ID: 1089704705

View in Genome Browser
Species Human (GRCh38)
Location 11:120269544-120269566
Sequence GCCTGAGTTGCCTCTTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089704701_1089704705 -9 Left 1089704701 11:120269530-120269552 CCTGTCAATGCTTAGCCTGAGTT 0: 1
1: 0
2: 2
3: 14
4: 73
Right 1089704705 11:120269544-120269566 GCCTGAGTTGCCTCTTGGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 206
1089704699_1089704705 29 Left 1089704699 11:120269492-120269514 CCAGATGTGGTCCAGAAATCTAA 0: 1
1: 0
2: 1
3: 9
4: 117
Right 1089704705 11:120269544-120269566 GCCTGAGTTGCCTCTTGGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 206
1089704700_1089704705 18 Left 1089704700 11:120269503-120269525 CCAGAAATCTAAGACAAGAGCTC 0: 1
1: 0
2: 1
3: 8
4: 127
Right 1089704705 11:120269544-120269566 GCCTGAGTTGCCTCTTGGGTGGG 0: 1
1: 0
2: 1
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089704705 Original CRISPR GCCTGAGTTGCCTCTTGGGT GGG Intronic
900376327 1:2356465-2356487 GCCTGAGGTGCTGCTTGGGGAGG - Intronic
900590247 1:3456216-3456238 GCCTCAGTTTCCTCATGTGTAGG - Intronic
900641264 1:3689096-3689118 GCCTGGGACCCCTCTTGGGTTGG - Intronic
902995093 1:20218303-20218325 GCCTCAGTTTCCTCTTGGTGAGG + Intergenic
903194279 1:21673246-21673268 CTCTGAGCTGCCTCTTTGGTTGG - Intergenic
904948561 1:34217160-34217182 GCTTGAGTTGCCTGTTGAGTAGG - Intronic
905100465 1:35516916-35516938 TCCTGATTTGGCTCTTGGCTTGG - Intronic
905840251 1:41170403-41170425 TCCTCAGTTGCCCCATGGGTAGG + Intronic
906696892 1:47829113-47829135 GCCTGACTTGTCTCTTATGTTGG + Intronic
906908644 1:49922673-49922695 TCCTGATTTGGCTCTTGGCTTGG - Intronic
906958866 1:50402106-50402128 TCCTGATTTGGCTCTTGGTTTGG - Intergenic
911044277 1:93615869-93615891 GCCTGTCTAGCCTCTTGGGGAGG - Intronic
911479059 1:98413490-98413512 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
912260168 1:108103266-108103288 TCCTGGGCTGCCACTTGGGTGGG - Intergenic
912732477 1:112120948-112120970 TCCTGATTTGGCTCTCGGGTTGG - Intergenic
915737565 1:158094594-158094616 GGCAGTGTTCCCTCTTGGGTGGG - Intronic
917184787 1:172341096-172341118 TCCTGATTTGGCTCTTGGCTTGG - Intronic
917267565 1:173237617-173237639 TCCTGAGTTGACTCTTGGCTTGG - Intergenic
917524754 1:175778134-175778156 TCCTGATTTGGCTCTTGGCTTGG - Intergenic
918704753 1:187646539-187646561 GGAAGAGTTGTCTCTTGGGTTGG - Intergenic
919876063 1:201869543-201869565 GTCAGAATTGCCTCTGGGGTGGG - Intronic
920710902 1:208294017-208294039 GCTTGCTTTGCCTCTTGGGATGG - Intergenic
921961381 1:221038480-221038502 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
922678251 1:227566575-227566597 GCCTGACTTGACGCTTGAGTCGG + Intronic
1063195836 10:3741855-3741877 GGCTGAGTTAGCTCCTGGGTGGG + Intergenic
1063236202 10:4119107-4119129 GTCTTAGTTTCCTCTTGGGGAGG + Intergenic
