ID: 1089702884

View in Genome Browser
Species Human (GRCh38)
Location 11:120255863-120255885
Sequence CAAGGTCACCAGAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 354}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089702884_1089702893 15 Left 1089702884 11:120255863-120255885 CCTTCCTCCCTCTGGTGACCTTG 0: 1
1: 0
2: 2
3: 40
4: 354
Right 1089702893 11:120255901-120255923 GTTGTCCCTCAGCGAGACTGGGG 0: 1
1: 0
2: 0
3: 4
4: 68
1089702884_1089702889 -7 Left 1089702884 11:120255863-120255885 CCTTCCTCCCTCTGGTGACCTTG 0: 1
1: 0
2: 2
3: 40
4: 354
Right 1089702889 11:120255879-120255901 GACCTTGGACTGATCATCTCAGG 0: 1
1: 0
2: 0
3: 9
4: 87
1089702884_1089702891 13 Left 1089702884 11:120255863-120255885 CCTTCCTCCCTCTGGTGACCTTG 0: 1
1: 0
2: 2
3: 40
4: 354
Right 1089702891 11:120255899-120255921 AGGTTGTCCCTCAGCGAGACTGG 0: 1
1: 0
2: 0
3: 5
4: 51
1089702884_1089702892 14 Left 1089702884 11:120255863-120255885 CCTTCCTCCCTCTGGTGACCTTG 0: 1
1: 0
2: 2
3: 40
4: 354
Right 1089702892 11:120255900-120255922 GGTTGTCCCTCAGCGAGACTGGG 0: 1
1: 0
2: 0
3: 0
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089702884 Original CRISPR CAAGGTCACCAGAGGGAGGA AGG (reversed) Intronic
900362118 1:2294167-2294189 CATGGGCACCAGTGGGAGGGAGG - Intronic
901143588 1:7051083-7051105 CCAGATCACCAGAGGGACGTGGG - Intronic
901420941 1:9150689-9150711 CAACGACACCAATGGGAGGAGGG + Intergenic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902043971 1:13512101-13512123 CAGGGTCACAAGTGGGAGGCTGG + Intronic
902936613 1:19769319-19769341 CAAGGAGAGCAGAGAGAGGAGGG - Intronic
903575553 1:24337621-24337643 CAAAGTCACTGCAGGGAGGAGGG - Exonic
904293609 1:29503615-29503637 CAAGTTCAGGAGAGGGAGGAGGG - Intergenic
904484656 1:30816678-30816700 AAAGGTGACCAGAGGAGGGAAGG - Intergenic
905592072 1:39172914-39172936 CAAGGACAAAAAAGGGAGGAGGG - Intronic
905810913 1:40912502-40912524 AGAGTTCACCAGAGTGAGGAGGG + Intergenic
905940728 1:41861171-41861193 CATGGTCCCCAGATGGAGCATGG - Intronic
906149043 1:43577198-43577220 TAAGGTCACCTGAGTGAGGCAGG - Intronic
906835342 1:49077813-49077835 AAAGATGACCAAAGGGAGGAGGG + Intronic
908020967 1:59898300-59898322 TAAGGTCAAAAGAGGGAGAATGG - Intronic
908265715 1:62377418-62377440 CAAGGTCTACAGTGGCAGGAGGG - Intergenic
908736778 1:67284845-67284867 CATGCTCACCAGAGGGGTGATGG + Intergenic
909004985 1:70265216-70265238 CAAGGTGACAAGAGTGAAGAGGG + Intronic
909081570 1:71118669-71118691 CCAGGTCAGCAGTGGGATGAGGG + Intergenic
909531374 1:76685327-76685349 CAAGGTCACAGAAGGCAGGAGGG - Intergenic
911083818 1:93959568-93959590 CTACGCAACCAGAGGGAGGAGGG - Intergenic
911121283 1:94299742-94299764 TAAGGGAGCCAGAGGGAGGAAGG + Intergenic
912951099 1:114121066-114121088 CAAGGCCCCCAGGGGGAGGTTGG + Intronic
915335118 1:155136405-155136427 AAAGGCTACCAGAGGGAGGTGGG + Intronic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
916303492 1:163302598-163302620 CAAGGGAGCCAGAGGTAGGAGGG - Intronic
917683736 1:177394806-177394828 AAAGGTTACCAGAGGGAGGTAGG + Intergenic
918612068 1:186504225-186504247 CAAGGGCAGTGGAGGGAGGAGGG + Intergenic
920123638 1:203676666-203676688 CCAGATCACCAGGGGGAGCAAGG + Intronic
920423018 1:205848731-205848753 CAAATTCACCTGAGGCAGGAAGG + Intronic
921193137 1:212727092-212727114 CCAGTTCACCAGAGGCAGAAGGG + Intronic
922009114 1:221563500-221563522 GAAGGTCACAAAAGGGAGGCTGG + Intergenic
922969936 1:229727754-229727776 CCAGGTGACCAGACGGAGGAGGG + Intergenic
