ID: 1089706702

View in Genome Browser
Species Human (GRCh38)
Location 11:120283389-120283411
Sequence GCTGCTGGGTTGCCACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 174}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089706702_1089706716 26 Left 1089706702 11:120283389-120283411 CCAGGATGTGGCAACCCAGCAGC 0: 1
1: 0
2: 1
3: 6
4: 174
Right 1089706716 11:120283438-120283460 AGGCAGGCCTCTGAGGATCTGGG 0: 1
1: 0
2: 1
3: 25
4: 277
1089706702_1089706708 6 Left 1089706702 11:120283389-120283411 CCAGGATGTGGCAACCCAGCAGC 0: 1
1: 0
2: 1
3: 6
4: 174
Right 1089706708 11:120283418-120283440 TGGGCTGCCCCGTCCTGCTCAGG 0: 1
1: 0
2: 1
3: 22
4: 296
1089706702_1089706717 27 Left 1089706702 11:120283389-120283411 CCAGGATGTGGCAACCCAGCAGC 0: 1
1: 0
2: 1
3: 6
4: 174
Right 1089706717 11:120283439-120283461 GGCAGGCCTCTGAGGATCTGGGG 0: 1
1: 0
2: 3
3: 30
4: 311
1089706702_1089706709 10 Left 1089706702 11:120283389-120283411 CCAGGATGTGGCAACCCAGCAGC 0: 1
1: 0
2: 1
3: 6
4: 174
Right 1089706709 11:120283422-120283444 CTGCCCCGTCCTGCTCAGGCAGG 0: 1
1: 1
2: 5
3: 27
4: 278
1089706702_1089706715 25 Left 1089706702 11:120283389-120283411 CCAGGATGTGGCAACCCAGCAGC 0: 1
1: 0
2: 1
3: 6
4: 174
Right 1089706715 11:120283437-120283459 CAGGCAGGCCTCTGAGGATCTGG 0: 1
1: 0
2: 1
3: 29
4: 308
1089706702_1089706714 19 Left 1089706702 11:120283389-120283411 CCAGGATGTGGCAACCCAGCAGC 0: 1
1: 0
2: 1
3: 6
4: 174
Right 1089706714 11:120283431-120283453 CCTGCTCAGGCAGGCCTCTGAGG 0: 1
1: 0
2: 4
3: 45
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089706702 Original CRISPR GCTGCTGGGTTGCCACATCC TGG (reversed) Intronic
900296806 1:1956012-1956034 GCTGCTGTGATCCCACAACCAGG - Intronic
902283420 1:15390657-15390679 GTTGCTGAGGTGCCACATCTTGG + Intronic
904248237 1:29203440-29203462 GATGCTGAGTTGCCAAGTCCTGG - Intronic
905883614 1:41479965-41479987 CTGGCTGGGTGGCCACATCCTGG + Intronic
918740724 1:188127872-188127894 GCTGCTGGGTTGCCAAACAATGG - Intergenic
1063123881 10:3123717-3123739 GGTGCTGAGGGGCCACATCCTGG + Intronic
1066578974 10:36859301-36859323 TCTGTTGCCTTGCCACATCCTGG + Intergenic
1069599903 10:69697259-69697281 TCTGCTGGGTTCCCAGAGCCTGG - Intergenic
1070873076 10:79775285-79775307 GCTGCTGTGTTGCCAGGTCCTGG - Intergenic
1071575950 10:86726496-86726518 GCCGCTGGTTTGCCAAACCCTGG - Intronic
1071640002 10:87297436-87297458 GCTGCTGTGTCGCCAGGTCCTGG - Intergenic
1071655232 10:87440513-87440535 GCTGCTGTGTCGCCAGGTCCTGG + Intergenic
1072534770 10:96353732-96353754 CCTGCTGGGTTCCAACAGCCAGG + Intronic
1073700933 10:105925798-105925820 TCTGCTGGGTGGCTAGATCCAGG + Intergenic
1074534576 10:114319739-114319761 GCAGCCGAGTTGCCACATCTGGG - Intronic
1075712552 10:124538322-124538344 GCTGCTGCCTTTCCACTTCCTGG + Intronic
1076829023 10:132985097-132985119 GCTGGTGGGTTGCCCCAGGCGGG + Intergenic
