ID: 1089707151

View in Genome Browser
Species Human (GRCh38)
Location 11:120286937-120286959
Sequence AGCCACAGTGGACCACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089707149_1089707151 -1 Left 1089707149 11:120286915-120286937 CCATCTTACTGATAACATTCTTA 0: 1
1: 0
2: 1
3: 24
4: 265
Right 1089707151 11:120286937-120286959 AGCCACAGTGGACCACAAGCAGG 0: 1
1: 0
2: 3
3: 13
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089707151 Original CRISPR AGCCACAGTGGACCACAAGC AGG Intronic
900299091 1:1967850-1967872 AGCAGCAGTGGACACCAAGCAGG + Intronic
900429036 1:2593352-2593374 AGCCACAGGGGAAAACCAGCTGG + Intronic
902807001 1:18867353-18867375 AGGGACAGGGGACAACAAGCAGG + Intronic
904289142 1:29472370-29472392 AGTCCCAGTGGACCACAAGTCGG + Intergenic
904562624 1:31408949-31408971 AGCCACAGGGGGCCAGGAGCTGG - Intergenic
906022780 1:42645589-42645611 AGCAACAGTGATCAACAAGCAGG - Intronic
906747378 1:48231488-48231510 AGCCAGAGAGGACCCCAAACTGG + Intronic
909467196 1:75985396-75985418 AGCTACAGTGGAACACAGCCAGG - Intergenic
912170811 1:107097198-107097220 AGGCACTGTGGACCACTAGAGGG - Intergenic
912911725 1:113767540-113767562 AGCCACTGTGGACAACAGTCTGG + Intronic
914345642 1:146796239-146796261 AGGCCCAGTGGTCCACAGGCTGG + Intergenic
916498614 1:165367558-165367580 AACCACAGTTGTCCACAAGAGGG + Intergenic
918515203 1:185356054-185356076 AGCTACATTAGACCACAAGATGG - Intergenic
922962736 1:229662333-229662355 ACCCACTGTGGTCCACAAGCAGG - Intergenic
1063572052 10:7224498-7224520 AGCCACAGTTGACGACATGTGGG - Intronic
1063590865 10:7394377-7394399 AGCAAAAGTGGTCCCCAAGCAGG - Intronic
1067040854 10:42952435-42952457 AGCCACATGGGCCCACAGGCGGG + Intergenic
1067285686 10:44906107-44906129 AGCCACAGTGCTACAAAAGCAGG + Intergenic
1070164764 10:73889161-73889183 AGGCCCAGTGGCCCACAGGCAGG - Intergenic
1070279188 10:75036522-75036544 AGCCACAGGGGCACAAAAGCAGG + Intergenic
1076462569 10:130656638-130656660 AGGCAGAGTGGACCCCGAGCGGG + Intergenic
1079237990 11:18703120-18703142 TGCCACACAGGCCCACAAGCAGG - Exonic
1079243918 11:18739678-18739700 AGCCACAGGGGTACAGAAGCAGG - Intronic
1082694409 11:56342922-56342944 AGGCACTGTGGACTACAAGAAGG + Intergenic
1083938624 11:65883262-65883284 GGACAGAGTGGTCCACAAGCTGG - Exonic
1085263684 11:75223925-75223947 AGCCAAAGTGGGCCTCAACCTGG - Intergenic
1087637288 11:100716308-100716330 CTTCACAGTGAACCACAAGCAGG - Intronic
1088590013 11:111395237-111395259 AGCCACATGGGACCTCAGGCCGG - Intronic
1089707151 11:120286937-120286959 AGCCACAGTGGACCACAAGCAGG + Intronic
1090450160 11:126798929-126798951 CGCCACAGAGGAGCACATGCAGG + Intronic
1091337578 11:134784064-134784086 AGCCAAGTTGAACCACAAGCAGG - Intergenic
1091658242 12:2361566-2361588 AGCCACTTTGGACCATAAGATGG + Intronic
1096758856 12:53822896-53822918 AGCCACAGAGGATTACAGGCTGG - Intergenic
1098041623 12:66358928-66358950 AGCCAGAGTGGGACATAAGCAGG - Intronic
1099499775 12:83399603-83399625 AGTCACAGTGGAGCTAAAGCTGG + Intergenic
1100962307 12:99976178-99976200 AGACACAGTGGACTACTAGAGGG + Intronic
1101041315 12:100758675-100758697 CACAACAGAGGACCACAAGCTGG + Intronic
1101519462 12:105468128-105468150 AGCCACAGTGAACCATAAGCTGG - Intergenic
1102603570 12:114051739-114051761 AGCCACAGTGGACCAAGATGGGG - Intergenic