923201523 1:231717277-231717299 CAAGGTCTTCAGTTGGAGGAAGG + Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923546595 1:234927858-234927880 CAAGGTTGCCACAGGGAGGGAGG - Intergenic
923776098 1:236979877-236979899 CAAGGACACCAGAGGAAAGCAGG + Intergenic
924440542 1:244082106-244082128 CAAGGACCCCAGAGGGTGGAGGG + Intergenic
924942380 1:248821113-248821135 CAAGGTCACCACAGGAGGGAGGG + Intronic
1063368057 10:5503188-5503210 ACAGGTCCCCAGAGGCAGGAAGG + Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1064909399 10:20383974-20383996 CCAGGACACCAGAGGGACCAAGG + Intergenic
1065895374 10:30158669-30158691 CAAGGTGGCCAGAGAGATGAAGG - Intergenic
1066205579 10:33186254-33186276 CAAGGTGACCACTGGAAGGAAGG - Exonic
1066477829 10:35765057-35765079 CAAGGACGGCAGAGGGAGCAGGG - Intergenic
1066618551 10:37321017-37321039 CATGGTAACAAAAGGGAGGATGG - Intronic
1067310618 10:45110186-45110208 AATGGTCACCAGAGGCTGGAGGG - Intergenic
1068957000 10:62827319-62827341 CTAGGTCATCAGAGGCAGGTTGG + Intronic
1069749717 10:70737369-70737391 CAAGGTCACCACAGTGATCAAGG - Intronic
1070160038 10:73860928-73860950 CAAGGTGACCACAAGGAGAATGG - Intronic
1072263318 10:93702878-93702900 TAAGGTTACTAGAGAGAGGACGG - Intergenic
1072712381 10:97724414-97724436 CAGGGCCACGAGAGGGAGGAGGG - Intergenic
1073773274 10:106758857-106758879 CAAGAGCACCAGAGGGAGAGAGG + Intronic
1073846417 10:107560859-107560881 CTAGCTCCTCAGAGGGAGGAAGG + Intergenic
1075279321 10:121126286-121126308 CGAAGTCCCAAGAGGGAGGAGGG - Intergenic
1076221284 10:128734956-128734978 CAGGGTCAGAAGAGGGAGCACGG + Intergenic
1076227721 10:128793733-128793755 CACGGTCACCAGCTGGAGGCTGG + Intergenic
1076930219 10:133527439-133527461 CATGGACACCAGCAGGAGGAAGG - Exonic
1076980177 11:199930-199952 CAGGGTCACCTGGGAGAGGAGGG - Exonic
1077201324 11:1309098-1309120 AATGGTCTCCAGATGGAGGAGGG - Intronic
1077263164 11:1634052-1634074 CCAGGGCACCAGGGGGAGGCTGG + Intergenic
1077456369 11:2683709-2683731 CTAGGTAACCAGAGGGAGTAAGG - Intronic
1078062884 11:8059862-8059884 CAAGGAGACCAGAAGGAGGCTGG + Intronic
1078536921 11:12182768-12182790 CAAGGTGGACAGTGGGAGGAGGG - Intronic
1078713519 11:13817609-13817631 CAAGATCACCAGAGGAGAGAAGG + Intergenic
1080381569 11:31777266-31777288 CAGGGTCACAAGGAGGAGGATGG - Intronic
1081745751 11:45471274-45471296 AAAGGTCAACAGGGGCAGGAAGG + Intergenic
1081854150 11:46293454-46293476 CAAGGTTACCAGTGTCAGGAGGG + Intronic
1083513868 11:63237426-63237448 CAAGGTCACAAGACAGAGAATGG - Intronic
1085097982 11:73775996-73776018 CAAGGTCAAGAAGGGGAGGAAGG + Intergenic
1085260502 11:75201941-75201963 CTTGGTCACCAGAGGGACCAAGG - Intronic
1086027286 11:82309162-82309184 CAAGGTCAGGGGAGGGAGGCAGG - Intergenic
1086205926 11:84258082-84258104 CAACTACACCAGAGGAAGGAGGG - Intronic
1086932664 11:92709517-92709539 GAAGGTCACCCGTAGGAGGAAGG + Intronic
1088550775 11:111010324-111010346 CAGGGCCACGAGAGGGAGGCTGG + Intergenic
1088852394 11:113715579-113715601 GAAGGTCACCAGGGAAAGGAAGG + Intergenic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1091851060 12:3697224-3697246 CAAGCCCATCAAAGGGAGGAGGG + Intronic
1094133303 12:27098022-27098044 TCAGGTCACCAGATGGAAGATGG - Intergenic
1094183126 12:27613253-27613275 TCAGGTCACCAGATGGAAGATGG - Intronic
1095605231 12:44059583-44059605 CAATGTCACAAGAGGTAGAATGG - Intronic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1096815934 12:54201726-54201748 CAGGGTCACCAGATGGAGAGCGG - Intergenic
1096859971 12:54518729-54518751 CAAGGTAACTGGAGGGAGGTGGG + Exonic
