ID: 1089709500

View in Genome Browser
Species Human (GRCh38)
Location 11:120305025-120305047
Sequence ATCAGGCATTTGGGCACCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089709500 Original CRISPR ATCAGGCATTTGGGCACCCT GGG Exonic
900202865 1:1419175-1419197 CTCAGGCATCTGGGCCACCTCGG + Exonic
900682982 1:3927928-3927950 ATCAGCTATCTGGGCATCCTTGG + Intergenic
902133799 1:14286724-14286746 ATCAAGAATTTGGGCTACCTGGG - Intergenic
905210508 1:36370805-36370827 ATTAGGGACTTGAGCACCCTTGG - Intronic
905948752 1:41927233-41927255 ATCTCCCAATTGGGCACCCTTGG + Intronic
906731067 1:48081527-48081549 ATGAGGAATTTGGGAACCCTGGG + Intergenic
909067501 1:70953265-70953287 ATAAGGGATTTGAGCATCCTGGG + Intronic
909687208 1:78363384-78363406 ATCAGGAACTTGAGCAACCTTGG - Intronic
911218215 1:95218723-95218745 ATCAGGAATTTGAGCACCCTTGG + Intronic
912655917 1:111486277-111486299 AGCAGGGATGTGGCCACCCTTGG - Intronic
915721379 1:157988259-157988281 ATCAGGGATCTGGGCTTCCTTGG + Intergenic
917960506 1:180140648-180140670 ATCAGGCATTTGAGCATCTGTGG - Intergenic
920516051 1:206585320-206585342 CCCAGGCCTTAGGGCACCCTGGG + Intronic
923250995 1:232179791-232179813 ACCAGGCATGTGGGCACCTCTGG - Intergenic
923413287 1:233730986-233731008 AGCCTGCCTTTGGGCACCCTTGG + Intergenic
1063444280 10:6099491-6099513 ATAAGGGACTTGGGCACGCTTGG - Intronic
1063738253 10:8787120-8787142 ATCAGGTATCTGGGCATCCTTGG + Intergenic
1065541552 10:26774065-26774087 ATGAGGGATTTGAGCATCCTTGG - Intronic
1065749357 10:28871425-28871447 AGGAGGCATTTGGGCACCAAAGG - Intronic
1071062198 10:81585200-81585222 ATCAGGATTCTGGGCATCCTAGG + Intergenic
1073209458 10:101787396-101787418 ATCATGCTTTTGGCCACACTTGG + Exonic
1075693630 10:124418403-124418425 AGGAGGCCTTTGGGCACCCTTGG - Intronic
1075718904 10:124573781-124573803 ATCATGGACTTGGGCCCCCTAGG + Intronic
1077992758 11:7426499-7426521 TTCAGGCATTTGGGCACACAAGG + Intronic
1079050244 11:17149421-17149443 ATCAGGGATTTGAGCATCCTGGG + Intronic
1080422260 11:32121051-32121073 ATCAGGCACTTGAGCGCCCTTGG + Intergenic
1084823300 11:71709374-71709396 ATCAGGCCTTTGGACAACTTCGG - Intergenic
1086360865 11:86057857-86057879 ATCAGGGATTTGAGCACCCTTGG + Intronic
1086408798 11:86522925-86522947 ATCAGGGATTTGAGCATCCATGG + Intronic
1087778538 11:102278871-102278893 ATCAGGGACTTGAGCATCCTTGG + Intergenic
1089709500 11:120305025-120305047 ATCAGGCATTTGGGCACCCTGGG + Exonic
1091501806 12:1025037-1025059 ATCAGGGACTTGAGCATCCTGGG + Intronic
1092760693 12:11808614-11808636 ATAAGGGATTTGAGCATCCTTGG + Intronic
1092902660 12:13074556-13074578 ATCAGACATTTGTGCAGCATGGG + Intronic
1093847274 12:23988249-23988271 ATCAGACATTTGGGTCACCTGGG + Intergenic