1076846454 10:133071750-133071772 CCAGCTGGGAGGCCACATCCTGG - Intronic
1077386705 11:2272622-2272644 CCTGCTGGATTTCCACCTCCCGG + Intergenic
1081643019 11:44770476-44770498 GATGCTGGGGTGCTACACCCAGG + Intronic
1083871768 11:65492713-65492735 ACAGCTGGGCTGCCACAGCCAGG + Intergenic
1084463604 11:69309537-69309559 GCTGCTGGGTTAGCAGCTCCGGG + Intronic
1087066267 11:94030822-94030844 GCTCCTGGGTAGACACATGCAGG + Intronic
1088781874 11:113142722-113142744 GCTGCTGTCTTGCCACCTTCCGG + Intronic
1089489986 11:118876882-118876904 GGTGCTGGGTAGGCACATCAAGG - Intergenic
1089706702 11:120283389-120283411 GCTGCTGGGTTGCCACATCCTGG - Intronic
1091011957 11:132009523-132009545 GCTGCCGGGATGGCACAGCCAGG - Intronic
1093416539 12:18927012-18927034 TCTGCTGAGTTTCTACATCCTGG + Intergenic
1095965226 12:47863084-47863106 GCTGCTGGGTTCCCACCACGTGG + Intronic
1096676209 12:53227478-53227500 GCCCCTGGGTAGCCAGATCCAGG + Exonic
1097225658 12:57475687-57475709 ACTGCCGGGGTCCCACATCCCGG + Intronic
1097751959 12:63365506-63365528 ACTCCTGAGTTGCCCCATCCTGG + Intergenic
1102254979 12:111410038-111410060 GCCGGGGGGTAGCCACATCCGGG - Intronic
1102949934 12:117024705-117024727 GCAGGTGGGGTGTCACATCCTGG - Intronic
1104649602 12:130522207-130522229 GCTGCTGTGTTGCAAAATCATGG + Intronic
1105569000 13:21582002-21582024 GTGGCTTTGTTGCCACATCCAGG - Intronic
1105797829 13:23873859-23873881 GCTGCTGGGAAGGCACGTCCTGG + Intronic
1107322585 13:39205148-39205170 GCTGCTGGATGGCTACACCCTGG + Intergenic
1108572737 13:51767203-51767225 GTGGCTGGGTTGCCCCGTCCTGG + Exonic
1109345875 13:61113853-61113875 GGTGCTGGGATGCCAGTTCCAGG + Intergenic
1111549107 13:89784200-89784222 GAAGCTGGGTTGCCAGTTCCGGG - Intergenic
1113901200 13:113799142-113799164 GCAGCTGGGCTGCTGCATCCAGG - Intronic
1118637811 14:67763981-67764003 GCTGCTGGGTGGAAGCATCCTGG + Intronic
1119262464 14:73245786-73245808 GCTGCTGGGTTGGCCCAGCCTGG + Intronic
1120170887 14:81246695-81246717 GCAGCTGTGTGCCCACATCCTGG - Intergenic
1122128896 14:99593765-99593787 TCTGCTGGGTGGCCAGAGCCAGG - Intronic
1122946789 14:105014940-105014962 GCTGCTGGGTTTCCAGAGTCAGG - Intronic
1124520829 15:30405678-30405700 TCTGCTGGCTGGCCACTTCCAGG + Exonic
1124959291 15:34382778-34382800 GCTGGTGGGTTGCCCCACCTGGG - Exonic
1124963071 15:34412482-34412504 GCTGCTCGGGTGCGACATCAGGG + Intronic
1124975917 15:34528999-34529021 GCTGGTGGGTTGCCCCACCTGGG - Exonic
1124979694 15:34558708-34558730 GCTGCTCGGGTGCGACATCAGGG + Intronic
1126226895 15:46281282-46281304 GCTGCTGGCTTGACAGCTCCAGG + Intergenic
1126775166 15:52094205-52094227 GCTGCCGGGTTGCCCACTCCTGG + Intergenic
1127731948 15:61809759-61809781 GCTGGTGTTTTGCCACATCACGG + Intergenic
1128483068 15:68055629-68055651 GCTGCTGGGTTCACACACACAGG - Intronic
1129029813 15:72610018-72610040 GCTGGTGGGTTGCCCCACCTGGG + Intergenic