1097248113 12:57617779-57617801 CATGTTCAGCTGAGGGAGGATGG + Intronic
1098844311 12:75517174-75517196 CACGGTAACCAGAGGGTAGAGGG + Intergenic
1102214061 12:111147709-111147731 CAAGGTCACCTGGCAGAGGAGGG + Intronic
1103365757 12:120381943-120381965 CAAGCTCTCCAGAGGGAGAGAGG + Intergenic
1103462677 12:121117515-121117537 CATGGTCAGCAGAATGAGGATGG + Intergenic
1103724037 12:122989157-122989179 GAGGGTCACCAGAGTCAGGAAGG - Intronic
1103820053 12:123690519-123690541 CAGGGACACCTGAGGGAGAAGGG - Exonic
1104091091 12:125518364-125518386 CTAGGCCCCCAGAGGCAGGAAGG + Intronic
1104537084 12:129628353-129628375 CAATGTCACAGGAGGCAGGAGGG + Intronic
1104593699 12:130104866-130104888 CAAGGTCACCAGTGGGGCAAAGG - Intergenic
1105701776 13:22939978-22940000 CAGGGTCCCCAGAGGAAGGCGGG + Intergenic
1107440478 13:40422980-40423002 CAGACTCCCCAGAGGGAGGAGGG - Intergenic
1108336476 13:49446423-49446445 CAAAGTCTCCAGCGGGAGTAGGG - Intronic
1110146590 13:72199177-72199199 CCAGATGACCAGAGGGAGGGGGG + Intergenic
1110410045 13:75194925-75194947 CAAGGGCAACAGAGGAAGGTTGG - Intergenic
1112402811 13:99090123-99090145 TAAAGTCATCAGAGGGAGCATGG + Intergenic
1113432712 13:110264454-110264476 TAAGAACAACAGAGGGAGGACGG + Intronic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1115700994 14:35952855-35952877 AAAGGAGACCACAGGGAGGAGGG + Intergenic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117019764 14:51557806-51557828 GAAGGTCGAGAGAGGGAGGAGGG + Intronic
1117049594 14:51847009-51847031 CATGGTAACCAGAGGGGGGGAGG + Intronic
1118481675 14:66173723-66173745 CAAGGGCACACGAGGAAGGATGG + Intergenic
1121386626 14:93533219-93533241 CAAGGTCCACATAGGTAGGAGGG - Intronic
1122278001 14:100605105-100605127 CCTGGTCTCCACAGGGAGGAGGG + Intergenic
1122907237 14:104807503-104807525 CAATGGCCCCAGAGGGAGGCAGG - Intergenic
1122942744 14:104989718-104989740 CCAAGGCCCCAGAGGGAGGAGGG + Intronic
1123026130 14:105425121-105425143 CAAGTTCAGCAGGAGGAGGAAGG - Intronic
1124159291 15:27254257-27254279 CGAGGTTTCCAGAGGGAGGGAGG + Intronic
1125038396 15:35154009-35154031 CTAGATCTCCAGAGAGAGGAAGG + Intergenic
1125932958 15:43613066-43613088 AAAGTTCTCCAGAGGGAGGTGGG + Exonic
1125946057 15:43712528-43712550 AAAGTTCTCCAGAGGGAGGTGGG + Intergenic
1125970443 15:43907082-43907104 GAAGCTCTCCACAGGGAGGATGG + Intronic
1126776587 15:52105571-52105593 CGAGGATACTAGAGGGAGGATGG + Intergenic
1126957272 15:53947555-53947577 CAAGGTGATCAGAGGCATGATGG - Intergenic
1128260513 15:66229697-66229719 CAAGGCTCCCACAGGGAGGAAGG + Intronic
1128575581 15:68772275-68772297 CAAGGTCATCAGTGGGAGATGGG - Intergenic
1129252824 15:74318287-74318309 CAAGGGCAGGTGAGGGAGGAGGG + Intronic
1129461046 15:75700268-75700290 CAATGGCCCCAGTGGGAGGAGGG + Intronic
1129723774 15:77891457-77891479 CAATGGCCCCAGTGGGAGGAGGG - Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1131099127 15:89674220-89674242 CAAGTCGACCAGAGGAAGGATGG - Intronic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1132557176 16:577840-577862 ACAGGTCCCCAGAGGGAGGATGG - Intronic
1132694061 16:1194380-1194402 CCAGGGAACCAGAGGAAGGAGGG - Intronic
1134202933 16:12213904-12213926 CAAGGCCACCAGAAGCAGCAGGG - Intronic
1135138885 16:19905044-19905066 CAAGAGTACAAGAGGGAGGAAGG + Intergenic
1136012447 16:27372588-27372610 AAAGGCCAGCAGAGGGAGGCAGG - Intergenic
1137624013 16:49896104-49896126 CGAGGCCAACCGAGGGAGGAGGG - Intergenic
1137699937 16:50490214-50490236 CATGGGCACTGGAGGGAGGATGG + Intergenic
1138514223 16:57527080-57527102 CCAGGTCACCCCAGGGAAGAGGG + Intronic