1096505982 12:52093563-52093585 GTCAGGCCTTTAGGCTCCCTGGG - Intergenic
1097125848 12:56774282-56774304 ATAAGGGATTTGAGCATCCTCGG - Intronic
1097141868 12:56908853-56908875 ACCAGGCATTTTTGCACTCTTGG + Intergenic
1097311197 12:58121438-58121460 ATCAGGGACTTGAGCACCCGTGG - Intergenic
1098451730 12:70626684-70626706 ATAAGGAATTTGAGCATCCTTGG + Intronic
1101974631 12:109346301-109346323 ATCAGGCAATTGAGCATCCATGG + Intergenic
1103322958 12:120102350-120102372 ATCAGTGCTTTGGGCAGCCTGGG - Intronic
1104551248 12:129759477-129759499 ATCAGGCACTTAGTCACCATGGG + Intronic
1106175955 13:27331888-27331910 ATCAGGGACTTGAGCATCCTTGG + Intergenic
1106615371 13:31322162-31322184 ATCAGCCTTTTTGGCAGCCTTGG + Intronic
1107824887 13:44319866-44319888 TTGAGGCATTTAGGCATCCTTGG - Intergenic
1111962754 13:94829332-94829354 ATGAGGCACTGAGGCACCCTGGG - Intergenic
1112051809 13:95650098-95650120 AACAGTCATTTGGCCACTCTCGG + Intergenic
1114640158 14:24214271-24214293 AACAGCCATTTGGGGTCCCTAGG - Intronic
1115526413 14:34284820-34284842 AGCAGGCATTGGGGAGCCCTTGG - Intronic
1117369026 14:55058993-55059015 ATCAGGTACTTGAGCATCCTGGG + Intronic
1117675444 14:58151343-58151365 ATGAGACATTTGGGCACCTCCGG + Intronic
1119938637 14:78616984-78617006 AGCAGGCATGTGGGGACACTGGG - Intronic
1124270702 15:28277888-28277910 ATCAGGGACTTGAGCATCCTAGG - Intronic
1124939167 15:34202025-34202047 ATCAGGGATTTGAGCATCCTCGG + Intronic
1125544734 15:40494762-40494784 ATCAGGCATTTGGCCAGGCATGG - Intergenic
1125695875 15:41636864-41636886 ATCAGGGATTTGAGCATCCATGG + Intronic
1125745923 15:41997094-41997116 ATCAGGGATGTGGCCAGCCTGGG - Intronic
1126839977 15:52708362-52708384 ATCAAGCATTTAGGTGCCCTAGG - Intronic
1128495659 15:68197082-68197104 AGCAGGCATTTGTGCTCCCAGGG + Intronic
1129316742 15:74749835-74749857 TTCAGGCCTTTGGGGACCCGAGG - Exonic
1129869305 15:78930591-78930613 GTCTGACATTTGGGCACTCTGGG - Intronic
1130460802 15:84157258-84157280 AGCAGGCATTGGTGCAGCCTGGG - Intergenic
1131244701 15:90780923-90780945 ATCAGGGACTTGAGCATCCTTGG + Intronic
1134198352 16:12176665-12176687 ATAAGGGACTTGAGCACCCTTGG + Intronic
1136085112 16:27879304-27879326 ATCAGGGACTTGAGCATCCTTGG - Intronic
1136341907 16:29649615-29649637 ATCAGGCATTTGCGATGCCTTGG + Intergenic
1138411596 16:56844653-56844675 ATCAGGCACATGGGCCCACTAGG + Exonic
1140534272 16:75694889-75694911 ATCAGGAACTTGAGCATCCTTGG + Intronic
1141883694 16:86877224-86877246 CTCAGGCATTTGGACACCAGGGG - Intergenic
1142841271 17:2632812-2632834 ATCAGGGATATGAGCAACCTCGG + Intronic
1144641758 17:16940971-16940993 ATCAGGCACTTGGACATCCGCGG - Intronic
1146632567 17:34481444-34481466 ATCAGGCTTCTGGGAACCATAGG - Intergenic