1063864897 10:10353320-10353342 TGCTGAGTTGACTCCTGGGTGGG + Intergenic
1064857363 10:19784790-19784812 TCCTGATTTGCCTCTGGGCTTGG - Intronic
1065592182 10:27275323-27275345 TCCTGATTTGGCTCTTGGCTTGG - Intergenic
1065658171 10:27975019-27975041 TCCTGATTTGGCTCTTGGCTTGG + Intronic
1066144074 10:32538271-32538293 TCCTGATTTGGCTCTTGGCTTGG + Intronic
1068906042 10:62323912-62323934 TCCTGATTTGGCTCTTGGCTTGG - Intergenic
1069488068 10:68837780-68837802 GCCTTGGTTGCCTCATGTGTTGG + Intronic
1075164649 10:120056197-120056219 TCCTGATTTGACTCTTGGCTTGG - Intergenic
1075642157 10:124072588-124072610 GCCTGGGTTTTCTCTTGGGAGGG - Intronic
1076581887 10:131517364-131517386 GCCTTTGTTGCCTCTGGGGCTGG + Intergenic
1077953843 11:6991472-6991494 GCCTGAGGGGGCTCTAGGGTAGG - Intergenic
1079708665 11:23653335-23653357 GCCTTAGCTGCCTCTTGGCAGGG - Intergenic
1080686220 11:34517212-34517234 GCCTGTGCTGCCTCTTGGGATGG - Intergenic
1083275924 11:61597110-61597132 GCCTGAGTTCTCTCATGAGTAGG + Intergenic
1085044084 11:73343331-73343353 TCCTGGGTTGGCTCCTGGGTCGG - Intronic
1089052515 11:115557894-115557916 GCCAGAGTTGTCCCTTGGGCTGG - Intergenic
1089704705 11:120269544-120269566 GCCTGAGTTGCCTCTTGGGTGGG + Intronic
1090278145 11:125433783-125433805 GCCTGAGTTTCTTCTTGCCTGGG - Intergenic
1091850068 12:3688982-3689004 TCCTGATTTGGCTCTTGGTTTGG + Intronic
1093116086 12:15212710-15212732 ACCTCAGTCGCATCTTGGGTAGG - Intronic
1094851277 12:34383392-34383414 GCCTGAGGTGCTCCATGGGTGGG + Intergenic
1097337441 12:58398734-58398756 TCCTGATTTGGCTCTTGGTTTGG + Intergenic
1098791668 12:74831947-74831969 TCCTGATTTGGCTCTTGGTTTGG - Intergenic
1099845441 12:88022715-88022737 TCCTGATTTGACTCTTGGCTTGG - Intronic
1099865935 12:88281018-88281040 TCCTGATTTGGCTCTTGGCTTGG - Intergenic
1100914360 12:99402146-99402168 GCCTGACTTGCCTTTGGGTTGGG + Intronic
1102351943 12:112199119-112199141 ACCTGAGTTGACACTTGGGTAGG + Intronic
1104015124 12:124956942-124956964 GCCTGAGCTGCCTCAAGCGTGGG - Intronic
1104082202 12:125439449-125439471 TCCTGATTTGGCTCTTGGCTTGG + Intronic
1108795645 13:54026587-54026609 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
1109528065 13:63602535-63602557 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
1110937279 13:81307027-81307049 GCCTGACATTCCTCGTGGGTGGG - Intergenic
1111798795 13:92957664-92957686 GCCTGACTTTCCTGGTGGGTGGG - Intergenic
1112602295 13:100868664-100868686 GCCTGAGGTCCCTCGGGGGTGGG + Intergenic
1115045103 14:28982237-28982259 CCCTGATTTGGCTCTTGGCTTGG - Intergenic
1115148574 14:30256355-30256377 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
1122129620 14:99597533-99597555 GCCTGTGTTGCCTCCAGGGCTGG - Intronic
1122654871 14:103251414-103251436 GGCTGAGTTGGTTCTTGAGTGGG - Intergenic
1124122751 15:26904745-26904767 TCCTGATTTGGCTCTTGGCTTGG + Intronic