1139550519 16:67670248-67670270 CAAGGTCACTGGAGGGAGTAGGG + Intergenic
1139871385 16:70111372-70111394 CAAGAACTTCAGAGGGAGGAGGG + Intergenic
1140364550 16:74371117-74371139 CAAGAACTTCAGAGGGAGGAGGG - Intergenic
1140792982 16:78410105-78410127 CAAGAGCAACAGAGGAAGGAAGG - Intronic
1140916798 16:79501116-79501138 CAGGGTCTCCAGAGGGAGTGTGG - Intergenic
1141279857 16:82621545-82621567 CAAGGTAGCCAGAGGTATGAAGG - Intergenic
1141332114 16:83120304-83120326 GGAGGACACCAGAGGTAGGATGG + Intronic
1141473962 16:84259446-84259468 CAACCTCACCTGAGGGAAGAGGG + Intergenic
1141486289 16:84342389-84342411 CTAGGTCAGGAGAGGGAAGAGGG + Intergenic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1142138052 16:88460591-88460613 TAAGGACCCCAGAGTGAGGATGG + Intronic
1143991836 17:10971010-10971032 CAATGTCACAAGAGGCAGCAGGG + Intergenic
1144286366 17:13778573-13778595 CAAGGTCACTATTGAGAGGAGGG + Intergenic
1144997365 17:19279371-19279393 CAAGGTCACCAGATGGGGGAGGG + Intronic
1145260550 17:21352106-21352128 CCAAGTCAGGAGAGGGAGGAGGG + Intergenic
1146004814 17:29154585-29154607 CAAGATCAACAGAGGCAAGAGGG - Intronic
1146634595 17:34494677-34494699 CCAGGTGACCAGAAGGAGCAGGG + Intergenic
1147187243 17:38719623-38719645 GAGGGACACCCGAGGGAGGAGGG + Intronic
1147390118 17:40103889-40103911 CAAAGCCACCAAAGGGAGGGGGG + Intergenic
1147759578 17:42788649-42788671 CAAAGTCAGCAGAGGGGAGAAGG - Intronic
1147905148 17:43817904-43817926 CATGGACTCCAGAGGAAGGAGGG - Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148389160 17:47257900-47257922 CAAGCACACCACAGTGAGGAGGG + Intronic
1148996450 17:51714469-51714491 AAAGAGCTCCAGAGGGAGGAAGG - Intronic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1150135268 17:62691962-62691984 CACAGTAACCAGAGGTAGGATGG + Intronic
1151231747 17:72690065-72690087 CACGCTCCCCAGAAGGAGGAAGG - Intronic
1151482747 17:74379960-74379982 CAAGCTCCCCAGAGTGGGGAAGG - Intergenic
1151734694 17:75931825-75931847 CCAGATCACAAGAGGGAGGAGGG + Intronic
1151858953 17:76744634-76744656 AAAGGTCACCAGAGGAAGGGAGG + Intronic
1152508520 17:80769824-80769846 CCAGGACACGAGAGGGAGGGCGG + Intronic
1152609021 17:81306621-81306643 CACGGTCCCTAGAGGGAGGCAGG + Intergenic
1152715062 17:81895513-81895535 CAAGGTCAAGAGATGGAGGCCGG + Intronic
1152715081 17:81895592-81895614 CAAGGTCAAGAGATGGAGGCCGG + Intronic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1153144706 18:2018114-2018136 CAATGTCACAAGAGACAGGAGGG - Intergenic
1153242721 18:3045214-3045236 CAAGGCCAGCTGAGGGTGGAAGG + Intergenic
1153821892 18:8839170-8839192 CAAGGGCACCAGAGAGGGGCAGG + Intergenic
1153948583 18:10038108-10038130 CAAGGGCATCAGAGAGAGCAAGG + Intergenic
1154332845 18:13443726-13443748 CAAAGTCACAAAAGGGAGAAGGG - Intronic
1155346693 18:24864331-24864353 CATGTTCACCAGAGCAAGGATGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156536447 18:37869194-37869216 CTAGGTCATTGGAGGGAGGAGGG + Intergenic
1156912667 18:42429035-42429057 CTAGATCACCAGGGGGAGGAAGG + Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158982630 18:62779137-62779159 CAAGGCTACCAAGGGGAGGAGGG - Intronic
1160879219 19:1311895-1311917 CAAGGGCCCCACAGGCAGGAGGG - Intergenic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1162361223 19:10221624-10221646 CCAGCTCTCCAGTGGGAGGATGG + Intronic
1162471070 19:10872128-10872150 CAAGGTGCCCAGAGTGAGCAAGG + Intronic
1162641575 19:12014467-12014489 CAATGGCACCTGAGGGAGGTAGG - Intergenic
1162723582 19:12676512-12676534 CATGGCCACCAGGGGGAGCATGG + Intronic
