ID: 1089713784

View in Genome Browser
Species Human (GRCh38)
Location 11:120336691-120336713
Sequence CACAGAAGGAGCCCCGGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089713775_1089713784 8 Left 1089713775 11:120336660-120336682 CCAGCACCGGGAGCCTGGTGAGG No data
Right 1089713784 11:120336691-120336713 CACAGAAGGAGCCCCGGGCCCGG No data
1089713774_1089713784 9 Left 1089713774 11:120336659-120336681 CCCAGCACCGGGAGCCTGGTGAG No data
Right 1089713784 11:120336691-120336713 CACAGAAGGAGCCCCGGGCCCGG No data
1089713770_1089713784 21 Left 1089713770 11:120336647-120336669 CCAGCGGCTCGTCCCAGCACCGG No data
Right 1089713784 11:120336691-120336713 CACAGAAGGAGCCCCGGGCCCGG No data
1089713779_1089713784 2 Left 1089713779 11:120336666-120336688 CCGGGAGCCTGGTGAGGGCGGCG No data
Right 1089713784 11:120336691-120336713 CACAGAAGGAGCCCCGGGCCCGG No data
1089713768_1089713784 30 Left 1089713768 11:120336638-120336660 CCGCCGGCGCCAGCGGCTCGTCC No data
Right 1089713784 11:120336691-120336713 CACAGAAGGAGCCCCGGGCCCGG No data
1089713780_1089713784 -5 Left 1089713780 11:120336673-120336695 CCTGGTGAGGGCGGCGAGCACAG No data
Right 1089713784 11:120336691-120336713 CACAGAAGGAGCCCCGGGCCCGG No data
1089713769_1089713784 27 Left 1089713769 11:120336641-120336663 CCGGCGCCAGCGGCTCGTCCCAG No data
Right 1089713784 11:120336691-120336713 CACAGAAGGAGCCCCGGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089713784 Original CRISPR CACAGAAGGAGCCCCGGGCC CGG Intergenic
No off target data available for this crispr