ID: 1089719064

View in Genome Browser
Species Human (GRCh38)
Location 11:120395322-120395344
Sequence GTAAGTAAATGGATGGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580
Summary {0: 1, 1: 0, 2: 9, 3: 79, 4: 491}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089719061_1089719064 -3 Left 1089719061 11:120395302-120395324 CCTTACAAAAATCAGGCAATGTA 0: 1
1: 0
2: 2
3: 32
4: 237
Right 1089719064 11:120395322-120395344 GTAAGTAAATGGATGGTAAATGG 0: 1
1: 0
2: 9
3: 79
4: 491
1089719058_1089719064 20 Left 1089719058 11:120395279-120395301 CCCAGGAGTGCAAGATTGGTTCA 0: 1
1: 2
2: 79
3: 539
4: 2451
Right 1089719064 11:120395322-120395344 GTAAGTAAATGGATGGTAAATGG 0: 1
1: 0
2: 9
3: 79
4: 491
1089719059_1089719064 19 Left 1089719059 11:120395280-120395302 CCAGGAGTGCAAGATTGGTTCAC 0: 1
1: 1
2: 22
3: 318
4: 2273
Right 1089719064 11:120395322-120395344 GTAAGTAAATGGATGGTAAATGG 0: 1
1: 0
2: 9
3: 79
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089719064 Original CRISPR GTAAGTAAATGGATGGTAAA TGG Intronic
902255466 1:15186252-15186274 GGAAGTAACTGGATAGAAAATGG + Intronic
903612757 1:24628417-24628439 GTAAATAAATCAACGGTAAATGG + Intergenic
903876380 1:26476900-26476922 GAAAGTAAATGGCTGGTAACTGG - Intergenic
904846390 1:33421409-33421431 CTAAGTAAAGGGATGTAAAATGG + Intronic
905498325 1:38414950-38414972 TTAAGTAAATGAATGGCAGATGG + Intergenic
906563807 1:46781788-46781810 TAAAGTAAATGGGTGGAAAAAGG - Intronic
906570417 1:46833386-46833408 TTAAATAAGTGGATGGCAAATGG - Intergenic
906896677 1:49781011-49781033 ATAAGTAAATAGGTGGAAAAAGG + Intronic
907236016 1:53048364-53048386 GCAAATAAATGGAATGTAAAAGG - Intronic
907379891 1:54078253-54078275 GTAGGTAAATGGATTTAAAAGGG - Intronic
908005484 1:59723413-59723435 TTAAGTAAATGGATGGCAGATGG - Intronic
908477257 1:64501905-64501927 GTAATTAAATGATAGGTAAAAGG + Intronic
908589503 1:65614601-65614623 GCAAGTAAATGGATGGTGGATGG + Intronic
908699065 1:66878746-66878768 GTAAGTAATTGGAGGGCAGATGG - Intronic
909561527 1:77014011-77014033 TTAAGTAAATGGAAGGGATAGGG - Intronic
909981186 1:82103414-82103436 TAAAGTAAATGGGTGGGAAAAGG - Intergenic
910225062 1:84927995-84928017 GGAAGGAAATGGATTGTAATGGG - Intronic
910348000 1:86263063-86263085 TTAAGCAAATGGGTGGAAAAGGG + Intergenic
910573135 1:88728679-88728701 TTCAGTAAATGGATGGTAGATGG + Intronic
911995154 1:104757923-104757945 ATAAGTAGAGGAATGGTAAAGGG - Intergenic
912065621 1:105737492-105737514 TTATGTAAATGGATGGCTAATGG - Intergenic
912939850 1:114035159-114035181 GTAAGAAAATGAATTGCAAAGGG + Intergenic
913145056 1:115980843-115980865 TTAAGTGAAAAGATGGTAAAGGG + Intronic
913566925 1:120081564-120081586 GAAACTAAATGGAAGGCAAATGG - Intergenic
913631204 1:120711985-120712007 GAAACTAAATGGAAGGCAAATGG + Intergenic
913644689 1:120844962-120844984 GTAAATAAATGCTTTGTAAAAGG - Intergenic
914082044 1:144418621-144418643 GTAAATAAATGCTTTGTAAAAGG + Intergenic
914099060 1:144568208-144568230 GTAAATAAATGCTTTGTAAAAGG - Intergenic
914176947 1:145287121-145287143 GTAAATAAATGCTTTGTAAAAGG + Intergenic
914232851 1:145780294-145780316 GAAAGGAAATGTATGGAAAAGGG + Intronic
914287679 1:146242271-146242293 GAAACTAAATGGAAGGCAAATGG - Intergenic
914299924 1:146369456-146369478 GTAAATAAATGCTTTGTAAAAGG + Intergenic
914531677 1:148528613-148528635 GTAAATAAATGCTTTGTAAAAGG + Intergenic
914548710 1:148693014-148693036 GAAACTAAATGGAAGGCAAATGG - Intergenic
914636715 1:149559116-149559138 GTAAATAAATGCTTTGTAAAAGG - Intergenic
914891426 1:151627263-151627285 TTAAGTAAATGGGTGGCAGATGG - Intronic
915077800 1:153325337-153325359 GTATTCAAATGGTTGGTAAATGG + Intergenic
915116063 1:153600520-153600542 ATAAATAAATGGATGGTGGAGGG - Intergenic
916332240 1:163629861-163629883 TTAAGTAAATAGATGGTGGATGG - Intergenic
917090950 1:171352632-171352654 GTAAGTAAAGGGATGGGGAGAGG - Intergenic
917466428 1:175281256-175281278 TTAAGTAAATGGATGGCAGATGG + Intergenic
917658698 1:177155627-177155649 TTAAATACATGGATGGTAGATGG + Intronic
917841138 1:178979288-178979310 GAAAGCAAAGGGATGGAAAAAGG + Intergenic
918247916 1:182676196-182676218 GTAATTAAATTGAAGATAAAGGG + Intronic
918268684 1:182873489-182873511 ACAAGTAAATGGATGGCAAGTGG + Intronic
918792914 1:188853798-188853820 TTAAGTAAATGGATGGCAGGTGG - Intergenic
918895067 1:190332258-190332280 GTAGGAATATGTATGGTAAATGG + Intronic
919875150 1:201860174-201860196 GGAAGTAAATGGACCGAAAATGG - Intronic
922027487 1:221764210-221764232 TTAAGTAAATAGATGGTGGATGG + Intergenic
923002843 1:230022031-230022053 GTAAGGAAATAGATGGTAGCTGG + Intergenic
923652324 1:235885255-235885277 GGAAGGAATTGGATGTTAAACGG - Intergenic
923921805 1:238574751-238574773 GTAGGTAAGTGGAAAGTAAAAGG + Intergenic
924257550 1:242197289-242197311 GTCAGGAAATGGATTGGAAAAGG - Intronic
924487943 1:244505613-244505635 TTAAGCAAATGGATGGCAGATGG - Intronic
1062943661 10:1444073-1444095 GGATGTAGATGGATGGTGAATGG - Intronic
1062943694 10:1444250-1444272 GGAAATAGATGGATGGTGAATGG - Intronic
1062943720 10:1444374-1444396 GTAGATAGATGGATGGTGAATGG - Intronic
1062943790 10:1444764-1444786 GGATGGAAATGGATGGTGAATGG - Intronic
1062943811 10:1444846-1444868 GGATGTAGATGGATGGTGAATGG - Intronic
1062943868 10:1445125-1445147 GTGAGTGAATGGATGGTAAATGG - Intronic