1148386395 17:47237905-47237927 ATCAGGCATTTCTGCACTCTTGG - Intergenic
1149312014 17:55403994-55404016 AGCAGGCATTTGGGCAATTTAGG + Intronic
1152560084 17:81073534-81073556 GTCAAGCATTTGGGGACCCTCGG + Intronic
1152772581 17:82179380-82179402 CTCCGGCATCTGGGCATCCTTGG - Intronic
1152943358 17:83184401-83184423 ATCTGGGATGTGGGCACCCTTGG - Intergenic
1154373398 18:13787078-13787100 ATCAGGCACTTGAGCATCCATGG + Intergenic
1159926155 18:74270770-74270792 ATCAGGGACTTGAGCACCTTCGG + Intronic
1163722058 19:18903043-18903065 ATGGGGCATCTGGGCAGCCTGGG - Intronic
1164504540 19:28848539-28848561 TTCAGGGATTTGGGCAGCCCAGG - Intergenic
1164603594 19:29579934-29579956 AACAGGCATATGGGGGCCCTGGG + Intergenic
926536365 2:14118266-14118288 ATAAGGGATTTGAGCACCTTTGG + Intergenic
927660067 2:24985585-24985607 GCCAGGCACGTGGGCACCCTCGG - Intergenic
928160905 2:28923665-28923687 ATCAAGTGTTTGGGCATCCTGGG - Intronic
928394180 2:30931468-30931490 AACAGGCAAGTGGGCACCCTTGG + Intronic
929568754 2:43006674-43006696 AGCAGGCTATGGGGCACCCTGGG - Intergenic
930037344 2:47095009-47095031 ATCTGGCATTTGGCTGCCCTGGG - Intronic
931361306 2:61580102-61580124 AGCAGGAATTTGGCCAACCTGGG + Intergenic
931824804 2:65989350-65989372 ATCGGGCACTTGAGCACCCATGG + Intergenic
935897778 2:107756248-107756270 ATCAGGCACTTGAGCATCCTTGG + Intergenic
937003612 2:118490850-118490872 AACAGGCAGTATGGCACCCTTGG + Intergenic
938078817 2:128358228-128358250 ATCAACCAGCTGGGCACCCTTGG + Intergenic
942069659 2:172304756-172304778 ACCAGGCATGTGGGCACCTCAGG + Intergenic
943504521 2:188737218-188737240 ATCATGCATTTGGACAAACTAGG + Intronic
945092918 2:206192842-206192864 ATCAGGGACTTGAGCATCCTTGG - Intronic
948186266 2:236023847-236023869 TTCAGGCTATAGGGCACCCTGGG + Intronic
948950725 2:241249560-241249582 CCCAGGCATCTGGGCACCCAGGG + Intronic
1171972097 20:31570869-31570891 ATAAGGCCTTTGTGCGCCCTGGG - Exonic
1172206679 20:33167442-33167464 ACCAGGCATTTGGGCCACCAGGG - Intronic
1172845300 20:37926657-37926679 ACAAGGCATTTGGACACTCTGGG + Intronic
1173369856 20:42426004-42426026 ATCCAGCATTTGGGTACCCCTGG - Intronic
1174499066 20:50970901-50970923 ATTAGGCCTTTGGACACCCAAGG + Intergenic
1177162602 21:17564178-17564200 ATCAGGGACTTGAGCATCCTTGG - Intronic
1179406498 21:41130763-41130785 ATAAGGGATTTGAGCATCCTTGG - Intergenic
1179638197 21:42728230-42728252 ATAAGGAATTTGAGCATCCTTGG + Intronic
1181640083 22:24191668-24191690 AGCAGGCACTCGGCCACCCTGGG - Intergenic
1184046569 22:41976186-41976208 TGCAGGCAGGTGGGCACCCTGGG - Intergenic
1184572753 22:45336846-45336868 ATCAGGCTAGTGGTCACCCTTGG - Intronic
949385494 3:3497485-3497507 ATAAGGGACTTGCGCACCCTTGG - Intergenic
949698744 3:6730637-6730659 ATCAGGGACTTGAGCATCCTTGG + Intergenic