1126858517 15:52861797-52861819 TGCTGACTTGCCCCTTGGGTGGG + Intergenic
1128291709 15:66483156-66483178 CCCTCATTTGCCTCTTGGGGAGG + Intronic
1128558156 15:68645693-68645715 TCCTGAGTGTCCTCTTGGTTTGG + Intronic
1129109547 15:73329517-73329539 GCCTGTGCTCCCTCTTGGGAGGG + Intronic
1131888728 15:96948909-96948931 GCCTTAGTTGCAGCTTCGGTAGG - Intergenic
1139226358 16:65236091-65236113 GCCTGGGTTTCCTCTAGAGTGGG + Intergenic
1141649809 16:85386871-85386893 TCCTGGGGTGCCTCTTGGGGTGG + Intergenic
1141838174 16:86556368-86556390 GCCTCTGTTGCCTCCTGCGTAGG - Intergenic
1142871905 17:2826614-2826636 GCCTGAATGTCCTCTTGGCTGGG + Intronic
1145895148 17:28452653-28452675 CCCTGATTTGGCTCTTGGCTTGG + Intergenic
1147236068 17:39058523-39058545 GCCTCAGTGGCCTCCTGTGTAGG + Intergenic
1151152659 17:72101141-72101163 GCCTGAGCTCTCTCTTGGCTGGG + Intergenic
1152419485 17:80184402-80184424 GCCTGGGTGGCCTCCTGGGGAGG - Intronic
1154322993 18:13369404-13369426 GCCTCAGTGGGCTGTTGGGTGGG + Intronic
1155084985 18:22449535-22449557 TCCTGATTTGGCTCTTGGCTTGG - Intergenic
1157578586 18:48760045-48760067 GCGTGAGATGTCTCTTGGGGTGG + Intronic
1158901661 18:61967653-61967675 GCCTGACATGCCTAGTGGGTCGG - Intergenic
1159953092 18:74499354-74499376 GCCTGTGTGGCCTCTTGGTCAGG + Intronic
1160469382 18:79114817-79114839 GCCTGTGTTGCCTTTTTGGAGGG + Intronic
1162576198 19:11500345-11500367 GCCAGACTTGGGTCTTGGGTTGG - Intronic
1164610663 19:29629375-29629397 GCCTGTGATGGCTCCTGGGTGGG - Intergenic
1164685746 19:30165538-30165560 GCCTGGCTGGCCTCATGGGTTGG + Intergenic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
925916009 2:8606822-8606844 GCCTGTGTTCTCTCTTGGGATGG + Intergenic
926206185 2:10835624-10835646 GGCTGGGTTTCCTCGTGGGTCGG - Intronic
927651106 2:24914213-24914235 GCCTGTGTTGCCTCTTGGGATGG + Intronic
928827031 2:35435319-35435341 CCCTGAGTTTTCTCTTGGGGTGG - Intergenic
931525293 2:63145988-63146010 TCCTGATTTGGCTCTTGGCTTGG + Intronic
933637539 2:84724140-84724162 GGCTGAGTTGTGTCATGGGTAGG - Intronic
934717192 2:96550917-96550939 GCCTCAGGTGCCTGGTGGGTGGG - Intronic
937848291 2:126606322-126606344 TCCTGATTTGGCTCTTGGCTTGG - Intergenic
937909698 2:127069429-127069451 GCCTGGGTTGACCATTGGGTTGG - Intronic
942405956 2:175655287-175655309 TCCTGATTTGGCTCTTGGTTTGG - Intergenic
942925369 2:181425866-181425888 CCCTGATTTGTCTCTTGGGTTGG - Intergenic
944021117 2:195105726-195105748 TCCTCAGTTGGCTCTTGGCTTGG - Intergenic
944828202 2:203506110-203506132 GCATGGGTTGCCTCTGGGATTGG - Intronic
946133678 2:217628149-217628171 GCCTGGGTTTCCTTTTGGCTTGG - Intronic
947326895 2:228989215-228989237 TCCTGATTTGACTCTTGGCTCGG - Intronic
947485380 2:230543518-230543540 TCCTGATTTGGCTCTTGGCTTGG - Intronic
1169546585 20:6656653-6656675 GCCTCAGTTGCCTCTTCCTTGGG + Intergenic
