ID: 1089714375

View in Genome Browser
Species Human (GRCh38)
Location 11:120343438-120343460
Sequence AAGCCTATGAAGCTAGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089714373_1089714375 7 Left 1089714373 11:120343408-120343430 CCGCTATAAGACAGCTTCTAACT 0: 1
1: 0
2: 0
3: 13
4: 101
Right 1089714375 11:120343438-120343460 AAGCCTATGAAGCTAGTGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089714375 Original CRISPR AAGCCTATGAAGCTAGTGCC TGG Intronic
901080246 1:6580060-6580082 CAGCCCACGAACCTAGTGCCCGG - Exonic
904234378 1:29105091-29105113 AAGGCTATGAAGCCAGTTTCAGG - Intronic
911191175 1:94949956-94949978 GAGCCTTAGAAGCTTGTGCCTGG - Intergenic
917747214 1:178022065-178022087 AAGCCTAAGAAGAAAGTGCTTGG - Intergenic
918942715 1:191022887-191022909 AAGGTGATGAAGCTAGTTCCAGG + Intergenic
921970944 1:221148511-221148533 TAGCTTGTGAAGCTATTGCCTGG + Intergenic
924795276 1:247288298-247288320 AACCTTATGAAGCTTGTGCCAGG - Intergenic
1064051234 10:12061307-12061329 GAGCTTATGAGCCTAGTGCCTGG - Intergenic
1076114954 10:127888836-127888858 ATGCCTGTCAATCTAGTGCCTGG + Intronic
1078116550 11:8458073-8458095 AAGATTTTTAAGCTAGTGCCGGG + Intronic
1081239847 11:40691629-40691651 AAGCCTTTGAAGAAAGTGACTGG + Intronic
1084426593 11:69087391-69087413 AAGGCTATGACGCCAGTGGCAGG - Intronic
1084961568 11:72719598-72719620 AAGGCTATGAAGCTGGTTCCTGG - Intronic
1089272719 11:117313255-117313277 CAGTCCAGGAAGCTAGTGCCAGG - Intronic
1089714375 11:120343438-120343460 AAGCCTATGAAGCTAGTGCCTGG + Intronic
1093949787 12:25152122-25152144 AATTCTAAGAAGCTTGTGCCAGG - Intronic
1096943398 12:55375346-55375368 AATCCTATGAAGCTATTATCAGG - Intergenic
1096961312 12:55580799-55580821 AAGCCTCTGAATCTAGGGCATGG + Intergenic
1097905153 12:64912038-64912060 AATGCCTTGAAGCTAGTGCCTGG - Intergenic
1103018015 12:117510950-117510972 AAGGCTCTGAAAATAGTGCCTGG - Intronic
1106504715 13:30361027-30361049 AACCATATGAAGCCAGTGCCTGG + Intergenic
1108733925 13:53262683-53262705 ATGCCTATGATGCTGGTCCCAGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1114707031 14:24737756-24737778 AATCCTCTGAAGCTATGGCCTGG + Intergenic
1117950790 14:61081035-61081057 CAGCATATAAATCTAGTGCCTGG - Intronic
1123122883 14:105926299-105926321 AAGCCCATCAAGCCAGGGCCAGG - Intronic
1123774284 15:23562914-23562936 AAGGCTATGCAGCTGGTGCCAGG - Intergenic
1124991283 15:34676521-34676543 AATCCCATAAGGCTAGTGCCTGG - Intergenic
1125663873 15:41415519-41415541 TAGCTTAGGAAGCTAGTGGCAGG - Intronic
1135907790 16:26529126-26529148 AAGACTCTGAAGTGAGTGCCAGG - Intergenic
1137985208 16:53101511-53101533 AAACTTATGAAGTTACTGCCTGG + Intronic
1141016823 16:80458708-80458730 AGGACTATGAAGCTAGGGTCAGG - Intergenic
1141136477 16:81468847-81468869 AGGCCTATGGAGCGTGTGCCAGG - Intronic
1142132309 16:88436681-88436703 AAGTCTAAGAAGCTGGGGCCGGG - Exonic
1143842180 17:9741602-9741624 AAGCCTGTGAAGTTATTTCCGGG + Intergenic
1144231149 17:13205098-13205120 AAGCCTATGAACTTTGTGCTCGG - Intergenic
1145994679 17:29098528-29098550 AAGCTGATGAAGCTTGGGCCAGG + Intronic
1146069029 17:29662028-29662050 AAGCCTATGAAGCATGGGCGGGG - Intronic
1155264554 18:24078580-24078602 AAGCCTTGGAAGCTTGTGCCTGG - Intronic
1157591585 18:48839305-48839327 AAACCTTTGAAGCTACAGCCAGG - Intronic
1168476244 19:56677488-56677510 AAGCCTAAGATGAAAGTGCCAGG + Intergenic
927503495 2:23597947-23597969 ATGCCTCTGGAGCTGGTGCCAGG + Intronic
928378842 2:30801271-30801293 AAGCCTAAGAAGATAGGCCCAGG - Intronic
933032561 2:77349941-77349963 AAGATTCTGAACCTAGTGCCAGG - Intronic
