1034232453 7:149542002-149542024 GAAAATAGTGTGAACCCAGGAGG - Intergenic
1036499421 8:9299688-9299710 GAAAAGAGTGAGAAGCCATCAGG - Intergenic
1036612227 8:10360269-10360291 GAAAACAGAGGGAAGCAATAGGG - Intronic
1036735307 8:11309118-11309140 GAAAACAGTGGGATCCAAGCTGG + Intronic
1037633449 8:20678754-20678776 AAAAAAAGTGGGAACTCAGCAGG - Intergenic
1039983463 8:42428480-42428502 GGAAACAGTGGGAGGATAGCAGG + Intronic
1043362582 8:79492580-79492602 TAAAAAAGTGGGAATTCAGCTGG + Intergenic
1043821194 8:84867141-84867163 GAAAACAGTGTGAAGACATGGGG - Intronic
1047058415 8:121193818-121193840 GGAAACATGGGGAAGCCATCAGG + Intergenic
1047331678 8:123894781-123894803 GAAAGGAGTCAGAAGCCAGCTGG + Intronic
1048502264 8:134988967-134988989 GAGACCTGTAGGAAGCCAGCAGG + Intergenic
1048726704 8:137393710-137393732 GAAAACAATGAGATACCAGCCGG - Intergenic
1049565321 8:143335035-143335057 GAAACCAGGGGGAGGCCGGCAGG - Intronic
1050189882 9:3013642-3013664 GGAAACAGAGGCAAGCCAGTTGG + Intergenic
1052411188 9:28123751-28123773 GAAAATAGTGTGAACCCAGGAGG - Intronic
1053700341 9:40683621-40683643 GAAAACACTCAGAACCCAGCAGG - Intergenic
1053700375 9:40683951-40683973 GAAAACACTCTGAACCCAGCAGG - Intergenic
1054140046 9:61520879-61520901 GAAAACCGTGTGAACCCAGGAGG - Intergenic
1054311633 9:63483019-63483041 GAAAACACTCAGAACCCAGCAGG - Intergenic
1054311667 9:63483349-63483371 GAAAACACTCTGAACCCAGCAGG - Intergenic
1054410414 9:64807172-64807194 GAAAACACTCAGAACCCAGCAGG - Intergenic
1054410449 9:64807502-64807524 GAAAACACTCTGAACCCAGCAGG - Intergenic
1054809665 9:69425054-69425076 GATGACGGTGGGAAGACAGCTGG - Intergenic
1057015231 9:91645198-91645220 GAAAACACTGGGAAGCCATCCGG + Intronic
1057028581 9:91756179-91756201 GCAAACAGGCTGAAGCCAGCGGG + Intronic
1057091415 9:92261432-92261454 GATGACAGTGGGAAGGCAGGAGG + Intronic
1058170679 9:101677522-101677544 GAAGGCAGTGGGAAGGGAGCTGG - Intronic
1059245379 9:112845320-112845342 GAAAAAACTGAGAAGCCACCTGG + Intronic
1059353730 9:113684106-113684128 GAATGCAGTGGGAAGCCCACTGG + Intergenic
1059971395 9:119672474-119672496 AAAAACAGTGGGTTGCCAGGTGG + Intergenic
1060189206 9:121581643-121581665 GCACACAGTGGGAAGCACGCAGG - Intronic
1060520981 9:124293941-124293963 GCACACAGTGGGCAGCCAGGGGG - Intronic
1061577593 9:131517109-131517131 GAAGCCAGTGGGAAGCTAGAAGG - Intronic
1061976486 9:134070504-134070526 GCAAACAGCTGAAAGCCAGCAGG + Intergenic
1062634647 9:137484506-137484528 GAAGACAGAGGGCAGCCGGCAGG + Intronic
1203626752 Un_KI270750v1:32610-32632 GGAAAAAGAGGGTAGCCAGCAGG - Intergenic
1186539064 X:10381812-10381834 GAAAACAGAGGGAAACCAAGAGG - Intergenic
1186739338 X:12500604-12500626 GAAAGCCTTGGGAAGCCAGGGGG - Intronic
1188534675 X:31183472-31183494 GAAAACAGCGCTAAGCCAGGAGG - Intronic
1189316890 X:40062843-40062865 GACAACAGCGAGAAGCCATCCGG - Exonic
1189515772 X:41712164-41712186 CAAAACAGTGGGAAACCACATGG - Intronic
1189897355 X:45669194-45669216 GAAAAGGGTGGGAAGGCAGGAGG + Intergenic
1190230873 X:48580930-48580952 GAAAACACTTGGAATGCAGCTGG - Intergenic
1190381038 X:49839966-49839988 GAATACAGTGGTAAACCAGTCGG - Intergenic
1190888410 X:54548921-54548943 GAACGCACTGGGAAGCCAGATGG + Intronic
1191840749 X:65512228-65512250 GAGAACAGCAGGAAGCCTGCTGG + Intergenic
1192112265 X:68377184-68377206 GAGAACAGTGTGAAGCCGGGAGG - Intronic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1197114091 X:122811481-122811503 GAAAGAAGTTGGAAGCTAGCAGG + Intergenic
1198854678 X:141003401-141003423 GAAAACAGGGAGAGGCCAGGAGG - Intronic
1198918301 X:141697694-141697716 GAAAACAGGGAGAGGCCAGGAGG + Intronic
1200159728 X:154000184-154000206 GAACAGGGTGGGAAGCCAGACGG + Intergenic
1200791045 Y:7299248-7299270 AGAAACAGAGGGAAGACAGCAGG - Intergenic
1201941713 Y:19467164-19467186 AATAACAGTGAGAAGCCATCTGG - Intergenic