1063872230 10:10430446-10430468 GTTTGTACATGTATGGTAAAGGG + Intergenic
1064701411 10:18024937-18024959 GTAAGTAAAGGGTTGGAGAAAGG - Intronic
1065375687 10:25038799-25038821 GTTTTTAAATGAATGGTAAAAGG + Intronic
1065681048 10:28233176-28233198 TTAAGTAAATCGATGGTGGATGG + Intronic
1066145331 10:32552253-32552275 TAAAGTAAATGGGTGGAAAAAGG - Intronic
1066691689 10:38035089-38035111 GAAAGTAAATGGATGATGGATGG - Intronic
1067762823 10:49061737-49061759 GTAAGTAGATTGAAAGTAAAAGG - Intronic
1068539835 10:58279810-58279832 CTAAATAAATGGAAGCTAAAAGG + Intronic
1068646031 10:59469479-59469501 TTAAGTAAATAGATGGTGAATGG + Intergenic
1068663109 10:59644542-59644564 GAAAGTGAAGGGATGGAAAATGG - Intergenic
1069220051 10:65871909-65871931 TTAAGTAAATGGATGGTGAATGG - Intergenic
1069289335 10:66758124-66758146 GTAGGTAATTTGATGGTGAATGG - Intronic
1069530433 10:69214633-69214655 TTAAGTACATGGATGGTGGATGG - Intergenic
1069588313 10:69625310-69625332 GAAAGTAAAATGATGGAAAAAGG + Intergenic
1070111401 10:73490594-73490616 GTAAGGAAAAGTTTGGTAAAAGG - Intronic
1070219048 10:74421315-74421337 ATAAGTAAATGGATGATGAATGG + Intronic
1072877965 10:99193571-99193593 GAAAATAAAGGGATAGTAAAAGG + Intronic
1072987982 10:100159082-100159104 GAAAGTAAAAGAATGGGAAAAGG + Intronic
1074222953 10:111456128-111456150 GCATGTAAACAGATGGTAAATGG - Intergenic
1075578867 10:123601362-123601384 TTAAGTAAATGGATGGCAGAAGG - Intergenic
1075652399 10:124137054-124137076 GACAGTAAATGGATGTAAAATGG - Intergenic
1077643946 11:3906881-3906903 ATAAGAAAATTGAGGGTAAAAGG + Intronic
1077968554 11:7162673-7162695 TTAAGTACATGGATGGCAGATGG + Intergenic
1078017381 11:7626603-7626625 ATAAGTGAAAGGATGGTGAATGG + Intronic
1078571734 11:12464387-12464409 TTAAGTAAATGCATGGTGGATGG - Intronic
1079105145 11:17566642-17566664 TTAGGTAAATGGATGGTGTATGG - Intronic
1079699870 11:23531617-23531639 GAAAGTGAAAGGATGGGAAAAGG - Intergenic
1079768583 11:24428330-24428352 GTAAATAAATGGCAGATAAATGG - Intergenic
1079791537 11:24746027-24746049 GTACGAACATTGATGGTAAATGG - Intronic
1081157089 11:39706358-39706380 GTATGAAAATGTTTGGTAAAAGG - Intergenic
1082130712 11:48485827-48485849 GTGAGGAAAAGGATGGAAAAGGG - Intergenic
1082294098 11:50417209-50417231 ACAAGTAAATGGATGGCAAGTGG + Intergenic
1082696059 11:56366018-56366040 TTAAATAAATGGATGGCATATGG + Intergenic
1084658780 11:70535181-70535203 GTGAGCAGATGGATGGAAAATGG - Intronic
1085869115 11:80328429-80328451 GGAAGTAAATGGATACTGAATGG - Intergenic
1086290924 11:85308322-85308344 AAAAGTGAATGGATGGTAAGGGG - Intronic
1086731454 11:90255706-90255728 AAAAGTAAATGGCTGGGAAAAGG - Intergenic
1086775205 11:90822451-90822473 GTAGTTAAATGGATGGAGAATGG - Intergenic
1087069387 11:94062570-94062592 GTAAATGAATGAATGGCAAATGG + Intronic
1087236301 11:95722624-95722646 TTAAGTAAATGGATGGTGTATGG + Intergenic
1087607943 11:100399859-100399881 GAATGGAAATGAATGGTAAAAGG + Intergenic
1087968100 11:104443835-104443857 GTAAGTAACAGGATAGTAGATGG - Intergenic
1088024002 11:105155919-105155941 GGAAGTCAATGGAAGGTAGAGGG - Intergenic
1088049754 11:105497957-105497979 CTAAGTAAATGGTTGGAAGATGG - Intergenic
1088168836 11:106971517-106971539 TTCAGTAAATGGATGGCTAAAGG + Intronic
1088627249 11:111738107-111738129 GTAAGGAACTGGATGGAAACAGG + Intronic
1088810687 11:113389769-113389791 GTAAGTACAAAGATGGGAAAAGG + Intronic
1088929437 11:114335592-114335614 GAAAGTAAATGGATGGAGAAAGG + Intergenic
1088998250 11:115023502-115023524 GAAAGTGAAAGGATGGAAAAAGG + Intergenic
1089719064 11:120395322-120395344 GTAAGTAAATGGATGGTAAATGG + Intronic
1090448205 11:126782594-126782616 TTAAGTAAATGGATGGCAGATGG + Intronic
1091192687 11:133707711-133707733 GGAAGTGAATGGAAGGGAAAGGG + Intergenic
1091876501 12:3938413-3938435 TTAAGTAAATGGATGGTAGGTGG + Intergenic
1093488509 12:19679492-19679514 TAAAGTAAAGGGATGGAAAAAGG - Intronic
1093577105 12:20744980-20745002 GTAAGTAAAAAGAAGGAAAATGG + Intronic
1093890977 12:24520778-24520800 GAAAGTGAAAGGATGGGAAAAGG + Intergenic
1094299787 12:28949953-28949975 GTAAGCAATTGGCTGGGAAAAGG + Intergenic
1095156632 12:38864300-38864322 GTAAATAAATGGATGATGATGGG - Intronic
1095316089 12:40763431-40763453 GTAAGTAAATGAAGGGTGAGGGG + Intronic
1095726996 12:45464804-45464826 GTAAGTAAAAGGAGGGTGGATGG - Intergenic
1096005864 12:48170849-48170871 GGAAGGAAATGGATGGAAATGGG + Intronic
1096040669 12:48513394-48513416 TTAAGTAAATAGATGGCAGATGG + Intronic
1097716610 12:62972719-62972741 GTAAGAATATAGATGGGAAAAGG - Intergenic
1097817520 12:64091114-64091136 GAAAGTAAATAAATGGGAAATGG + Intronic
1097952937 12:65453002-65453024 TTAAGAAACTTGATGGTAAATGG - Intronic
1098852440 12:75612893-75612915 TAAGGTAAATGGATGGAAAAAGG + Intergenic
1098913197 12:76231590-76231612 GAAAGTGAAAGGATGGAAAAAGG - Intergenic
1099587794 12:84543835-84543857 GAAAGTAAAGGGATGGAAAAAGG - Intergenic
1099770595 12:87048725-87048747 TTAAGTAAATGGATGATGGATGG + Intergenic
1099800078 12:87445727-87445749 GTAACTAAATAGATGTCAAAGGG - Intergenic
1099821250 12:87713597-87713619 TTAAGTAAACGGATGGCAGATGG + Intergenic
1100083724 12:90882003-90882025 ATAAGTAAATGGAGGGTGAGTGG + Intergenic
1100769350 12:97904280-97904302 GAAAAGAAATGGATGATAAATGG - Intergenic
1100887106 12:99083813-99083835 GTTAGTACTTGGATGGGAAAAGG - Intronic