937250425 2:120520178-120520200 AAGCCCACCATGCTAGTGCCCGG - Intergenic
937438046 2:121895584-121895606 AAGCCCATGAAGCTGGCTCCGGG + Intergenic
944309326 2:198215849-198215871 AAGCCAATGAAGTTACTGACTGG + Intronic
945026435 2:205624134-205624156 ATGCCCAGGAAGCTAGAGCCTGG - Intergenic
945276459 2:207992244-207992266 AAGCCTATGCAGCTAGTATGTGG - Intronic
1171327085 20:24304237-24304259 ATGCCTATGCAGCTGGTACCCGG - Intergenic
1174079946 20:47963457-47963479 AAGCCTGTGAAATAAGTGCCAGG + Intergenic
1177760782 21:25400151-25400173 AAGCCTCTGATTCTAGGGCCCGG + Intergenic
1182437383 22:30339419-30339441 AAGCCTATAAACCCAGTGCTTGG + Intronic
951082383 3:18467382-18467404 AAGCCTATGCTGCTAGTTTCTGG - Intergenic
961131359 3:124470509-124470531 AAACCTATTCAGCTTGTGCCAGG - Intronic
967103083 3:186233014-186233036 AAGCCTATGAGGCTAGTAGGTGG + Intronic
975272673 4:72454789-72454811 AAGCCTATGAAGCCAGAATCTGG + Intronic
975592276 4:76011792-76011814 AAGCCCAGGAAACTAGTGTCTGG - Intronic
986046689 5:4044759-4044781 AAGCCCATGAAAATACTGCCAGG - Intergenic
986945834 5:13018239-13018261 AACCTTATGAAACTAGTGCAAGG + Intergenic
990046888 5:51443908-51443930 AAGACTATGAAGATTGTGCCAGG - Intergenic
990780144 5:59351613-59351635 AAGCCCATGAAGCAAAAGCCAGG + Intronic
991423297 5:66463835-66463857 ATGCCCATGAAGCCAGTGACTGG - Intergenic
996412896 5:123177982-123178004 ATGCCTCTCAAGCCAGTGCCAGG + Intronic
1000026100 5:157360498-157360520 AAGGCTATCTAGCTAGTGGCGGG - Intronic
1000908105 5:166988111-166988133 AAGTCTAGGAAGCTATTACCTGG - Intergenic
1015608391 6:134985864-134985886 CAGTTTATGAGGCTAGTGCCTGG - Intronic
1016809592 6:148247097-148247119 AAGTCTGTGAAGCTAGTCCATGG - Intergenic
1019767482 7:2862582-2862604 GAGCCTACAGAGCTAGTGCCTGG - Intergenic
1020342531 7:7127624-7127646 AACCCTTGGAAGCTTGTGCCTGG + Intergenic
1045559595 8:103248128-103248150 AACCCTATGGACCTAGTGCTTGG + Intergenic
1049254991 8:141609075-141609097 AAGCCCGAGAACCTAGTGCCAGG + Intergenic
1053166840 9:35850833-35850855 AAGCATATGGAGCCAGTGCTTGG + Intronic
1053418873 9:37964277-37964299 AAGGCTGTGAAGCAGGTGCCAGG + Intronic
1056161080 9:83894712-83894734 AAGTCTTGGAAGCTTGTGCCTGG + Intronic
1056359051 9:85834550-85834572 AAGTCTTGGAAGCTTGTGCCTGG - Intergenic
1057456326 9:95215633-95215655 AAGGCTATGTAGCTTCTGCCTGG + Intronic
1060513000 9:124247903-124247925 AAGCCTATGAGGCGAGTGTCAGG - Intergenic
1061462528 9:130751718-130751740 ACACCCATGAAGCCAGTGCCTGG + Intronic
1186503204 X:10068580-10068602 AAGCCTTAGAAGCTATGGCCAGG + Intronic
1187654964 X:21461644-21461666 CAACCTATGAAACTACTGCCAGG - Intronic
1188817415 X:34732171-34732193 GACCCAATGAAGCTAGGGCCAGG + Intergenic
1200686993 Y:6266379-6266401 AAGCCCTTGGAGCTTGTGCCGGG - Intergenic
1200690766 Y:6305249-6305271 AAGCCCTTGGAGCTTGTGCCAGG + Intergenic
1200989871 Y:9337296-9337318 AAGCCCTTGGAGCTTGTGCCGGG - Intergenic
1200992539 Y:9357629-9357651 AAGCCCTTGGAGCTTGTGCCGGG - Intergenic
1200995191 Y:9377907-9377929 AAGCCCTTGGAGCTTGTGCCGGG - Intronic
1200997856 Y:9398253-9398275 AAGCCCTTGGAGCTTGTGCCGGG - Intergenic
1201000365 Y:9466786-9466808 AAGCCCTTGGAGCTTGTGCCGGG - Intergenic
1201003027 Y:9487099-9487121 AAGCCCTTGGAGCTTGTGCCGGG - Intronic
1201005686 Y:9507382-9507404 AAGCCCTTGGAGCTTGTGCCGGG - Intergenic
1201008346 Y:9527712-9527734 AAGCCCTTGGAGCTTGTGCCGGG - Intergenic
1201010940 Y:9547894-9547916 AAGCCCTTGGAGCTTGTGCCGGG - Intergenic
1201044506 Y:9869467-9869489 AAGCCCTTGGAGCTTGTGCCAGG - Intergenic