1163427720 19:17248200-17248222 CAAGGTCACATGTGGGAGGACGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164541973 19:29128237-29128259 CAAGGACACGCAAGGGAGGAAGG + Intergenic
1166325870 19:42050866-42050888 CAAGCTCAGGAGAGGGAGGGAGG + Intronic
1166781526 19:45345829-45345851 GAAGGTCAGCTGAGGGCGGAGGG + Intronic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925183663 2:1832722-1832744 ACAGCTCACCACAGGGAGGAAGG - Intronic
926012884 2:9422873-9422895 CAGGGTCACCAGAGTAAGGACGG + Exonic
927383013 2:22500534-22500556 CAAGTGCACCACAGGGAGAAGGG + Intergenic
927818536 2:26242692-26242714 CAAGGTCATCAGAGGGTAAAAGG + Intronic
928688702 2:33776318-33776340 CAAGGTTTCCACAGTGAGGAAGG - Intergenic
929049069 2:37819238-37819260 CAAGGCCACCAGAGGGGTGATGG - Intergenic
930822019 2:55655835-55655857 CAAGGTTAACAGAGAGAGGAAGG - Intronic
932815913 2:74861587-74861609 CAAGGTCACCTGTGGGCAGATGG + Intronic
933264575 2:80168508-80168530 GAAGGTGATCAGAAGGAGGAGGG - Intronic
933660071 2:84920427-84920449 CAAGGTCAGAAGAAGAAGGATGG - Intergenic
936444955 2:112587917-112587939 CAAGGAGACCAGAGAGAGGCTGG - Intronic
936463770 2:112729464-112729486 GAAGGTCAGCAGGGGCAGGAAGG - Intronic
937104279 2:119295350-119295372 CAAGGTCACAGGATGGAGGGAGG + Intergenic
937331290 2:121031957-121031979 CAAGGGCACCAGAGGGTCAAGGG - Intergenic
938572373 2:132572236-132572258 CAAGAACACCAGACGGAAGAAGG - Intronic
938608276 2:132919564-132919586 CAAGATCAACAGCGGGATGATGG + Intronic
941918562 2:170828126-170828148 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918568 2:170828149-170828171 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918600 2:170828294-170828316 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918628 2:170828406-170828428 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918675 2:170828620-170828642 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918681 2:170828643-170828665 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918704 2:170828733-170828755 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918715 2:170828779-170828801 TGAGGACAGCAGAGGGAGGAGGG - Intronic
941918735 2:170828853-170828875 CAAGGACCGCAGAGGGAGGAAGG - Intronic
944398635 2:199299549-199299571 CAAGGTAGCCAGAGGGAAAATGG + Intronic
945693066 2:213066316-213066338 CAACGGCAACAGAGGGAGGGAGG + Intronic
945996283 2:216439103-216439125 TTAGGCCACCACAGGGAGGAAGG - Intronic
946072631 2:217047631-217047653 GAAGGGCACCAGTGGGAGGATGG - Intergenic
946284407 2:218692290-218692312 CAAGGTAACCAGAGTGGAGAAGG + Exonic
946617872 2:221529235-221529257 CCAGGTCTCCACAGGAAGGAAGG + Intronic
947120621 2:226810964-226810986 CAAGGTCACCTGGGGGAGTGGGG - Intergenic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948027604 2:234790360-234790382 GAAGGTGAGGAGAGGGAGGAAGG + Intergenic
948798953 2:240421509-240421531 CAAGGATCCCAGAGGGGGGATGG + Intergenic
1169224240 20:3846513-3846535 CAAAGTTCCCAGGGGGAGGAGGG + Intergenic
1169566223 20:6856389-6856411 CAAGGTCCTCAGAGGGAAGGTGG - Intergenic
1169806255 20:9562511-9562533 CAAGGATACCAGGGGAAGGAAGG - Intronic
1170474695 20:16703158-16703180 CAAGGCCACCAGAGGAGTGATGG + Intergenic
1170479008 20:16746551-16746573 AAAGGTTACCAGAGGGATCATGG - Intergenic
1171251581 20:23653107-23653129 CATGGTCACCATAGGGAGGCAGG - Intergenic
1172173847 20:32960701-32960723 TAAGGGGACCACAGGGAGGAGGG - Intronic
1172777599 20:37416501-37416523 GAAGGCCACCAGAGGGGCGAGGG - Intergenic