1101272211 12:103159663-103159685 GAAATTAAATGGATGGCAAATGG - Intronic
1102506931 12:113389617-113389639 GTGAGTGGATGGATGATAAATGG - Exonic
1102506993 12:113390014-113390036 GTGGGTAAGTGGATGGAAAATGG - Exonic
1102507108 12:113390567-113390589 GTGGGTAGATGGATGATAAATGG - Exonic
1102507133 12:113390703-113390725 GTGGGTAGATGGATGATAAATGG - Exonic
1102541800 12:113625570-113625592 TTAAGTAAATGGAAGGCAGATGG - Intergenic
1102667104 12:114583959-114583981 GGAAGGAAATGGATGGGCAAGGG + Intergenic
1103190327 12:118995798-118995820 ATGAGTAAATGCATGATAAACGG - Intronic
1104125996 12:125846666-125846688 TTCAGTAAATGGATGGTGCATGG - Intergenic
1104475278 12:129065990-129066012 TTAGATAAATGGATGGTAGATGG - Intergenic
1104906696 12:132217350-132217372 GTAGGTAGATGGATGGATAAAGG - Intronic
1104906762 12:132217662-132217684 GTAGGTAGATGGATGGATAAAGG - Intronic
1104906799 12:132217843-132217865 GTAGGTAGATGGATGGATAAAGG - Intronic
1105201000 13:18177613-18177635 GACAGTAAAAGGATGGTCAATGG - Intergenic
1105235506 13:18548304-18548326 GTAACTAAATGGAATGGAAAAGG + Intergenic
1106912320 13:34476132-34476154 GTCAGTAAATATGTGGTAAATGG + Intergenic
1107160568 13:37222361-37222383 GAAAGTAAATGGATGGGGAAAGG - Intergenic
1107219722 13:37967940-37967962 TTAAGTAAATGGCTGGTTAATGG - Intergenic
1107287221 13:38807633-38807655 GTAACTAAGTGCATTGTAAATGG + Intronic
1107771374 13:43790178-43790200 ATAAGTTAATGTATGTTAAAAGG + Intergenic
1108415872 13:50197773-50197795 GCATGTTGATGGATGGTAAAGGG + Intronic
1108438319 13:50423160-50423182 GACAGTAAATGAATGATAAAAGG + Intronic
1109017522 13:57037369-57037391 GGAATTCAATGGATAGTAAAAGG - Intergenic
1109554261 13:63950784-63950806 TTAAGTAAATGGATGGTAGCTGG + Intergenic
1109638369 13:65153227-65153249 ATAAATAAAAGGATGGAAAAAGG - Intergenic
1109848561 13:68030714-68030736 TTAAATAAATGGATGCCAAATGG - Intergenic
1110594865 13:77309011-77309033 GTATGCAAATGGATGCCAAAGGG + Intronic
1110993263 13:82070663-82070685 TTAAGTAAATAGATGGCAGATGG - Intergenic
1111163714 13:84429279-84429301 TTAAATAAATGGATGGAAGATGG - Intergenic
1112708445 13:102099220-102099242 GAAGATAAATGGATGGAAAAAGG + Intronic
1112945515 13:104921935-104921957 TAAAGTAAAGGGGTGGTAAAGGG + Intergenic
1114169113 14:20253989-20254011 GTAAGTAAATGATTGGTAGATGG + Intergenic
1115012170 14:28562166-28562188 TTAAGTAAATGCATGGCAGATGG + Intergenic
1115265224 14:31493463-31493485 TTAAGTAAAGGGGTGGAAAAAGG + Intronic
1115504931 14:34084764-34084786 GTAAATAAATGATTGGGAAAAGG + Intronic
1115680516 14:35732536-35732558 ATAAGTAAAGGGGTGGAAAAAGG + Intronic
1115687730 14:35813508-35813530 ATAAGTAAATGTTTGGTATATGG - Intergenic
1115867568 14:37764622-37764644 GAAAGTGAAAGGATGGGAAAAGG - Intronic
1116116227 14:40654467-40654489 ATAGGTAAATGGATGGAGAATGG + Intergenic
1116281993 14:42920172-42920194 GTAAGTAAGTGAATGGATAAAGG - Intergenic
1117984288 14:61372502-61372524 GTAAGTAAATGGATGGTGGGTGG - Intronic
1118014767 14:61648727-61648749 TTAAGTAAATGCATGGTGGATGG + Intronic
1119272200 14:73317032-73317054 GTAAGTAAATGGAAAGCCAATGG - Intronic
1119744823 14:77036638-77036660 ATAACTGAATGAATGGTAAATGG - Intergenic
1120375611 14:83702976-83702998 GTAAGTAAATGAATGGTAGATGG + Intergenic
1120621161 14:86766363-86766385 CTAACTAAACTGATGGTAAATGG + Intergenic
1121181809 14:91934879-91934901 GTAAGAGAAGGGATGGGAAAGGG - Intronic
1122426810 14:101614427-101614449 TTAAGTAAATGGATGGTGGATGG + Intergenic
1122600890 14:102921260-102921282 GTGAATAGATAGATGGTAAATGG - Intergenic
1123929379 15:25154717-25154739 TTAAGTAAATGGTTGGCAGATGG + Intergenic
1124173007 15:27393634-27393656 TTAAGCAAGTGGGTGGTAAATGG - Intronic
1124395756 15:29300133-29300155 GTGAGTAAATGGATGGATAATGG + Intronic
1124398557 15:29328687-29328709 TTAAGTAAATGGATGGCAGATGG + Intronic
1124647767 15:31451354-31451376 GGAAGTAAGTGGATAGAAAAAGG - Intergenic
1125456038 15:39859777-39859799 GAAAGTAGATGGGTGGTTAACGG + Intronic
1125625634 15:41106885-41106907 TTAAGTAAATGGATGGCAGGAGG - Intronic
1126215757 15:46152754-46152776 ATAAGGAAATGGATATTAAATGG - Intergenic
1127122465 15:55783661-55783683 CTAAGTAAAAGCCTGGTAAAAGG - Intergenic
1128854573 15:70997963-70997985 GCTAGAAAATGTATGGTAAAAGG - Intronic
1128999944 15:72323821-72323843 GAAAGTAAAAGGATAGAAAAAGG - Intronic
1130180274 15:81620139-81620161 TTAAGCAAATGGATGGTGGATGG - Intergenic
1130398532 15:83527567-83527589 AAAAGTAAAGGGATGGAAAAAGG - Intronic
1131308834 15:91269404-91269426 GTAAGTAAATGGGTGGCCATGGG + Intronic
1131744246 15:95428896-95428918 GTAAGTAAATTAAATGTAAATGG - Intergenic
1132054495 15:98639079-98639101 ATGAGTAAATGGATGGCAGATGG + Intergenic
1133163618 16:3929785-3929807 GTAATTACATGAATGGTAAGTGG + Intergenic
1133430450 16:5732695-5732717 TTAAGTAAATGGGTGAAAAATGG - Intergenic
1133582285 16:7157360-7157382 GGCAATAAATGTATGGTAAATGG + Intronic
1133988120 16:10683911-10683933 GTAAATAAATGTATGATAAAAGG + Intronic
1134075653 16:11289638-11289660 CTAAGTAAATGGATGGAGGATGG - Intronic
1134774521 16:16840371-16840393 TTAAGTAAATGCAGAGTAAAAGG - Intergenic
1135528847 16:23235119-23235141 GTCAGTAACAGGATGGAAAATGG - Intergenic
1137479991 16:48844366-48844388 ATAAGAAAATGAATGGTAAAGGG - Intergenic