951457095 3:22904750-22904772 ATTAAGCATTAGGGCACCCTGGG - Intergenic
953463512 3:43100409-43100431 AACAGGCACTTGAGCATCCTTGG + Intronic
953751387 3:45611265-45611287 ATCAGGCATTTGGCCTCAGTGGG - Intronic
953866206 3:46585337-46585359 ATCAGGGATTTAGACCCCCTAGG - Intronic
954904386 3:54047444-54047466 ATCAGGGAGTTGAGCACCCACGG - Intergenic
956246732 3:67191963-67191985 ATCAGACATTTGAGCACCCATGG + Intergenic
956498441 3:69854351-69854373 ATCAGACACTTGAGCACCCATGG - Intronic
959997447 3:112694645-112694667 ATCAGACATTTGGGGACTATTGG + Intergenic
960883851 3:122374391-122374413 ATCAGGGACTTGAGCATCCTTGG - Intronic
961629300 3:128284553-128284575 AGCAGGCTTTTGGGCACTCAGGG + Intronic
962277629 3:134028318-134028340 ATCAGGAATTTTGGAACCTTTGG - Intronic
962607346 3:137044001-137044023 CTAAGGCATTAAGGCACCCTTGG - Intergenic
963111132 3:141689034-141689056 CTAAGGCATTTGGGCCCCTTTGG - Intergenic
968842863 4:3021010-3021032 ATCAGGGACTTGAGGACCCTTGG + Intronic
969685891 4:8674035-8674057 GTCAGGGATTTGAGCATCCTTGG + Intergenic
970235336 4:13952914-13952936 ATCAGGGATGTGGGAACCCTGGG + Intergenic
972095330 4:35341333-35341355 ATCAGGCATTTGGGGACTACTGG + Intergenic
975473220 4:74794076-74794098 ATCTGGCAATTGGGCACCTGGGG - Intronic
977663527 4:99618220-99618242 ATAAGGGACTTGAGCACCCTTGG + Intronic
977676245 4:99751022-99751044 ATCAGGGATTTGGGCATCCTTGG + Intergenic
977894569 4:102348889-102348911 CTCAGGCACTTGGGAAACCTGGG + Intronic
978361368 4:107933672-107933694 ATCAGGGACTTGAGCATCCTAGG - Intronic
978555408 4:109974162-109974184 ATCAGGGAATTGAGCATCCTTGG + Intronic
981887203 4:149690650-149690672 ATCAGGAACTTGGGCATTCTCGG + Intergenic
984752865 4:183295778-183295800 GTCAGGGATCTCGGCACCCTGGG - Intronic
984768014 4:183414253-183414275 ATCAGGAGTTTGGGCACTTTAGG - Intergenic
984792180 4:183625038-183625060 ATCAGGGACTTGAGCATCCTTGG - Intergenic
987293164 5:16526947-16526969 ATCAGTCATTGGCTCACCCTAGG - Intronic
987306686 5:16644098-16644120 ATCAGGGACTTGAGCATCCTTGG + Intergenic
988230444 5:28471332-28471354 ATCAGAAATTTGGTCAACCTAGG + Intergenic
989280578 5:39638151-39638173 ATAAGGGATTTGAGCATCCTTGG - Intergenic
991938526 5:71827692-71827714 ATGAGGCCTTTGGGCAGGCTAGG + Intergenic
995176128 5:109179793-109179815 ATCAGGGATTTGAGCATCTTTGG + Intronic
1000287833 5:159843021-159843043 ATCAGGAATTTGAGCATCCTTGG + Intergenic
1000614609 5:163413342-163413364 AGCAGGCACGTGGGCACCTTTGG - Intergenic
1001601727 5:172933246-172933268 ATAAGGGGTTTGGGCAGCCTTGG - Intronic
1006955306 6:37864859-37864881 ATCAGGGACTTGAGCATCCTCGG - Intronic
1007070476 6:39034046-39034068 ATCTGGCTTTTGAGCACCCTAGG + Intergenic
1009705577 6:67246418-67246440 ATCAGGCATTTTTGCACTTTGGG - Intergenic