1131546866 15:93322845-93322867 GCTGCTTGGATGCCCCTTCCTGG + Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1132896926 16:2233593-2233615 GCTGCGGGGCTGCCACTGCCAGG - Exonic
1133207180 16:4240714-4240736 GCTGCTGGGCTGCTACACACTGG - Intronic
1137463702 16:48689074-48689096 TCTGCAGGGTTGTCTCATCCAGG + Intergenic
1138653231 16:58473726-58473748 GCTGCTGGCTTGCCACACAGCGG - Intronic
1142292564 16:89199729-89199751 GCTGCTGGGCTGTGTCATCCTGG - Exonic
1142693996 17:1623443-1623465 GCTGAGGGCTTGCCACATGCTGG - Intronic
1143130502 17:4674272-4674294 GCTGCTTGGGTGCCTCCTCCTGG + Intronic
1143919410 17:10318963-10318985 GCTGCAGGGTGGCCTCCTCCAGG + Exonic
1143928969 17:10400563-10400585 GCTGCAGGGTGGCCTCCTCCAGG + Exonic
1144640770 17:16935396-16935418 GCTGCTGGGTGACCTCATGCAGG - Intronic
1144672006 17:17138178-17138200 GTGGCTGGCTGGCCACATCCAGG - Intronic
1144704989 17:17362361-17362383 CCAGCTGGGCTGCCACAGCCAGG - Intergenic
1146944270 17:36863358-36863380 GCTCTAGGGTTGTCACATCCTGG + Intergenic
1151745614 17:76010207-76010229 CCTTCTGGGCTGCCACTTCCAGG + Exonic
1152398566 17:80050060-80050082 TCTGCTTGGTAGCCACAACCTGG - Exonic
1152837507 17:82543447-82543469 GCTGTGGGGGTGCCACACCCAGG + Intronic
1152855596 17:82663401-82663423 GCTCCTGCGGTGCCTCATCCTGG - Intronic
1153466851 18:5397504-5397526 GCTGCTGGCTTTAGACATCCTGG - Intronic
1156486640 18:37470538-37470560 GCTGCTGGGATGCCACATTTGGG - Intronic
1158667980 18:59449921-59449943 CCTGCTGGGTGGCTGCATCCTGG + Intronic
1158865232 18:61632258-61632280 ACTGCTTGGGTGCCACATTCTGG + Intergenic
1160507289 18:79434259-79434281 GCTGCAGGGTTGCCAGGCCCAGG - Intronic
1160568566 18:79801410-79801432 CCTGCTGGGTTTCCTCAGCCGGG + Intergenic
1160835248 19:1121940-1121962 GGGGCTGGGTGGCCACATCCAGG + Intronic
1162345506 19:10115922-10115944 GCTGGTGGGTGGGCACCTCCCGG - Intronic
1164646784 19:29864012-29864034 GGTGCTGGTTTGCCACTGCCAGG + Intergenic
1165909023 19:39212507-39212529 GCTTCTGGGTTCCCCCTTCCCGG - Intergenic
1166448859 19:42880875-42880897 GGTGTTAGGTGGCCACATCCCGG + Intronic
925189296 2:1869814-1869836 GCTCCTGGCTTGCCACTTGCTGG - Intronic
929173887 2:38958308-38958330 GCTGCTTGGTTGGCACATATAGG - Intronic
929756270 2:44768294-44768316 TCTGCAGAGTTGGCACATCCTGG + Intronic
930602246 2:53456278-53456300 GATGCTGATTTGCCACTTCCAGG + Intergenic
933769755 2:85735602-85735624 GCTGTTGGGTTGACTGATCCTGG - Intergenic
935586028 2:104801065-104801087 GCTGCTGGGTTCACAGTTCCAGG - Intergenic
936623130 2:114120729-114120751 ACTCCTGGGTTCCCACTTCCAGG + Intergenic
937001478 2:118471719-118471741 GCTCCTGGGTTGCCTGATGCAGG - Intergenic
937203603 2:120222358-120222380 GCTGCTCGGCAACCACATCCAGG + Exonic
937237323 2:120438612-120438634 GCCCCTGGGTGGCCCCATCCTGG - Intergenic
938509537 2:131926066-131926088 GCTGCTGGATTGTCAACTCCAGG + Intergenic
941116770 2:161480614-161480636 GAAGCTGGGTGACCACATCCTGG + Intronic
941400137 2:165020468-165020490 GCTGCTGGCTTTCCAGACCCTGG - Intergenic