1137528427 16:49259665-49259687 TTAAGTAAATGAATGGTAGATGG + Intergenic
1137552587 16:49450285-49450307 AAAAGTAAAAGGATGGAAAAAGG - Intergenic
1137938829 16:52661162-52661184 TAAAGTAAATAGATGGAAAAAGG + Intergenic
1138780891 16:59784299-59784321 TTAAGTAAATAGATAGTAAATGG - Intergenic
1138918174 16:61493813-61493835 GTATGAAAATGGAAGGTAATAGG - Intergenic
1138923575 16:61563607-61563629 TTAAGTAAATGAATGGTGGATGG - Intergenic
1139089060 16:63621419-63621441 GGAAATAATTCGATGGTAAAAGG - Intergenic
1141038554 16:80651871-80651893 TTAAGTAAATGGATTGCAGATGG + Intronic
1141110200 16:81265689-81265711 GTAGGTAGATGGATGGTGGATGG - Intronic
1143991025 17:10961724-10961746 TAAAGTAAAGGGATGGAAAAAGG + Intergenic
1145263357 17:21367670-21367692 GTAGGTTAATGGATTTTAAATGG + Intergenic
1145894725 17:28448304-28448326 GAAAGTAAAAGGATGGAAAAAGG + Intergenic
1146107323 17:30051884-30051906 ATAAGTAAATGCTTGGGAAAAGG - Intronic
1146241797 17:31236299-31236321 ATATGTAAATGCATGGAAAAAGG - Intronic
1146311876 17:31775701-31775723 GTAAGTAAATGGAGAGAGAAGGG - Intergenic
1147720865 17:42538482-42538504 GCAGGTAAAAGGATGGAAAAGGG + Exonic
1147902940 17:43801880-43801902 GCAAGGAAAGGGGTGGTAAAAGG + Intronic
1148044674 17:44735894-44735916 GTAAATAAATGTAAGATAAATGG - Intronic
1148532704 17:48410151-48410173 TTAAGTAAATGGATGATGAATGG + Intronic
1148692681 17:49540649-49540671 TTCAGTAAATGGATGGTTGATGG - Intergenic
1148984877 17:51612655-51612677 ACAAGTAAATGAATGGTAAGAGG + Intergenic
1149619004 17:58027866-58027888 TTAAGAAAATGGATGGCCAATGG + Intergenic
1150197287 17:63313406-63313428 CTAATTATATTGATGGTAAAAGG - Intronic
1151014572 17:70539744-70539766 GGAAGTAAAAGGAATGTAAAAGG - Intergenic
1152001810 17:77650821-77650843 CTAGGTAAATGGATGGCAGATGG - Intergenic
1152301818 17:79499276-79499298 ATGAATAAATGGATGGTAGATGG - Intronic
1153127386 18:1810982-1811004 TTGAGTAAATGGATGCTATATGG - Intergenic
1153400671 18:4680905-4680927 TAAAGTAAAGGGATGGAAAAAGG + Intergenic
1153857012 18:9159737-9159759 ATTAATAAATGGATGGTGAAGGG - Intronic
1153965726 18:10180281-10180303 TTAAGTAAATGGGTGGAAAAGGG - Intergenic
1156011121 18:32499224-32499246 TAAAGTAAAGGGATGGAAAAAGG - Intergenic
1156060356 18:33066638-33066660 GAAAGTGAAGGGATGGAAAAAGG + Intronic
1156538432 18:37886395-37886417 TAAAGTAACTGGATGGAAAAAGG - Intergenic
1157525778 18:48380333-48380355 TTAAATAAATGGATGGCAGATGG + Intronic
1159950836 18:74481769-74481791 ATAAGAAAATGGAAGGTAACTGG + Intergenic
1160472778 18:79153153-79153175 GTAAATAAATGGATAATAAATGG - Intronic
1160526669 18:79542604-79542626 GTAAATACATGGATGGATAATGG - Intergenic
1162287986 19:9754665-9754687 GTAATTATATGAAGGGTAAATGG - Intronic
1163462147 19:17445448-17445470 ATAAGTAAATGGATGTAAATGGG - Intronic
1165098315 19:33422508-33422530 GTAAGTAAATAGATGATAGATGG - Intronic
1166458415 19:42964486-42964508 ATAAGTAAATGGCTGGTGACTGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1168635882 19:57996510-57996532 ATAAATAAATGGCTGGTAAGGGG + Intronic
925009662 2:473152-473174 GAAAGTAAAAGTATGGAAAAGGG + Intergenic
925520773 2:4742418-4742440 TTCAGTAAATGGATGGCAGATGG + Intergenic
925932154 2:8717007-8717029 GCAATTAAATGGATGGATAAAGG - Intergenic
926896700 2:17698574-17698596 GAAAGTAAAAGGATGGAAAATGG - Intronic
926899709 2:17737269-17737291 GTAATAAAATAGAAGGTAAATGG + Intronic
927088497 2:19692942-19692964 TTGAGTAAATGGATGGCAGATGG - Intergenic
927315760 2:21679791-21679813 GAAAGTAAAAGGATGGAAAAAGG + Intergenic
927441830 2:23124261-23124283 GAAAGTAAAAGGATGGTAAAGGG - Intergenic
929337611 2:40769248-40769270 GTAGGTAAGTGGATGGGGAAGGG - Intergenic
929541048 2:42822217-42822239 GAAAATAAAGGGATGGAAAAAGG - Intergenic
929577977 2:43064239-43064261 GTAAGTCAATGGATAGTGGATGG - Intergenic
929634097 2:43498713-43498735 CTAAGAAAATTCATGGTAAAGGG + Intronic
930365318 2:50432321-50432343 ATAAGAAAATGCAGGGTAAATGG - Intronic
930731660 2:54734008-54734030 GTAAGTAAAGGGATACTAAAAGG + Intronic
931006279 2:57853315-57853337 TTAAGTAAATGGATGGCAGATGG - Intergenic
931017856 2:58006437-58006459 ATAAGTGAATGGATCTTAAATGG - Intronic
931548073 2:63410677-63410699 TCAAGTAAAGGGATGGAAAAAGG + Intronic
931609401 2:64082249-64082271 GTGGGTAAATGGAGAGTAAAAGG - Intergenic
932498991 2:72164570-72164592 CTAAGTAAATGGCTAGTATATGG + Intergenic
933075671 2:77922595-77922617 TTAAGTAAATGGATGACAGATGG - Intergenic
933209987 2:79554950-79554972 GCAATTAAATGGCTGCTAAATGG - Intronic
933409147 2:81903303-81903325 TTAAGTAAATGAATGGCAACTGG + Intergenic
933439531 2:82294974-82294996 GTAGGGAAATGGATGATAAAGGG - Intergenic
933998988 2:87690865-87690887 GGAAGGAAGTGGATGGGAAATGG - Intergenic
935799884 2:106685052-106685074 GAAAGTAAAAGGATGGAAAATGG - Intergenic
935916979 2:107965139-107965161 TTAAGTAAATAGATGGCACATGG + Intergenic
936294856 2:111260018-111260040 GGAAGGAAGTGGATGGGAAATGG + Intergenic
936853276 2:116927681-116927703 ATAAGTAAATGGATTGTCGAAGG + Intergenic
936929756 2:117776137-117776159 GTAAGTAAATCTTTGTTAAATGG - Intergenic
937351676 2:121168606-121168628 AAAAGTAAAAGGATGGAAAAAGG - Intergenic
937561822 2:123233741-123233763 GAAAGTAAAAGGATGAGAAAAGG - Intergenic
937571402 2:123367383-123367405 TTAAGTAATAGTATGGTAAATGG - Intergenic