1112478003 13:99749546-99749568 AGCCATGGTGGACCACAAACTGG + Intronic
1115141486 14:30176540-30176562 AGCCACAGTGCACCCCAGCCGGG - Intronic
1116858722 14:49976722-49976744 ATACACAGAGGGCCACAAGCTGG + Intergenic
1117951889 14:61091053-61091075 AGGCACAGACGCCCACAAGCAGG + Intergenic
1119187850 14:72656366-72656388 AGTCGTAGTGGATCACAAGCTGG - Intronic
1120079821 14:80203123-80203145 AGCCAAAGTTGACCACTAGTGGG + Exonic
1120157422 14:81109111-81109133 TGCCAAAGTGGATCACAGGCCGG + Intronic
1122034614 14:98938261-98938283 GGCCACACTGGACCACACTCAGG + Intergenic
1122832295 14:104405012-104405034 AAGCACAGTGGACCACATGCTGG - Intergenic
1122939020 14:104973005-104973027 AGGCACACTTGACCACCAGCAGG + Intronic
1127503667 15:59578070-59578092 AGGCACAGGGGACCATAGGCCGG - Intergenic
1127972829 15:63975137-63975159 AGCCCCAGTGGAGCACATGCTGG - Intronic
1128053938 15:64685794-64685816 AGCCACAGGAGTCCACCAGCTGG - Exonic
1128111128 15:65076884-65076906 AGCCACAGTGCTCCACCAGCAGG - Exonic
1128638514 15:69318429-69318451 ATACCCAGTGGACCACGAGCAGG - Intronic
1130567276 15:85007330-85007352 AGCCACAGTAGCACAAAAGCAGG + Intronic
1131132749 15:89910570-89910592 AGCCAAATGGGACCACCAGCTGG - Intronic
1132135383 15:99332701-99332723 AGCCATAGTTTACCACCAGCTGG + Intronic
1132711226 16:1268885-1268907 AGCCACAGTGGAGCCCAGGGCGG + Intergenic
1132789197 16:1675628-1675650 AGCCACTGTAGACCACAGGCAGG + Exonic
1138023748 16:53506147-53506169 ACAAACAGTGAACCACAAGCAGG + Intergenic
1139988344 16:70919028-70919050 AGGCCCAGTGGTCCACAGGCTGG - Intronic
1140482196 16:75267648-75267670 AGGAACAGTGGGCCCCAAGCAGG - Intronic
1140706537 16:77635675-77635697 AGCCACATGGAGCCACAAGCAGG - Intergenic
1142783328 17:2199707-2199729 CGCCACGGTGGCCCACAGGCTGG - Intronic
1151223468 17:72631285-72631307 GGCCACCGTGGAGCACAACCAGG + Intergenic
1151320577 17:73350060-73350082 AGACACAGTGGGGCCCAAGCAGG - Intronic
1151416618 17:73970449-73970471 AGCCAGAGAGGAGCCCAAGCAGG - Intergenic
1153734658 18:8052755-8052777 AGCCACTATGGAACACAAGTTGG - Intronic
1154215344 18:12411767-12411789 AGACACAGTGGAACACCAGTGGG - Intronic
1155243728 18:23887346-23887368 AGCCACAGGGGACCAACACCTGG + Intronic
1155325068 18:24656938-24656960 TGGCACTGTGGACCACAGGCAGG - Intergenic
1155682888 18:28511525-28511547 AGCCATACTGGAATACAAGCTGG - Intergenic
1159934628 18:74353356-74353378 AGTAGCAGTGGACCACAAGGTGG + Exonic
1160576672 18:79858640-79858662 AGCCACAGTGGAAAACAGTCTGG - Intergenic
1161735786 19:5991405-5991427 AGCCACAGTGGACCTCAAGGTGG - Intergenic
1165476825 19:36035472-36035494 TGCCACAGTGGATGCCAAGCCGG - Exonic
1166213533 19:41321898-41321920 AGCCAGAGCTGACCACAGGCAGG - Intronic
1167782399 19:51607531-51607553 GGCCTCAGTGGACCACAGGATGG - Intergenic
925706147 2:6686057-6686079 AGCCAGAGGGGACAACGAGCCGG + Intergenic
929047817 2:37807278-37807300 AGCCACTTTGGACAACAATCTGG - Intergenic
929470795 2:42190802-42190824 AGCTTCACTGGAACACAAGCAGG - Intronic
930565248 2:53010704-53010726 AGACACTGTGGACTACAAGAGGG - Intergenic
933934927 2:87195462-87195484 ACCCACAGTGAACCCTAAGCAGG + Intergenic
934976280 2:98805096-98805118 AGCCACCATGGTCCACAATCAGG + Intronic
936358216 2:111770437-111770459 ACCCACAGTGAACCCTAAGCAGG - Intronic
938388018 2:130881788-130881810 AGCCAGTGAGGACCACAGGCTGG + Intronic