1172980148 20:38935382-38935404 CAGGGCCACCAGAGGGTGGCAGG - Intronic
1172982387 20:38953720-38953742 CTAAGTCAGGAGAGGGAGGAAGG - Intergenic
1173262706 20:41451073-41451095 CCCAGTCCCCAGAGGGAGGAAGG - Exonic
1173347545 20:42214784-42214806 CCATGTACCCAGAGGGAGGAGGG - Intronic
1173581866 20:44152675-44152697 ACAGGTCACCAGAGGGAAGAGGG - Intronic
1174276577 20:49408700-49408722 CAATGTCACACGAGGGAGGATGG + Intronic
1174391354 20:50220194-50220216 CAAGGGCTCCCCAGGGAGGAAGG - Intergenic
1174955368 20:55091916-55091938 CAAGGTCACATTAGTGAGGAAGG - Intergenic
1175012393 20:55752840-55752862 CAAGATCACCTGGGGCAGGAGGG - Intergenic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175234894 20:57503029-57503051 CTAGGTCCCCCGAGGGAGGGCGG + Intronic
1178482694 21:32993405-32993427 CAAGGGCACCAAATGAAGGAAGG + Intergenic
1179229543 21:39489037-39489059 CAAGAAGACCAGAGGGAAGAAGG + Intronic
1179570553 21:42276129-42276151 CAAGGCCACGGGAGGCAGGAGGG + Intronic
1180158951 21:45990537-45990559 GAAGGTGACCAGGGGAAGGACGG + Intronic
1180182047 21:46122424-46122446 AAAGCTGCCCAGAGGGAGGAAGG + Intronic
1181311281 22:21946211-21946233 CAGGGCCACTAGAGGGTGGAGGG + Intronic
1181415004 22:22753073-22753095 CAAGGTGAGCACTGGGAGGACGG + Intronic
1181464534 22:23103794-23103816 CCAGCTGACCTGAGGGAGGAAGG - Intronic
1181513888 22:23400852-23400874 CAGGGCAACCACAGGGAGGAGGG + Intergenic
1183030876 22:35103784-35103806 CAAGGTCACCAGGAGGTCGATGG + Intergenic
1183272368 22:36870188-36870210 CAAGGTCAGGAGAGGGACCAGGG - Intronic
1183867602 22:40716274-40716296 CAAGGGCAAGAGAGGCAGGATGG + Intergenic
1184093100 22:42302543-42302565 CAAGGTCACCAGCCAGTGGAAGG + Intronic
1185093039 22:48786529-48786551 CAAGGTCCCAGGAGGGAGGAGGG + Intronic
1185148303 22:49150963-49150985 CGAGGTCACCAGAGGAAGGAGGG + Intergenic
1185301593 22:50083873-50083895 CCAGGGCACCAGGTGGAGGAGGG + Intronic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
1185399061 22:50606693-50606715 CGAGGTCACAGGAGGCAGGAGGG - Exonic
950490575 3:13302236-13302258 CAAGGCCATAGGAGGGAGGATGG - Intergenic
951802776 3:26614832-26614854 CAAGTTCTACAGAAGGAGGAAGG + Intergenic
953695154 3:45152496-45152518 TAAGGTGACCAGAAGGAGCAAGG - Intergenic
954886587 3:53880792-53880814 GGAGCTAACCAGAGGGAGGAGGG - Intronic
959327880 3:104960768-104960790 CAAGGTCATCAGAGGTAAGTCGG + Intergenic
960121220 3:113950062-113950084 CAAGGTCTCCAGGGCTAGGAGGG - Intronic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
961144114 3:124579956-124579978 CATGGTCTCCAAAGGGAGGAAGG + Intronic
962266788 3:133949514-133949536 CAAGGTCAGAAGAGGTAGGAAGG - Intronic
962809470 3:138948544-138948566 CAAGGCCACCTTATGGAGGAAGG + Intronic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964636203 3:158860425-158860447 CTTGGGCACCAGTGGGAGGAAGG + Intergenic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967606450 3:191452352-191452374 TAAGGTCAGCTGAGGAAGGATGG + Intergenic
968054608 3:195681788-195681810 CAAAGTTACCAGAGGGAAAAAGG - Intergenic
968101283 3:195967370-195967392 CAAAGTTACCAGAGGGAAAAAGG + Intergenic
968733218 4:2281477-2281499 CTATGTCACCACATGGAGGAAGG + Intronic
968984818 4:3869398-3869420 CAAGGCCTCCTGAGGGAGCACGG - Intergenic
969047364 4:4346116-4346138 TAAAGTCATCAGAGAGAGGACGG - Intergenic
969058026 4:4414132-4414154 CAGGTTCCCCACAGGGAGGAGGG + Intronic
970427986 4:15963094-15963116 CAAGGTCACCAGCAGGAGGCAGG + Exonic
970640078 4:18054271-18054293 CAAGGCAGCCAGTGGGAGGAAGG - Intergenic