1169833775 20:9854858-9854880 GCCTTAGTTGCCTCTTGGAGGGG + Intergenic
1172011183 20:31846778-31846800 TCTTGAGGTGCCTCTTGGGAGGG - Intergenic
1172194257 20:33081416-33081438 TCCTGAGATGACTCTTGGCTGGG + Intronic
1173678920 20:44862311-44862333 GCCTGAGTTGGCACTGGGGTCGG - Intergenic
1179722012 21:43321480-43321502 GCCTGGGATGGCTCTTGGGATGG - Intergenic
1181603486 22:23966277-23966299 GCCTGTGTAGCCTCTTGTGCCGG - Intergenic
1181605027 22:23975030-23975052 GCCTGTGTAGCCTCTTGTGCCGG + Intronic
1182018957 22:27064857-27064879 CTCTCAGTTGCCTCTTTGGTTGG - Intergenic
1182282689 22:29226357-29226379 GCCTAAGGTCCCTCGTGGGTTGG + Intronic
1182283214 22:29229778-29229800 GACTGAGTTGCCTCTTACATGGG - Intronic
1183716261 22:39535272-39535294 GCCTCAGTTTCCTCATTGGTTGG + Intergenic
1184181387 22:42829342-42829364 GCATGGGTTGCCTCTTTGTTGGG - Intronic
1184757811 22:46526719-46526741 GCCCGAATAGCCTCCTGGGTGGG - Intronic
950599719 3:14022442-14022464 TCCTGAGTTGGCTCTTGGCTTGG + Intronic
950715713 3:14846356-14846378 GCCAGAGTTGTCTGTGGGGTGGG + Intronic
951233504 3:20207473-20207495 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
952809705 3:37390868-37390890 TCCTGATTTGACTCTTGGCTTGG + Intronic
953816960 3:46166155-46166177 TCCTGATTTGGCTCTTGGTTTGG + Intronic
959680227 3:109087435-109087457 TCCTGATTTGGCTCTTGGCTTGG - Intronic
962861084 3:139402403-139402425 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
963632308 3:147748486-147748508 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
964460210 3:156916536-156916558 TCCTGATTTGGCTCTTGGCTTGG + Intronic
968019429 3:195371339-195371361 TCCTGAATTGGCTCTCGGGTTGG + Intronic
968486743 4:866610-866632 GCTGGAGTGGCCTCTTGGGCAGG - Intronic
970196074 4:13550964-13550986 TCCTGATTTGGCTCTTGGCTTGG - Intergenic
973151489 4:46893874-46893896 TCCTGATTTGGCTCTTGGCTTGG - Intronic
974142318 4:57902856-57902878 GCCTGTGTTGTCGCATGGGTGGG - Intergenic
975789896 4:77937646-77937668 GCTTCTGCTGCCTCTTGGGTTGG + Intronic
979012128 4:115385783-115385805 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
979045398 4:115856542-115856564 TCCTGATTTGGCTCTTGGCTTGG - Intergenic
983985649 4:174056993-174057015 TCCTGATTCGCCTCTTGGCTTGG + Intergenic
985062244 4:186091098-186091120 GACTGAGTCGGCTCTTGGGTGGG + Intergenic
985657413 5:1139411-1139433 GGCTGAGCCGCCTCTTGGTTTGG - Intergenic
985845418 5:2341944-2341966 GTCTGATTTGGCTCTTGGCTTGG + Intergenic
989211115 5:38860794-38860816 CCCTGAGTAGCCTCCTGAGTAGG + Intronic
989697111 5:44214228-44214250 TCCTGATTTGGCTCTTGGCTGGG + Intergenic
991146616 5:63313561-63313583 GCCTCAAAAGCCTCTTGGGTGGG - Intergenic
993019039 5:82568675-82568697 TCCTGATTTGGCTCTTGGTTTGG - Intergenic
993114753 5:83706937-83706959 TCCTGATTTGGCTCTTGGCTTGG - Intronic
994707366 5:103223139-103223161 GCTGGAGTTGCCCCTTGGTTGGG + Intergenic