939959488 2:148553820-148553842 AGCAACAGTAGAGAACAAGCAGG + Intergenic
941033006 2:160534507-160534529 AGGCACAGTGGAGCACATGTTGG - Intergenic
943648942 2:190436330-190436352 AGCCAGAGTGGACTACTAGTAGG + Exonic
945869478 2:215211131-215211153 AGACACAGTGGCCCATATGCTGG - Intergenic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946320329 2:218950273-218950295 AGGCACTGTGGACCACAACCCGG - Intergenic
946712393 2:222519675-222519697 AGACACTGTGGACCACTAGACGG - Intronic
947186536 2:227460239-227460261 AGGCACCGTGGACCACAGCCAGG - Intergenic
1169444425 20:5659554-5659576 AGGCACACTGTACCAAAAGCTGG - Intergenic
1169757959 20:9063762-9063784 AGCCACAGTGAACCAAGAGAAGG + Intergenic
1171086904 20:22246028-22246050 AGACATAGTGGTCCCCAAGCTGG - Intergenic
1175033118 20:55974624-55974646 AGCCACAGTGGTGCACCAGGTGG + Intergenic
1176181284 20:63750955-63750977 AGCCACACTGAACCTCAAACAGG + Intronic
1176293233 21:5057263-5057285 TGCAACAGAGGACCACAGGCGGG + Intergenic
1176673306 21:9753874-9753896 AGCCACAGTGGATGAAAACCTGG - Intergenic
1179167126 21:38944039-38944061 AGCCACAGGGAACCAGAGGCTGG + Intergenic
1179864027 21:44206387-44206409 TGCAACAGAGGACCACAGGCGGG - Intergenic
1181274171 22:21678008-21678030 AGCCACATTGGACTCCCAGCTGG - Intronic
1183506185 22:38210229-38210251 AGCCACTGTGGCCCTTAAGCAGG - Intronic
1184446402 22:44549879-44549901 AGGCACTGTGGACCACAGTCTGG - Intergenic
1185126031 22:49011297-49011319 TGCCACGGTGGAGCACAGGCAGG + Intergenic
952180306 3:30910053-30910075 AGCCTCTGGGGACCCCAAGCAGG - Intergenic
953278223 3:41525465-41525487 AGCCACAGGGAGCCACAGGCAGG + Intronic
953590089 3:44242600-44242622 AGCCAAAATGGACCACAAGTAGG - Intronic
954405584 3:50343357-50343379 AGCCACTCTGGGCCACCAGCAGG + Exonic
954652983 3:52176470-52176492 AGCCACAGTGGAGGAGGAGCTGG - Intergenic
956487035 3:69733826-69733848 AGCCATAGTAGACCACAGGGTGG + Intergenic
959309975 3:104723002-104723024 AGCCACTGTGGAGAACAATCTGG - Intergenic
961219722 3:125190042-125190064 AACTACAGAGGGCCACAAGCTGG + Intronic
962229388 3:133648013-133648035 AGGCACAGTGAATCTCAAGCAGG + Intronic
963318775 3:143789716-143789738 AGGCACAGTGGCACACAAGAGGG + Intronic
967313410 3:188127887-188127909 AGGCATGGTGGACTACAAGCTGG + Intergenic
967821507 3:193843115-193843137 AGCCACAGTGGACTAAAGCCAGG + Intergenic
968713722 4:2139159-2139181 AGCCACACTGGGTCACCAGCAGG + Intronic
969705392 4:8788840-8788862 AGAGACAGAGGACCACAGGCTGG + Intergenic
970526864 4:16941739-16941761 AGGCACAGAGAAGCACAAGCAGG + Intergenic
981535946 4:145799838-145799860 AGCCATAGTAGACCATAAGATGG + Intronic
985636490 5:1038226-1038248 TGCCACAGTGGAGCACGAGGTGG + Exonic
988691970 5:33581436-33581458 CACCACAGTGGACCACAGGTGGG - Intronic
990255617 5:53965747-53965769 ACCCACAGTAGATCAGAAGCAGG - Intronic
994548486 5:101202312-101202334 AGCCATAGTGGCCTACATGCTGG - Intergenic
995111280 5:108431594-108431616 AGACACAGGGGACTACAAGAGGG + Intergenic
996301381 5:121990408-121990430 AGACACCGTGGACTACTAGCGGG + Intronic
996538328 5:124601978-124602000 GGCCACAGTGGGACACAAGTGGG + Intergenic
999001622 5:147929982-147930004 AGCCTCAATGGGTCACAAGCAGG - Intergenic
999821642 5:155234572-155234594 TGCCACAGTTGGTCACAAGCAGG - Intergenic
999852507 5:155558066-155558088 AGCCACTGTGGACAACAGTCTGG - Intergenic
1001182731 5:169535842-169535864 AGCCAAAGTGGAATTCAAGCTGG + Intergenic