970723372 4:19014183-19014205 CAAGTTTACCTGGGGGAGGAAGG + Intergenic
972205826 4:36771595-36771617 TGAGGTAACAAGAGGGAGGACGG - Intergenic
976602189 4:86948239-86948261 CAAGTTTACCATAAGGAGGAGGG - Intronic
977591044 4:98827588-98827610 CAAGGACAACAGAGGGCAGAGGG - Intergenic
982235332 4:153246874-153246896 CAAGGCCACCAGAGGCAGAGGGG - Intronic
986174053 5:5336963-5336985 CATGGGCAGCACAGGGAGGAGGG + Intergenic
987116233 5:14728928-14728950 CAAGCTCACCAGGGCGCGGAAGG + Intronic
987192401 5:15491794-15491816 CAAGGTCACATGACAGAGGAGGG - Intergenic
988502127 5:31792269-31792291 CAAGGTCATCAGAAGCAGGCAGG + Intronic
988737587 5:34038267-34038289 TAAGGTGAGCACAGGGAGGATGG + Intronic
989118288 5:37977969-37977991 CTAGGCCACCAGAGAGAGCATGG - Intergenic
994991656 5:107004495-107004517 CAAAGTCTCCAGGGAGAGGAAGG + Intergenic
996168598 5:120259917-120259939 CAAGGTTACCAAAGGGTGGGAGG - Intergenic
997372079 5:133368433-133368455 TAAGATCAACAGAGGGAAGAGGG - Intronic
999972317 5:156877397-156877419 CAAAGTCACCACACTGAGGATGG - Intergenic
1001298956 5:170519722-170519744 CAAAGTCAAGAAAGGGAGGAAGG + Intronic
1001642975 5:173258320-173258342 CAAGGTCTCTTGAGGGAGGAGGG - Intergenic
1002807655 6:592553-592575 CAGGGTCACCAGACGCATGAAGG + Exonic
1003504095 6:6725546-6725568 CTGGGTCACCAGAGGCAGGGAGG + Intergenic
1003860308 6:10316860-10316882 GAATGTCACCAGAAGAAGGAGGG + Intergenic
1005493257 6:26366744-26366766 CAAGGTCTGCAGATGGAGGTGGG - Intronic
1005497818 6:26404118-26404140 CAAGATCTGCAGAGGGAGGTGGG - Intronic
1005502502 6:26442122-26442144 CAAGGTCTGCAGAGGGAGGTGGG - Intronic
1005717427 6:28563961-28563983 AAAGGCCAACAGATGGAGGAAGG + Intergenic
1005825860 6:29631655-29631677 CAGGCTCCCCAGTGGGAGGAAGG + Intronic
1006930680 6:37686273-37686295 CAAGGTCACCAAAAGGCTGATGG - Intronic
1007070577 6:39035115-39035137 CATGGTAACCAGAAGGAGCATGG + Intergenic
1010672379 6:78701262-78701284 GAAGGGCATCAGAGGGAGAAAGG + Intergenic
1011528453 6:88292991-88293013 TGATGTCACCAGAGGAAGGAAGG + Intergenic
1011938309 6:92810707-92810729 CAAGGTCAACAGATGTAGGTGGG + Intergenic
1014165666 6:118221516-118221538 CAAGGACACTGCAGGGAGGAAGG + Intronic
1015374857 6:132498977-132498999 CAAGGTCATCAGATAGAGAATGG - Intronic
1015763073 6:136685882-136685904 CAAGGTGCTCACAGGGAGGAGGG - Intronic
1016037165 6:139395408-139395430 CAAGGACTCCAGAGGGAGTTGGG + Intergenic
1016625159 6:146158279-146158301 GAAGGAAACAAGAGGGAGGATGG + Intronic
1016935302 6:149445386-149445408 CACGGTCTCCTGTGGGAGGAAGG - Intergenic
1018547663 6:164956024-164956046 CACAGTCACAAGAAGGAGGAAGG - Intergenic
1019735678 7:2648785-2648807 CAAGGAGACCTGAGCGAGGAGGG + Intronic
1020181449 7:5925603-5925625 CAAGGACACAACAGTGAGGAAGG - Intronic
1020301484 7:6799286-6799308 CAAGGACACAACAGTGAGGAAGG + Intronic
1020700464 7:11475493-11475515 CAAGGTCAATAGTGGGAGAATGG + Intronic
1022344782 7:29503614-29503636 CATGGTCACAGGAGGGATGAGGG + Intronic
1022778647 7:33554963-33554985 CAAGGTCAGCAGATGGAGCAAGG + Intronic
1023915468 7:44585448-44585470 CAAAGTAACCAGAGAGATGAGGG - Intergenic
1023965994 7:44963272-44963294 CAGGGCCCCGAGAGGGAGGAGGG - Intronic
1026241431 7:68578897-68578919 CAAGTTCTCCAGAGGGACAATGG + Intergenic
1026598272 7:71752447-71752469 CTAGGTCACCTGCTGGAGGAGGG + Intergenic
1028146863 7:87328839-87328861 TAAAATCATCAGAGGGAGGATGG - Intergenic
1029620906 7:101689162-101689184 CAAGGTCACATGGGGGTGGATGG + Intergenic
1031024352 7:116663878-116663900 CAAGGTCACCATCAGGAGGGAGG + Intergenic
1033485338 7:141783594-141783616 TAAGGTCAACAGCAGGAGGAGGG + Intronic