994788903 5:104199423-104199445 GCCTGAGTCTCCTCTTGAGGAGG + Intergenic
995008103 5:107226059-107226081 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
997358141 5:133277674-133277696 ACCTGACTTGCCCCTTGGGGTGG + Intronic
998594972 5:143519452-143519474 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
999352332 5:150885696-150885718 TCCTGATTTGGCTCTTGGCTTGG + Intronic
999526799 5:152415145-152415167 TCCTGATTTGGCTCTTGGCTTGG - Intronic
999614217 5:153404984-153405006 GCCTGCGGTGCCTCTAGGTTCGG + Intergenic
1005908615 6:30288274-30288296 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
1007188256 6:39991372-39991394 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
1008173599 6:48238744-48238766 TCCTGACTTGGCTCTTGGCTTGG - Intergenic
1009946097 6:70343001-70343023 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
1010628988 6:78174833-78174855 GCCTCACTTCCCTCTTGGCTGGG - Intergenic
1010849541 6:80755149-80755171 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
1011056298 6:83207031-83207053 TCCTGATTTGGCTCTTGGCTTGG - Intergenic
1014133407 6:117860987-117861009 TCCTGATTTGGCTCTTGGCTTGG - Intergenic
1014339921 6:120191465-120191487 TCCTGATTTGGCTCTTGGCTTGG - Intergenic
1014860869 6:126466848-126466870 TCCTGATTTGGCTCTTGGTTTGG - Intergenic
1016778062 6:147927444-147927466 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
1017601647 6:156089823-156089845 TCCTGATTTGGCTCTTGGCTTGG - Intergenic
1017762354 6:157579668-157579690 TCCTGATTTGGCTCTTGGTTTGG + Intronic
1017864050 6:158427001-158427023 TCCTGATTTGGCTCTTGGTTTGG + Intronic
1018132277 6:160743440-160743462 TCCTGATTTGCCTCTGGGCTTGG + Intronic
1019095432 6:169575550-169575572 GCCTGAGTTTCCTGTCTGGTGGG + Intronic
1019356631 7:583299-583321 GCCTGTGTTCCTTCTTGGGGAGG - Intronic
1020877054 7:13710948-13710970 TCCTGATTTGGCTCTTGGCTTGG - Intergenic
1021035508 7:15793742-15793764 GCCTGATTTGTCACTTGGGATGG - Intergenic
1024408727 7:49014139-49014161 TCCTGATTTGGCTCTTGGCTTGG - Intergenic
1029597469 7:101545407-101545429 GCCTGGGTTGCCTGCTGGGCCGG - Exonic
1029728554 7:102424702-102424724 GCTCAAGTTGCCTCTTGGGTGGG - Intronic
1031208879 7:118796431-118796453 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
1033007631 7:137584756-137584778 GCCAGTGTTACCACTTGGGTGGG - Intronic
1036603811 8:10288484-10288506 GCCTCAGTTGCTTGTTGTGTTGG + Intronic
1037454923 8:19053497-19053519 GCCTGTGTTCCCTCTTGATTAGG - Intronic
1038019178 8:23538633-23538655 TCCTGAGTGCCCTCTTGGCTAGG + Intronic
1040760527 8:50836598-50836620 TCCTGGTTTGACTCTTGGGTTGG - Intergenic
1041174239 8:55177400-55177422 GCCTGAGATGTCCCCTGGGTGGG - Intronic
1042344256 8:67711552-67711574 GCCTGAGGAGGCTCTTGGTTGGG + Intronic
1042497352 8:69470131-69470153 TCCTGAGCTGACTCTTTGGTTGG - Intronic