1010754991 6:79656771-79656793 ATCAAGGATTTGAGCATCCTTGG + Intronic
1013346643 6:109266671-109266693 ATAAGGCACTTGTGCATCCTTGG - Intergenic
1022028410 7:26469406-26469428 AGCAGGGATTTGGGGACACTGGG - Intergenic
1022280977 7:28909053-28909075 ATCAGGAACTTGGGCATCCAGGG - Intergenic
1023187710 7:37549026-37549048 ATCAGGCCTTTGGGTACCTGAGG + Intergenic
1030581052 7:111356470-111356492 ATCAGGGATTTGAGCATCCTCGG + Intronic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1034498297 7:151434624-151434646 ATCAGGAACTTGAGCATCCTCGG - Intronic
1035131095 7:156654377-156654399 ATCAGGGACTTGAGCATCCTTGG + Intronic
1036601070 8:10260566-10260588 AGCAGGCATTTGTGGTCCCTGGG - Intronic
1036909062 8:12737562-12737584 ATCAGGGACTTGAGCATCCTTGG + Intronic
1038757038 8:30351544-30351566 ATCAGGAATTTAGGAAACCTGGG - Intergenic
1039022684 8:33224940-33224962 ATCAGGGACTTGGGCATCCTTGG - Intergenic
1039752592 8:40492084-40492106 AGCAGGCAGTAGTGCACCCTGGG - Intergenic
1040431967 8:47351839-47351861 ATCAGGAACTTGAGCATCCTTGG + Intronic
1041603003 8:59744420-59744442 ATCAATCATTTGGGTTCCCTAGG - Intergenic
1045577675 8:103443702-103443724 ATCAAGGACTTGGGCATCCTTGG - Intergenic
1047246990 8:123154761-123154783 ATAAGGCAATTGTGCACACTAGG + Intergenic
1047867547 8:129043489-129043511 ATCAGGAACTTGAGCATCCTTGG - Intergenic
1049334299 8:142074643-142074665 ATCCTGCATTTGGGGTCCCTGGG - Intergenic
1050274113 9:3979023-3979045 ATCACACATTTGGGCACCCATGG + Intronic
1052572241 9:30241669-30241691 AAAAGCCATTTGGGCAGCCTAGG - Intergenic
1052809092 9:33041197-33041219 ATCAGGGACTTGAGTACCCTCGG + Intergenic
1053046685 9:34926256-34926278 ATGAGTTATTTGGCCACCCTGGG + Intergenic
1055601709 9:77925843-77925865 ATCAGGTACTTGAGCATCCTTGG - Intronic
1058251242 9:102697979-102698001 AGCAGGAATTTGGGCCCCCAAGG - Intergenic
1058477349 9:105351157-105351179 ATCATGTATTTGGGCACCTCTGG + Intronic
1061474891 9:130858474-130858496 ATCAGCCGTTTGGGCACCTGGGG + Intronic
1188482611 X:30650781-30650803 ATAAGGCATTTGAGCATTCTCGG - Intergenic
1189652979 X:43210173-43210195 AGCAGGCATTTGGGCTTCCTTGG + Intergenic
1191169153 X:57423424-57423446 ATCAGGGAGTTCGGCAGCCTGGG + Intronic
1191845855 X:65547472-65547494 TTCTGGGATTTGGGCACTCTAGG + Intergenic
1192026393 X:67457015-67457037 CTCAGGAATCTGGGCAGCCTAGG + Intergenic
1197669584 X:129261436-129261458 ATCAGGGACTTGAGCATCCTTGG - Intergenic
1199435395 X:147806635-147806657 ATCAGGGATTTGAGCATCCACGG + Intergenic
1201542775 Y:15126300-15126322 CTCAGATATTTGGGGACCCTAGG + Intergenic
1202378448 Y:24257922-24257944 AGCAGGCATTGGTGCAGCCTGGG + Intergenic
1202492334 Y:25412199-25412221 AGCAGGCATTGGTGCAGCCTGGG - Intergenic