1034435140 7:151059792-151059814 CCAGGGCCGCAGAGGGAGGAAGG + Intronic
1034752505 7:153584025-153584047 CAAGGTCAGCAGGGAGAGAAGGG + Intergenic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1035245843 7:157561514-157561536 TCAGGGCCCCAGAGGGAGGATGG - Intronic
1037913486 8:22758239-22758261 AAGGGTCACCGGAGGGAAGATGG - Intronic
1038583697 8:28771299-28771321 CCAGGTGACCAGTGGCAGGAAGG + Intronic
1039825774 8:41173040-41173062 CAAGGTCACCAGAAGGACGTGGG - Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1040487774 8:47890341-47890363 CAAGCCCACAAGAGGGAGAAAGG - Exonic
1040832391 8:51691814-51691836 CCCGGCCAGCAGAGGGAGGAAGG + Intronic
1041871120 8:62635422-62635444 CGAGGTCACCAGCTGGTGGAAGG - Intronic
1045860575 8:106811446-106811468 CATGGTTACCAAAGGGAAGAAGG + Intergenic
1046877047 8:119266668-119266690 CAAGGACAGCAGGGAGAGGAAGG + Intergenic
1047281113 8:123446524-123446546 AAAGCTCTCCAGAGGGAGGAGGG - Intronic
1047828995 8:128611407-128611429 TAAGGTAACCAGAGGGTGTATGG + Intergenic
1048286156 8:133143242-133143264 GAAGGACACCTGAAGGAGGAAGG - Intergenic
1048784983 8:138040960-138040982 AAAGGTCCCCAGAGGAAGCATGG + Intergenic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1048894437 8:138977343-138977365 TAAGGCCACCAGATGGGGGAAGG + Intergenic
1049319427 8:141988100-141988122 CAGGGTCACAAAAGGGAGCATGG - Intergenic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1054725572 9:68646837-68646859 CAAGGTCTCAAGATGGAGGCTGG - Intergenic
1057049714 9:91914537-91914559 CAAGGTGACCGGCAGGAGGATGG - Intronic
1057208636 9:93187657-93187679 CAAGGTCACCAGTGAGGAGATGG + Intronic
1057302062 9:93892309-93892331 CAAGGTACCCAAAGAGAGGAGGG + Intergenic
1059044849 9:110855354-110855376 CTAGGTCCCCAGAGAGAGTAGGG - Intergenic
1059412242 9:114139643-114139665 CAGGGTCCCCAGAGGAAGGGAGG + Intergenic
1059432627 9:114259201-114259223 CAGGGTCAAAAGAGGGACGAGGG + Intronic
1060415587 9:123427520-123427542 CCAGGGCACCAGATAGAGGAGGG - Intronic
1060903064 9:127278761-127278783 CACGGCCCTCAGAGGGAGGATGG - Intronic
1061034218 9:128104519-128104541 CAAGGCCACAAGAGGGAGGGAGG - Intronic
1061219640 9:129242767-129242789 CAAGGACAGCTGAGGGAGGATGG + Intergenic
1061253121 9:129437905-129437927 CAAGGTCACATGATGGCGGAAGG + Intergenic
1061260976 9:129481014-129481036 CAAGGTCACAACAGGTAGAAAGG - Intergenic
1061848797 9:133402807-133402829 CAAGGACAACAGAGGCAGGAAGG + Intronic
1191674926 X:63784335-63784357 CAAGGTCTCCAGGTGGAGAAGGG + Intronic
1192561822 X:72132231-72132253 CAAGGTACCGAGAGGGAGGGGGG + Intergenic
1194180731 X:90708673-90708695 CTAGACCACTAGAGGGAGGAGGG - Intergenic
1194365053 X:93004590-93004612 CAAGGCCAAGAGAGAGAGGAGGG - Intergenic
1195473548 X:105260057-105260079 CAAAGTCACCTGAAGGAGGTGGG + Intronic
1197152946 X:123239920-123239942 CAAGGGCACCAGTGAGAGAAAGG - Intronic
1197493902 X:127153831-127153853 AAATGCCACCAGATGGAGGAAGG + Intergenic
1197852427 X:130877416-130877438 AAAGGACAGAAGAGGGAGGAAGG - Intronic
1198131238 X:133697432-133697454 CAAGCTCAGCAGATTGAGGAAGG - Intronic
1198223383 X:134623310-134623332 CTTGGACACAAGAGGGAGGATGG + Intronic
1199864940 X:151836315-151836337 CAAAGTTACCAAAGGAAGGATGG + Intergenic
1200211598 X:154349075-154349097 GCAGGACACCAGCGGGAGGAAGG - Intronic
1200527394 Y:4290829-4290851 CTAGACCACTAGAGGGAGGAGGG - Intergenic
1200673281 Y:6120850-6120872 CAAGGCCAAGAGAGAGAGGAGGG - Intergenic
1201622039 Y:15970157-15970179 TAAGGGCACCAGGTGGAGGAGGG - Intergenic