1046011390 8:108552564-108552586 TCCTGATTTGGCTCTTGGCTTGG - Intergenic
1049422270 8:142522221-142522243 GCCTCAGTTGCTGCTTGGGTGGG + Intronic
1050127409 9:2372969-2372991 TCCTGATTTGGCTCTTGGCTTGG - Intergenic
1050946814 9:11532139-11532161 GCCTAAATTGGCTCTTTGGTAGG + Intergenic
1052094255 9:24365350-24365372 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
1052820022 9:33131011-33131033 GCCTCAGTTTCCTCCTTGGTGGG - Intronic
1053104925 9:35401123-35401145 GCCTGAGGTGCCTCCTGGGAGGG - Intronic
1053438518 9:38094445-38094467 GCCTGACCTGCCTCCTGGGTTGG + Intergenic
1056181488 9:84087557-84087579 TCCTGATTTGGCTCTTGGTTTGG + Intergenic
1059902712 9:118945851-118945873 TCCTGACTTGGCTCTTGGATTGG + Intergenic
1060201588 9:121654651-121654673 GCCTGAGTTTCTCCCTGGGTGGG - Intronic
1061460365 9:130733101-130733123 GGCTTAGTTGGATCTTGGGTTGG + Intronic
1061551003 9:131334764-131334786 GCCTGAGTTGCCACGTGGCCTGG - Intergenic
1061566536 9:131444517-131444539 GCCTTTTTTGTCTCTTGGGTTGG + Intronic
1061616532 9:131783874-131783896 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
1061631499 9:131875018-131875040 GGCTGAGCTGCCTCTTGGCGGGG - Intronic
1185739970 X:2523897-2523919 ACCTGGGTTCCCTCTTGGCTGGG - Intergenic
1186017795 X:5217866-5217888 GCCTCAGTCTCCCCTTGGGTGGG - Intergenic
1187756169 X:22529286-22529308 TCCTGATTTGTCTCTCGGGTTGG - Intergenic
1188537661 X:31215335-31215357 GACTCAGATGCCTCTTGGGGTGG + Intronic
1188806601 X:34598228-34598250 TCCTGATTTGGCTCTTGGTTTGG + Intergenic
1188923175 X:36004308-36004330 TCCTGATTTGGCTCTTGGCTTGG - Intergenic
1190437979 X:50446062-50446084 TCCTGATTTGGCTCTTGGCTTGG + Intronic
1190561060 X:51685573-51685595 GCCTTAGGTTCCTCTTGGCTGGG + Intergenic
1190563231 X:51707748-51707770 GCCTTAGGTTCCTCTTGGCTGGG - Intergenic
1191217074 X:57944069-57944091 TCCTGATTTGCCTCTTGGCTTGG + Intergenic
1193642254 X:84024409-84024431 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
1194201919 X:90962355-90962377 GCCTGATTTGGCTCCTGGCTTGG - Intergenic
1194286692 X:92019947-92019969 GCCTCATGTGGCTCTTGGGTGGG - Intronic
1194357388 X:92902225-92902247 TCCTGATTTGGCTCTTGGTTTGG + Intergenic
1195540991 X:106062786-106062808 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
1195892807 X:109713972-109713994 GCCTGAGGTGCTTCTTGAGAAGG - Intronic
1196536626 X:116852974-116852996 TCCTGATTTGGCTCTTGGCTTGG + Intergenic
1196913800 X:120511646-120511668 GAATGATTTGCATCTTGGGTGGG - Intergenic
1197142734 X:123134298-123134320 TCCTGAGTTGGCTCTTAGCTTGG - Intergenic
1198729671 X:139715939-139715961 GACTGAGTTGCCTCATAGGAAGG + Intergenic
1198769637 X:140115991-140116013 TCTTGATTTGGCTCTTGGGTTGG + Intergenic
1200547756 Y:4537807-4537829 GCCTGATTTGGCTCCTGGCTTGG - Intergenic
1200604238 Y:5244507-5244529 GCCTCATGTGGCTCTTGGGTGGG - Intronic