944437983 2:199711805-199711827 ATTCCTGGGTTTCCACATCCTGG + Intergenic
948455899 2:238104501-238104523 GCTGCGGGGTTCCCCCCTCCAGG - Intronic
1170462964 20:16596511-16596533 GCTGCTGGGTATCCCCAACCAGG - Intergenic
1170782399 20:19437668-19437690 GCATCTGGGTTTCCACAGCCTGG + Intronic
1173718767 20:45235414-45235436 GCAGCTGTGTGACCACATCCTGG - Intergenic
1175817644 20:61891755-61891777 GCTGCCGTGTTCCCACCTCCCGG + Intronic
1175945888 20:62558570-62558592 GCTTCTGGGTGACCACCTCCTGG - Intronic
1176172978 20:63704517-63704539 TCTGCTGGGGTGCGACTTCCTGG - Intronic
1176976619 21:15327981-15328003 GCTGTGGGGTTGGCAGATCCAGG - Intergenic
1177981994 21:27926329-27926351 GCTGCTGGATTGTCAACTCCAGG - Intergenic
1179609889 21:42543507-42543529 GCTACTGGGTGTCCACATGCTGG + Exonic
1180839952 22:18954638-18954660 CATGCAGGGTGGCCACATCCCGG - Intergenic
1180967587 22:19798633-19798655 GCTGGTGGGTAGGCACAGCCAGG - Intronic
1181061946 22:20285841-20285863 CATGCAGGGTGGCCACATCCCGG + Intergenic
1181614556 22:24044138-24044160 GATGCTAGGTTGAGACATCCTGG + Intronic
1183509742 22:38227740-38227762 GCTGCGGGGATGGCACAGCCAGG + Intronic
1183649355 22:39145347-39145369 GCTCCTGGGTTGCCAGCGCCCGG - Intronic
1183969872 22:41468813-41468835 GCTGCTGGGCGGCCAGGTCCTGG + Intergenic
1184890377 22:47375475-47375497 GCTGCTAGGTAGCCACGACCCGG - Intergenic
955818773 3:62874784-62874806 GCTGCTGGGTTGCAGCCCCCCGG + Exonic
961051728 3:123752445-123752467 CCTGCTGGATTGCGGCATCCGGG - Exonic
962983925 3:140517590-140517612 TCTGCTGGGTGGCTAGATCCAGG - Intronic
963906098 3:150774675-150774697 GGGGCTGGGCTGCCACTTCCAGG - Intergenic
968224895 3:196967402-196967424 GCTGCTGGGTTGCCGCTTATGGG + Intronic
968561350 4:1284714-1284736 GCTGCAGGGGGTCCACATCCTGG - Intergenic
969660734 4:8525935-8525957 CCTGCTGGGCTGCCATCTCCTGG + Intergenic
971918772 4:32909890-32909912 GCTGCTGTGGTGCCCCCTCCTGG - Intergenic
973131542 4:46654058-46654080 GCTGCGGGGTTACCACAACATGG + Intergenic
975753962 4:77553350-77553372 GCTGCTGGGTTGCCAAAGAATGG + Intronic
986044224 5:4022324-4022346 CCTGCTGGATGGCCACACCCAGG - Intergenic
986169854 5:5306700-5306722 GCAGCTGGTTTGCCTCACCCTGG + Exonic
989162180 5:38401888-38401910 ATGGCTGGGTTGCCCCATCCAGG + Intronic
995492435 5:112707460-112707482 GTTGCTGGCTTCCCACAGCCCGG - Intergenic
997729550 5:136157541-136157563 GCAGCTAGGTTGTCTCATCCAGG + Intronic
1001466896 5:171975382-171975404 GCTGCTGGCCAGCCACAGCCTGG + Intronic
1002183642 5:177443939-177443961 GCTGCTGGCTTGGCACCTTCTGG - Intergenic
1002898094 6:1390646-1390668 GCCGCTCGGCTGCCACAGCCAGG + Exonic
1002943053 6:1734530-1734552 GCTTCTGGGCTGCCCCACCCTGG + Intronic
1003854687 6:10261162-10261184 GCTGCTGCTCTGGCACATCCAGG - Intergenic
1006257905 6:32845644-32845666 GCTGGTGGGTTCCCCCCTCCCGG + Exonic
1007782095 6:44260231-44260253 GCTCTTGGGTTTCCACAGCCAGG + Exonic