938176456 2:129135768-129135790 TTAAGTAAATGGAAGGCAGATGG + Intergenic
938514274 2:131986308-131986330 GTAACTAAATGGAATGGAAAAGG - Intergenic
938704366 2:133909016-133909038 GAAAGTAAAAGGATGGAAAATGG + Intergenic
939892138 2:147749108-147749130 TTTAGTAAATGGCAGGTAAAAGG + Intergenic
939950913 2:148470923-148470945 GTAGGTGAATGGATAGGAAAAGG + Intronic
940706775 2:157115296-157115318 GAAAGTGAAGGGATGGAAAAAGG + Intergenic
941479245 2:165985350-165985372 GTAAGAAAAAGGAAGGAAAAAGG + Intergenic
941686144 2:168451111-168451133 GTAAGTAGCTGGTCGGTAAAGGG - Intergenic
943643167 2:190381022-190381044 GTAAGTGAATGGAGGGGCAATGG + Intergenic
943841609 2:192590475-192590497 TTAAGTAAATAGATGGCCAATGG + Intergenic
944759848 2:202803441-202803463 GAAAGGAAAAGGATGGAAAAGGG + Intronic
945250708 2:207764348-207764370 GTAACTATATGGATGGAAACAGG + Exonic
945956828 2:216094038-216094060 GGAAATAAAGGGATGGCAAATGG + Intronic
948297110 2:236868965-236868987 GTAAGAAAATGGACAGGAAATGG - Intergenic
948340979 2:237251468-237251490 TTAAGTAAATGGATGGCAAATGG + Intergenic
948441253 2:237991301-237991323 ATAATTAAATAGATAGTAAAGGG - Intronic
948548571 2:238751551-238751573 GAAAATAAAGGGATGGAAAAGGG + Intergenic
1168950790 20:1800321-1800343 TTAAGTAAATGGATGGCAGATGG + Intergenic
1170015656 20:11778912-11778934 GAGAGGAAATGGATGGTTAAAGG + Intergenic
1170073964 20:12398692-12398714 GTATATAAATGGATGATAGATGG + Intergenic
1170400793 20:15981002-15981024 GTAATTAAAAAGATGATAAATGG - Intronic
1172473074 20:35215209-35215231 GGCAGAAAATGGAGGGTAAAAGG - Intergenic
1172576569 20:36013715-36013737 TTCAGTAAATGGATGGCAGAGGG + Intronic
1172757148 20:37293672-37293694 TTAAGTAAATGTATGGTGAATGG - Intronic
1174184977 20:48699969-48699991 GGAGGTGAATGGATGGTAGAAGG - Intronic
1174940919 20:54926168-54926190 TTAGGTAAATGGATGGTGGATGG - Intergenic
1174966228 20:55219249-55219271 ACAAGTAAATAGATGGTAGATGG - Intergenic
1174986927 20:55465392-55465414 TTAAGTAAATGAATGGCAGATGG + Intergenic
1175325471 20:58124489-58124511 TTAAGTAAATGAATGGTGAATGG + Intergenic
1175631930 20:60547860-60547882 GAAAATAAAGGGATGGAAAAAGG - Intergenic
1175659532 20:60800478-60800500 ATAAGTAAATGGATAGTGGATGG + Intergenic
1176779505 21:13176589-13176611 GTAACTAAATGGAATGGAAAAGG + Intergenic
1177893817 21:26838003-26838025 GTAAGAACCTGGATGGTCAAGGG + Exonic
1177977137 21:27865627-27865649 GTAACTAAATGGAATGGAAAAGG + Intergenic
1178630438 21:34255142-34255164 TTAAGTAAATGGATAGCAGATGG - Intergenic
1178697426 21:34806271-34806293 ACAAGTAAAGGGATGGAAAAAGG + Intronic
1181722552 22:24786918-24786940 TTAAGTAAATGTATGGCAGATGG + Intergenic
1182218719 22:28741328-28741350 CTAAGTAAATGTATGGGATAGGG - Intronic
1182734650 22:32523584-32523606 ATAGGGAAATGGCTGGTAAATGG - Intronic
1182970521 22:34570434-34570456 TTAAGTAAATGGATGGTGGATGG - Intergenic
1182995791 22:34810830-34810852 TTTAATAAATGGGTGGTAAATGG + Intergenic
1183313706 22:37125700-37125722 GAAAGGAAAAGGATTGTAAAGGG - Intergenic
1183744076 22:39683533-39683555 GTAAATAAATGGTTGGCTAAAGG - Intronic
1184579003 22:45399911-45399933 TTAAGCAAATGGATGGCAGATGG + Intronic
1185196851 22:49477040-49477062 ATGAATAGATGGATGGTAAATGG + Intronic
949191995 3:1261299-1261321 GTAGGTAAATAGATAGCAAAAGG + Intronic
949326284 3:2868657-2868679 CTAAATAAATGTATGTTAAATGG - Intronic
949595707 3:5544723-5544745 GAAAGTGAAGGGATGGAAAAAGG - Intergenic
950321882 3:12063484-12063506 TTAAGTAAATGGATGGAAGATGG + Intronic
950603210 3:14054591-14054613 TAAAGTAAAGGGATGGAAAAAGG - Intronic
951460035 3:22941571-22941593 TAAAGTAAATGGGTGGTAAAAGG - Intergenic
951944715 3:28122858-28122880 CTAAGTAAATGGATCTTATAAGG + Intergenic
952280704 3:31920582-31920604 TTAAGTAGATGGATGGTAGATGG + Intronic
952689132 3:36183150-36183172 TTAAGTAAATGGATGGTGGCAGG - Intergenic
952724628 3:36570877-36570899 GAAAGTAAAAGAATGGAAAAAGG - Intergenic
953940111 3:47087160-47087182 GCTAGTAACTGGAGGGTAAAAGG + Intronic
954505695 3:51070539-51070561 CCAAGTAAATGTTTGGTAAAAGG + Intronic
956107415 3:65834935-65834957 CAAAGTAAAAGGATGGAAAAAGG - Intronic
956286577 3:67616445-67616467 ATAAGTAAATGTATAGGAAAAGG + Intronic
957087479 3:75695121-75695143 GAAAATAAAAGGATGGAAAAAGG + Intergenic
957447417 3:80331957-80331979 TTAAGTAAATGGATGGCAGATGG + Intergenic
957609066 3:82443937-82443959 ATAAATAAATAGATGTTAAAGGG + Intergenic
958534927 3:95387937-95387959 GGAAGTTAATGGCTGGTGAAGGG + Intergenic
958692823 3:97490122-97490144 GTAAATAAATGAATGACAAAAGG + Intronic
959438512 3:106347578-106347600 TTAAGTAAATGGATAGCAGATGG - Intergenic
960497253 3:118389474-118389496 GTAAGTATATTGAAAGTAAAAGG + Intergenic
961055443 3:123784554-123784576 GAAAGTAGAGGGATGGTGAATGG - Intronic
962428088 3:135292163-135292185 TTAGGTAAATGGATGGCAGATGG + Intergenic
964318425 3:155468528-155468550 GAAAATAAACGGATGGAAAAAGG + Intronic
964804316 3:160590235-160590257 GAAAATAAATGGATGGAAAAAGG + Intergenic
964865696 3:161257845-161257867 TTAAGTAAATGGGTGGCAGATGG - Intergenic
964908430 3:161747755-161747777 TGAAATAAATGCATGGTAAAAGG + Intergenic
965162652 3:165154376-165154398 CTAAGTAAATGGATGGTGGATGG + Intergenic
965651772 3:170941323-170941345 TTAAGTAAATGGATGATGCAGGG + Intergenic
966645829 3:182245592-182245614 GTAAGAACATGGAAGGAAAAGGG + Intergenic