1002448050 5:179302108-179302130 AGCCACACAGGAGCAGAAGCCGG + Intronic
1003125383 6:3351703-3351725 AGCCACACTGTACCACAGGGTGG + Intronic
1007124362 6:39412819-39412841 AGCCACGCTGGACCACAAAAAGG - Intronic
1007398983 6:41593072-41593094 GGTCAAAGTGGACCTCAAGCTGG - Intronic
1007480328 6:42145531-42145553 AGCCACTGTGTGCCACACGCTGG + Intergenic
1007729210 6:43935614-43935636 AGCCTGAGTGCACCACAGGCAGG - Intergenic
1010560858 6:77347989-77348011 AGACCCAGTGGACTACTAGCAGG - Intergenic
1013271314 6:108547858-108547880 AGCCACTGTGGAAAACAATCTGG + Intergenic
1013487746 6:110614300-110614322 AGTCACAATGGAACACATGCAGG + Exonic
1016173267 6:141046298-141046320 AGACACAGGGGACTACAAGAAGG - Intergenic
1018051208 6:160010199-160010221 AACCAGAGTGGACTACAAACAGG - Intronic
1018128070 6:160701168-160701190 AGCCACACTGGGCAACAAGAGGG - Intergenic
1018151596 6:160944950-160944972 AGCCACAGGAGTCCACATGCAGG + Intergenic
1018836293 6:167486743-167486765 AGCCACAGTGGACTCCTCGCTGG + Intergenic
1019026669 6:168971381-168971403 TGCCCCAGTGGACCAAAAGTTGG - Intergenic
1022922098 7:35025974-35025996 AGCCACAGTGGTCCAAACTCTGG + Intronic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1027223048 7:76226218-76226240 GGACACAGTGGGCCACAAACTGG - Intronic
1028777432 7:94694523-94694545 TGCCAAGGTGGACCACAATCTGG - Intergenic
1032397805 7:131603114-131603136 AGCCACAGAGAGCCACATGCAGG + Intergenic
1034211234 7:149365036-149365058 AGGCAGAGTGCACCACAACCAGG + Intergenic
1034945664 7:155260235-155260257 AGCCACAGTGGGCCACAAGGAGG + Intergenic
1035116942 7:156532678-156532700 AGGCACATTGGAACACAAGGAGG + Intergenic
1035279730 7:157770025-157770047 AGCCACAGAGAACCCCAGGCCGG - Intronic
1036544059 8:9749421-9749443 AGCCACAGTGAACCACTCCCTGG - Intronic
1037794686 8:21982720-21982742 AGCCACAGAGCCCCACATGCTGG + Exonic
1042614939 8:70638372-70638394 AGGGCCAGTGGACCACAAGCTGG - Intronic
1043416590 8:80057266-80057288 AGCCACTGTGGAACACAATTTGG + Intronic
1045112681 8:98949045-98949067 GGCCACGGTGGACCACCTGCAGG + Exonic
1048068556 8:130998417-130998439 AGCCACAGTGGGCCGCATGCTGG - Intronic
1050075477 9:1858180-1858202 AGCAGCAGTGGGCCTCAAGCAGG - Intergenic
1052726836 9:32238793-32238815 AGACACTGTGGACTACTAGCTGG - Intergenic
1053069714 9:35093965-35093987 GGCCACAGTGGTCCACACCCAGG + Exonic
1053196666 9:36125160-36125182 AGACATAGAGGACCACAAGCTGG + Intergenic
1056682885 9:88734880-88734902 AGGTTCAGTGAACCACAAGCAGG - Intergenic
1057046524 9:91890271-91890293 AGCCACTGTCGGCCTCAAGCAGG + Intronic
1057301981 9:93891820-93891842 AGCCACAGTGACCCACAGGGAGG - Intergenic
1061952899 9:133946118-133946140 AGCCACAGTGCACGAGAACCTGG + Intronic
1062095554 9:134701429-134701451 GACCACAGTGGACCGCCAGCCGG - Intronic
1062357274 9:136170836-136170858 AGCCACAGAGGACCCCACACTGG + Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1203771853 EBV:53626-53648 GGCCACGTTGGACCCCAAGCGGG - Intergenic
1185615310 X:1418533-1418555 AGCCACTCTGGACCACAAGGAGG + Intronic
1192940362 X:75904872-75904894 AAGCACAGTGGACAACATGCTGG + Intergenic
1194890784 X:99375953-99375975 AGCCACCCATGACCACAAGCTGG + Intergenic
1197647708 X:129036042-129036064 TGTCTCAGTGGACCACATGCTGG + Intergenic
1199596049 X:149506591-149506613 AGCAACAGTTGACAAAAAGCTGG + Intronic