1010259918 6:73804011-73804033 GCTCCAGGTTTGCCACAGCCCGG + Intronic
1011192670 6:84749179-84749201 GCTGCTGGGATTCCATATTCAGG + Intronic
1013235005 6:108190442-108190464 GCTTCAGGGTTTCCTCATCCTGG + Intergenic
1015905077 6:138107989-138108011 CCTGCTGGGTTGCCAGATTTTGG + Intergenic
1017086823 6:150720797-150720819 GCTGCTGGGTTTCACCTTCCTGG - Intronic
1019133699 6:169895451-169895473 GCTGCAGTGTTGCCTCTTCCTGG - Intergenic
1024229363 7:47352639-47352661 GCTGATGGGTGGCCTCGTCCTGG - Intronic
1025039012 7:55623307-55623329 TCTGCTGGCTTGTCACATTCTGG - Intergenic
1026869341 7:73841180-73841202 ACAGCAGGGTGGCCACATCCTGG + Exonic
1029705154 7:102272231-102272253 GAGGCTGGGCTGCCCCATCCTGG + Intronic
1036411517 8:8506279-8506301 GCTGCTGGGTGGCCAAATCCAGG + Intergenic
1036702071 8:11019478-11019500 GCTGCTGGGCTGCCTCCTCTGGG + Intronic
1037456280 8:19067619-19067641 GCTGCTGGCTTGTGACACCCTGG - Intronic
1037571497 8:20161849-20161871 GCTGCTGGGTAGACTCAGCCCGG - Intronic
1037608800 8:20459225-20459247 GCTGTTGGGATTCCACACCCTGG + Intergenic
1038017254 8:23525678-23525700 GCTGCTGCCTTGTGACATCCGGG + Intergenic
1039397513 8:37239741-37239763 TCTGATGTGTAGCCACATCCTGG + Intergenic
1040639726 8:49319338-49319360 GCTGCTAAGTTTCCTCATCCCGG - Intergenic
1042109570 8:65366836-65366858 GCTGCTGGGTTGCCAAAGAATGG - Intergenic
1042300726 8:67277695-67277717 GCTTCTGTTTTGGCACATCCTGG - Intronic
1046077752 8:109333581-109333603 GCTGCTGTGTGTCCACAGCCTGG - Intronic
1047489379 8:125362080-125362102 GCGGCTGGGTCCCCACCTCCAGG - Intronic
1048967546 8:139625364-139625386 CCTGCTGGGTAGTCACAGCCTGG + Intronic
1053043149 9:34891647-34891669 GCTGCTAGGATTCCACCTCCAGG - Intergenic
1053526504 9:38835476-38835498 GATCCTGGGTTGCCACGTCCGGG - Intergenic
1054198730 9:62059901-62059923 GATCCTGGGTTGCCACGTCCGGG - Intergenic
1054639625 9:67528464-67528486 GATCCTGGGTTGCCATGTCCGGG + Intergenic
1055030820 9:71769749-71769771 GCTGCAGGACTGCCAAATCCGGG + Intronic
1057336376 9:94158793-94158815 GCAGCTGAGTCCCCACATCCAGG - Intergenic
1058868542 9:109183209-109183231 GCTGCTGAGAGGTCACATCCTGG + Intronic
1060143202 9:121228036-121228058 GCGGCTGGGTGTCCACTTCCTGG - Intronic
1062442676 9:136578189-136578211 GCTGCTGGCCTGGCACCTCCCGG + Intergenic
1062467640 9:136688045-136688067 GGGGCTGGGTTGCCCCACCCTGG + Intergenic
1185561292 X:1062370-1062392 CCTACTGTGTTGCCACCTCCAGG + Intergenic
1186130180 X:6457531-6457553 GCAGCTGGGTTGCACCTTCCTGG - Intergenic
1189105793 X:38233916-38233938 GTTGCTGCTTTGGCACATCCTGG + Intronic
1189372473 X:40439779-40439801 AGGGCTGGCTTGCCACATCCTGG + Intergenic
1191739608 X:64422911-64422933 TCTGCTGGGTGGCCACCACCTGG - Intergenic
1194260110 X:91684772-91684794 GCTTCTGGGTTGCCACAGAATGG - Intergenic
1197286636 X:124602760-124602782 TCTTTTAGGTTGCCACATCCTGG - Intronic
1200578804 Y:4923831-4923853 GCTTCTGGGTTGCCACAGAATGG - Intergenic