966660860 3:182412792-182412814 CAGAGTAAATGGCTGGTAAATGG - Intergenic
967210686 3:187165767-187165789 GTAAATAAATAGAGGGTAATAGG + Intronic
967453814 3:189657603-189657625 TTAAACAAATGGATGGTACATGG + Intronic
967476219 3:189923560-189923582 TTAAGTAAATGGATAGTGGATGG + Intergenic
967559145 3:190897615-190897637 TTAAGTAAAGGGGTGGAAAAAGG + Intergenic
967660857 3:192108129-192108151 GTAAGTCAATTGAAGGTAATTGG - Intergenic
968718944 4:2185013-2185035 GTAACCAAATAGATGATAAAAGG + Intronic
969287790 4:6216684-6216706 GAAAGTCAAAGGATGGAAAAAGG - Intergenic
969510293 4:7613866-7613888 GTGAATGAATGGATGGTGAATGG - Intronic
969599379 4:8166933-8166955 ATAGGTGAATGGATGGTGAATGG - Intergenic
969602430 4:8184290-8184312 TTAAGTCAATGGATGGCTAATGG - Intronic
971113198 4:23613909-23613931 TTAAGTAAATGAATGGCAGATGG + Intergenic
971688138 4:29797372-29797394 GTAAGTGAATTTATGATAAAAGG - Intergenic
971750481 4:30640727-30640749 GTAAGCAAAAGGATTGAAAAAGG + Intergenic
971811726 4:31436551-31436573 ATAATTAAATGGATGGAAAATGG + Intergenic
971819632 4:31534553-31534575 ATCAGTAAATGGATGGTAAATGG - Intergenic
972197253 4:36668868-36668890 GTAAGTCAATGGTTTGTAGATGG + Intergenic
972275271 4:37551310-37551332 GTAATTAAAAAGATGATAAATGG + Intronic
973049459 4:45576946-45576968 TTATGTAAATGGATGTTAAATGG + Intergenic
974381397 4:61145028-61145050 ATAAGTAAATGGGTAATAAATGG - Intergenic
974861184 4:67523458-67523480 ATAAGTAAATGGATGTTGAATGG + Intronic
975183039 4:71369139-71369161 GTAAGTCAATGGCTGGGGAAAGG + Intronic
976261303 4:83147567-83147589 GTTAGTAAATGGAAGGCTAATGG - Intergenic
976346359 4:84006687-84006709 CCAAGTAAATGGATGATAGATGG - Intergenic
976734900 4:88299450-88299472 GCAAGGGAATAGATGGTAAAAGG - Intergenic
977164167 4:93674913-93674935 ATAAGTAAATGGATGGAAGAGGG + Intronic
977783119 4:101002218-101002240 TTAATTAAAAGGATGGCAAAAGG - Intergenic
978110850 4:104962567-104962589 GCGAGTAAATGGACGGGAAAAGG - Intergenic
978288848 4:107112918-107112940 TTAGGTAAATGGATGGTGGATGG + Intronic
978292672 4:107163487-107163509 TTAAGTAACTGGATGGTGCATGG + Intronic
978343940 4:107746255-107746277 TTAATTAAATGGATGGCAGATGG + Intergenic
979323797 4:119355159-119355181 GTGAATAAATGCATGGAAAATGG - Intergenic
979383603 4:120037286-120037308 GCAACTAAATGTATGGTAATTGG + Intergenic
981887886 4:149699772-149699794 GTAAGTAAATAAATGGCACAAGG - Intergenic
982101327 4:151971153-151971175 GTAAGTAAATAGCTGGTAACTGG + Intergenic
984305809 4:177988917-177988939 TTAAGTAAATGGATGACACATGG + Intronic
985519361 5:364784-364806 GAAAGTAAAAGGATGGGAAAGGG + Intronic
986277827 5:6295639-6295661 TTAAATAAATGGATGGTGAATGG + Intergenic
987240304 5:15990975-15990997 GAAAGGAAAGGGATGGAAAAAGG - Intergenic
987470963 5:18326885-18326907 TTAGGTATATGGATGGTCAATGG + Intergenic
988020214 5:25611614-25611636 GAAAGTAAAAGAATGGGAAAAGG + Intergenic
988060245 5:26158334-26158356 ACAAGTAAATGGATGGTGGATGG - Intergenic
988376474 5:30441559-30441581 GAAAATAAAGGGATGGAAAAAGG + Intergenic
988387322 5:30581867-30581889 GTGGGTAAATGGGTTGTAAAAGG - Intergenic
989223691 5:38999910-38999932 GAAAGTAAAAGGATGGTAAAAGG + Intronic
989260694 5:39416700-39416722 GTGAGGAAATGGCTGGTAAGAGG - Intronic
989442033 5:41484028-41484050 GTAAGAAAATGGAAGCAAAAAGG + Intronic
990806322 5:59666693-59666715 GTAAGCAACTGAATTGTAAAAGG + Intronic
991598250 5:68326463-68326485 GTAAGGAAATTGATGGTTAGAGG + Intergenic
992569043 5:78033865-78033887 GTTTGTAAATGGATGTAAAAAGG + Intronic
992945551 5:81805272-81805294 GAAAGTGAAGGGATGGAAAAAGG + Intergenic
992989351 5:82268402-82268424 GTAATTAAAAAGATGATAAATGG - Intronic
994033729 5:95175038-95175060 TTAAGTAAATTGAGGGAAAAAGG + Intronic
994243835 5:97456024-97456046 GGAAGTAAATGGAAGCTAGATGG - Intergenic
994301133 5:98148849-98148871 TTAAGTAAATGAATGGCAAATGG - Intergenic
994603063 5:101932570-101932592 TTAAGTAAATACATTGTAAATGG + Intergenic
994810101 5:104505756-104505778 TTAAGTAAATAGATGGCAGATGG - Intergenic
995818023 5:116193461-116193483 GAAAGTAAAGGGGTGGAAAAAGG + Intronic
996876287 5:128243722-128243744 GTAAGTAGATGGATGATGGATGG + Intergenic
996941602 5:129012789-129012811 GAAAGTAGTTGGATGGAAAAAGG - Intronic
997404810 5:133637016-133637038 ATAAGTAGAGGGATAGTAAAAGG + Intergenic
997818633 5:137042673-137042695 TTAAGTAAATGGATAGTGGATGG + Intronic
998589329 5:143460846-143460868 TTAAGTAAATGGGTGGTGGATGG - Intergenic
999354024 5:150906694-150906716 ATAAGCAAATAGATGGGAAATGG - Intergenic
999970320 5:156853936-156853958 GAAAGTAAAAGAATGGAAAAAGG + Intergenic
1000153239 5:158524300-158524322 GTGATTAAATGGAAGATAAAAGG + Intergenic
1000815967 5:165922132-165922154 TTCAGTAAATATATGGTAAATGG + Intergenic
1000903064 5:166932041-166932063 TTAAGTAAATTGATGGCAGATGG + Intergenic
1000962869 5:167620980-167621002 GCAAGAAAATGGATGTAAAAGGG - Intronic
1001178575 5:169496548-169496570 GCAAGTGAATGGATAGGAAATGG + Intergenic
1001429014 5:171644995-171645017 GTAAGAAAATGGATGGTGAGAGG + Intergenic
1003641814 6:7881889-7881911 GGAAGTAGCTCGATGGTAAAAGG + Exonic
1004661508 6:17714511-17714533 GAAAGTTACTGAATGGTAAAAGG - Intergenic
1004790464 6:19020924-19020946 GAAAGGAAATGGAAGGGAAAAGG - Intergenic
1004799241 6:19127886-19127908 TGAAGTAAATGGATGGCAGATGG + Intergenic
1004967274 6:20867904-20867926 GTTAGGAAATGGGAGGTAAATGG + Intronic
1005089148 6:22038125-22038147 CTAAGTATATGGATGGTGGATGG + Intergenic
1005148160 6:22716400-22716422 ATAAGTGATTGGATGGGAAATGG + Intergenic
1005159238 6:22839120-22839142 GAAAGTGAATGAATGGAAAAAGG + Intergenic
1005295800 6:24425961-24425983 GTGAGCTAATGGATGGTACATGG + Exonic
1005679706 6:28194449-28194471 AAAAGTAAATGGATGAAAAAAGG - Intergenic
1005950067 6:30625420-30625442 GTAAGAAAAAGGATTATAAAGGG - Intronic
1006558800 6:34891025-34891047 CTAAATAAATGGATGGTGGATGG + Intronic
1006937127 6:37726265-37726287 GAGAGTAAATGGATGGTATATGG - Intergenic
1007128037 6:39443858-39443880 GTAAGTAAGTAGATGCAAAATGG + Intronic
1007769514 6:44181306-44181328 CTCAAGAAATGGATGGTAAAGGG + Exonic
1008025432 6:46630558-46630580 GTAAGTAAATGGATAGTTTCAGG - Intronic
1008627148 6:53327827-53327849 GAGAGGAAATGGAAGGTAAAAGG - Intronic
1009453376 6:63827059-63827081 TAAAGTAAAGGGATGGAAAAAGG + Intronic
1009546528 6:65027055-65027077 GTAAGTAAATAAATTATAAATGG - Intronic
1010183166 6:73112068-73112090 GAAAATATATGGATGGCAAAAGG - Intronic
1010205509 6:73319269-73319291 TTAAGTAAATGGTTGGTGGATGG + Intergenic
1010403575 6:75476725-75476747 GTAAGTACAAGGGTTGTAAAGGG - Intronic
1011023446 6:82839848-82839870 ATATGTAAATGGATGGCAGATGG + Intergenic
1011425468 6:87224077-87224099 TTAAGTAAATGGATGGCCAATGG - Intronic
1011609405 6:89135907-89135929 ATAAGTATATGGATAGTGAAGGG - Intergenic
1011907978 6:92396364-92396386 GTAAGTAAATGGATGGAAGATGG - Intergenic
1012738026 6:102975623-102975645 AAAAGTAAAGGGATGGAAAAAGG + Intergenic
1013379202 6:109550009-109550031 TTAAGTAAATTGATGGTGATTGG + Intronic
1013952518 6:115801547-115801569 CTAAGTAAATAGAAGGCAAATGG + Intergenic
1014149467 6:118037153-118037175 GAAATAAAATGGATGGAAAAAGG - Intronic
1014200024 6:118598861-118598883 ACAAGTAAATGGATGGTAGATGG + Intronic
1014430381 6:121363588-121363610 TTAAGTAAAAGGATGGCAGATGG + Intergenic
1014435584 6:121417308-121417330 ATAAGTAAATAGATGGAAAATGG + Intergenic
1014651659 6:124047120-124047142 TAAAGTAATTGGATTGTAAAGGG - Intronic
1014939982 6:127426543-127426565 GAAAGTAAACAGATGGAAAAAGG + Intergenic
1014979113 6:127925635-127925657 TTAAGTAAATAGATGGCAGATGG + Intergenic
1015678027 6:135771802-135771824 ACAAGTAAATGGAAAGTAAATGG - Intergenic
1016070008 6:139727304-139727326 GTGAGAAAATTGATGGTGAAAGG - Intergenic
1016161003 6:140879351-140879373 GTAAGCAACTTGATGGGAAAGGG - Intergenic
1016312236 6:142746554-142746576 TTAAGTAAATGGAAGGCAGAAGG - Intergenic
1016434652 6:144023634-144023656 GTAAGTAATTAGATGGTAGGTGG + Intronic
1016681938 6:146840936-146840958 GCAAATTAATGGATGTTAAAGGG - Intergenic
1019848423 7:3529040-3529062 GTAAATATATTGAGGGTAAAGGG + Intronic
1020048068 7:5058442-5058464 GAAAGAAAATGGAAGATAAAAGG - Intronic
1020895877 7:13938943-13938965 GTGTGTGATTGGATGGTAAATGG + Intronic
1021473893 7:21038549-21038571 TTAAGTAAAGGGGTGGAAAAAGG - Intergenic
1022075682 7:26967365-26967387 ATAAGTAAATGGTTTTTAAAAGG - Intronic
1022285702 7:28955428-28955450 AGAAGTAAATGGATGGTACTTGG - Exonic
1022983400 7:35625862-35625884 GAAAGTAAAAGGATGGAAAAAGG - Intergenic
1023691367 7:42791990-42792012 GTAATTACATGAAAGGTAAATGG + Intergenic
1024025383 7:45405756-45405778 TTAAGTCAATGGATGGTAGATGG + Intergenic
1024121644 7:46248012-46248034 GTAAATAAAAGCATGGTAAGTGG + Intergenic
1024467217 7:49723912-49723934 CTAAGTAAATGGGTGATAGATGG - Intergenic
1024886014 7:54143618-54143640 CTAAGTAAATGGGTGGCAGATGG + Intergenic
1026428484 7:70320532-70320554 TTAAGTAAATGTTTGCTAAATGG - Intronic
1026495746 7:70901174-70901196 GAAAGTGAAAGGATGGAAAAAGG - Intergenic
1026828586 7:73598224-73598246 GTAGGTGAATGGATGGAAGACGG - Intronic
1027372058 7:77516750-77516772 GTCAGTAAATAGATGGTAGATGG - Intergenic
1027728095 7:81832989-81833011 GTAAGTTAATTGATGTAAAATGG - Intergenic
1028278847 7:88895266-88895288 ATAAGTAAATGGGTGGCAGATGG + Intronic
1030270740 7:107665976-107665998 TTAAGTGAATGAATGATAAATGG - Intronic
1030565308 7:111146719-111146741 TTAAGTTAATGGATGAAAAAGGG + Intronic
1030706529 7:112698192-112698214 GAAAATAAAGGGATGGAAAAAGG - Intergenic
1030981490 7:116190048-116190070 GTAAGTAGATTGGAGGTAAAAGG + Intergenic
1031294053 7:119980388-119980410 AGAAGTAAAAGGATGGAAAAGGG + Intergenic
1031488367 7:122357216-122357238 TTAAGTAAATGGATGGTGGTTGG - Intronic
1031562203 7:123251958-123251980 GAAATCAAAAGGATGGTAAAAGG + Intergenic
1033706638 7:143893062-143893084 GAAAGTGAAAGGATGGAAAAAGG + Intronic
1034713050 7:153213254-153213276 GAAAGTGAAGGGATGGAAAAAGG - Intergenic
1036436026 8:8734254-8734276 TTAAGTAAATGCATGGCAGATGG - Intergenic
1036457151 8:8919889-8919911 TTAAGTAAATGGATGATTGACGG - Intergenic
1037024749 8:14021196-14021218 TTAAGTAAATGGATGAACAAAGG - Intergenic
1037173244 8:15918508-15918530 GTGAGTAACTGGATGAGAAAGGG + Intergenic
1037508700 8:19559491-19559513 ATAAGTAAATAAATGGTACAAGG + Intronic
1037697845 8:21242840-21242862 GAAAGTAAAGGGATCATAAAAGG - Intergenic
1038365277 8:26925520-26925542 TTACGTAAATGGATGGCAAATGG + Intergenic
1040577023 8:48661578-48661600 TTAAGTAAATGGATGGCAGATGG - Intergenic
1040632479 8:49231302-49231324 GTAAGAAAGTGGATGGAAATTGG + Intergenic
1040936528 8:52787668-52787690 GGAAGTAAATGGGTGGCAAGTGG + Intergenic
1041060495 8:54030280-54030302 GAATGTAAAAGGATGGAAAAAGG - Intergenic
1041236080 8:55804105-55804127 GCAAGGAACTGGATGGCAAAAGG - Intronic
1041424920 8:57709701-57709723 AGAAGTAAATGGATGGTGCAGGG - Intergenic
1041565483 8:59272971-59272993 TTAAGTAAATGGATGGCAGCTGG - Intergenic
1041697303 8:60749434-60749456 CTAAGTAAATTTATGGAAAAAGG + Intronic
1041816470 8:61977800-61977822 GAAAGTCAAAGGATGGAAAAGGG + Intergenic
1042129815 8:65577003-65577025 GAAAGTAAACAGATGGAAAAAGG - Intergenic
1042441738 8:68835758-68835780 TTAAGTAAATAAATGGCAAATGG + Intergenic
1042819919 8:72918999-72919021 GTAAGTAAATAGAATGGAAAGGG + Intronic
1043918581 8:85953569-85953591 GTATGTAAATGCATAGAAAATGG - Intergenic
1043933449 8:86116558-86116580 GTCAATAAATGATTGGTAAATGG - Intronic
1044568865 8:93696212-93696234 GTTAGCAAATGCTTGGTAAATGG - Intergenic
1044793150 8:95868524-95868546 TTAAGTAAATGGATGGTAGATGG - Intergenic
1045102931 8:98863655-98863677 GTGAGAATATGGATGGTAATGGG - Intronic
1045988967 8:108283738-108283760 GTAAGTAAATGGAGGTAAAAAGG + Intronic
1046208229 8:111032502-111032524 TTAAGTAAATGGATAGCAGATGG + Intergenic
1046233726 8:111393292-111393314 GTAAGAAAAAGGATGATAAAAGG + Intergenic
1046608558 8:116397738-116397760 GAAAGCAAAAGGATGGAAAAAGG + Intergenic
1047154725 8:122303997-122304019 GTAAGTGTATGGATGGGTAATGG - Intergenic
1047266078 8:123310341-123310363 ATAGGTAAATGGGTGGTGAAAGG + Intergenic
1047329227 8:123871032-123871054 TTAAGTAAATGAATGGCAGATGG + Intronic
1047403104 8:124562514-124562536 GTAAGTAGATGGATTGAAAGAGG - Intronic
1048069911 8:131010578-131010600 GTAAGTAAAAGGAAGCAAAAGGG + Intronic
1048124485 8:131617703-131617725 TTAAGTAAATGGATGGTGGGAGG - Intergenic
1048187856 8:132260774-132260796 ATAATTAAATGGATGGATAATGG - Intronic
1048790901 8:138102340-138102362 GAAAGTAATAGGATGCTAAATGG + Intergenic
1048913385 8:139158372-139158394 TTAAGTACCTGGATGATAAATGG + Intergenic
1050140109 9:2508799-2508821 TTAAGTAAATAGATGGACAATGG - Intergenic
1052609894 9:30758859-30758881 GTAAATAAATGGACGGTCCATGG - Intergenic
1055371393 9:75603452-75603474 GAAAGGAGATGGATTGTAAAGGG - Intergenic
1056686540 9:88768262-88768284 TCAAGTAAATGGATGGTGGATGG - Intergenic
1056819722 9:89830335-89830357 CTAAGTAAATGGATGGAGGATGG - Intergenic
1056986505 9:91368286-91368308 TTAAGTAAATGGATGGCAGATGG + Intergenic
1057323899 9:94042129-94042151 ATAAGTAAAAGGATGGTGAATGG - Intronic
1057719937 9:97523925-97523947 GTAAGTTAATGAATTGTAATTGG - Intronic
1057970300 9:99549912-99549934 GAAAATAAAGGGATGGAAAAAGG - Intergenic
1059609380 9:115876470-115876492 TAAAGTAAATGGGTGGAAAAGGG - Intergenic
1059644632 9:116252391-116252413 ATAAGAAAATGGATGTTACAGGG + Intronic
1059774150 9:117458233-117458255 TTAAGTAAATGGATGGCAGATGG + Intergenic
1060165438 9:121410200-121410222 TTAAGTAAATGGATGGTGGATGG - Intergenic
1060376603 9:123120199-123120221 GAAAGGAGATGGGTGGTAAATGG - Intronic
1060395828 9:123315703-123315725 GTAAGTACATGGATTGCAATAGG + Intergenic
1061086132 9:128399777-128399799 ATAATTAAATGAATGGTAGATGG + Intergenic
1061584464 9:131556980-131557002 GATAGTAGATGGATGGTAGATGG - Intergenic
1061636076 9:131909253-131909275 GTAAGTGAAGAGATGTTAAATGG + Intronic
1062247979 9:135579411-135579433 GTGAATAAATGGATGGTGTATGG - Intergenic
1062248006 9:135579579-135579601 GTAAGTCAATGAATGATAGATGG - Intergenic
1062248072 9:135579929-135579951 GTAAATAAATGGATGGACAATGG - Intergenic
1062378013 9:136273296-136273318 GCAAATAAATGGAAAGTAAAAGG + Intergenic
1185552539 X:994950-994972 GTAAGTAGATAGATGATACATGG - Intergenic
1185926975 X:4157949-4157971 GTAAGTATATGGGTTGTAACTGG - Intergenic
1188718410 X:33491642-33491664 GAAAGCAAATGGATAGAAAACGG + Intergenic
1190561185 X:51686910-51686932 ATGAGTAAATGGATGGTGGAGGG - Intergenic
1190563106 X:51706407-51706429 ATGAGTAAATGGATGGTGGAGGG + Intergenic
1190614964 X:52220848-52220870 GAAAATAAAAGGATGGAAAAAGG + Intergenic
1190926217 X:54907616-54907638 ATAAGTAAAGGGATGGTAGATGG - Intergenic
1192302622 X:69921519-69921541 TCAAGTAAATGGATGGTGGATGG - Intronic
1192820428 X:74638939-74638961 TAAAGTAAAGGGATGGAAAAAGG + Intergenic
1192907718 X:75569321-75569343 GTAAGAAAATGGATGGATATTGG + Intergenic
1193750191 X:85332551-85332573 TTAAGCATATAGATGGTAAATGG + Intronic
1194457277 X:94120644-94120666 GAAAATAAAGGGATGGTAAAAGG - Intergenic
1194934586 X:99932759-99932781 GGTAGTGCATGGATGGTAAAGGG - Intergenic
1195592454 X:106646159-106646181 GAAAATAAAAGGATGGTAAAAGG - Intronic
1195632998 X:107079348-107079370 TTAAGTAAATGTATGGCAGATGG - Intronic
1195842540 X:109190188-109190210 TTAAGAAAATGTATAGTAAAAGG - Intergenic
1197016308 X:121630723-121630745 TTAAGTAAATGGATAGTAGGTGG + Intergenic
1197213128 X:123844681-123844703 GTAAGTAAATGGATAGTGGACGG + Intergenic
1197668882 X:129254063-129254085 TAAAGTAAAGGGATGGAAAAAGG - Intergenic
1198374174 X:136021339-136021361 TTAGGTAAATGGATGGCAAGTGG - Intronic
1199549742 X:149045854-149045876 ATAAGTAAATGGATGGCAGATGG - Intergenic
1199797220 X:151211753-151211775 TAAAGTAAAGGGATGGAAAAAGG + Intergenic
1199891711 X:152089827-152089849 CTAAGTAAATGAATGGTAGATGG - Intergenic
1201388401 Y:13468694-13468716 GGAAGTCAATGAATGATAAATGG - Intronic