ID: 1089730419

View in Genome Browser
Species Human (GRCh38)
Location 11:120515512-120515534
Sequence CCATACAGAGGGAGAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 316}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089730419_1089730425 5 Left 1089730419 11:120515512-120515534 CCTTCTGCTCTCCCTCTGTATGG 0: 1
1: 0
2: 3
3: 39
4: 316
Right 1089730425 11:120515540-120515562 CTGAGCCCCCTGCTCCTACCTGG 0: 1
1: 0
2: 2
3: 38
4: 357
1089730419_1089730428 11 Left 1089730419 11:120515512-120515534 CCTTCTGCTCTCCCTCTGTATGG 0: 1
1: 0
2: 3
3: 39
4: 316
Right 1089730428 11:120515546-120515568 CCCCTGCTCCTACCTGGTATTGG 0: 1
1: 0
2: 1
3: 7
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089730419 Original CRISPR CCATACAGAGGGAGAGCAGA AGG (reversed) Intronic
901422159 1:9158483-9158505 CCCTGCAGAGGGAGAGAGGAGGG - Intergenic
901570037 1:10152851-10152873 CCAGACTGAGGGATAGAAGATGG - Intronic
901742319 1:11350354-11350376 CCTTCCGGAGGGAGAGCCGAGGG - Intergenic
901752257 1:11417574-11417596 CCAAACACTGGGTGAGCAGAGGG - Intergenic
905364520 1:37442343-37442365 ACAGAGAGAGGGAGAGCGGAGGG - Intergenic
905825047 1:41020815-41020837 CCAGAGAGAGGGAGGGCAGAGGG + Exonic
906343094 1:44997981-44998003 CCATAGAGATAGAGAGTAGAAGG + Intergenic
907261316 1:53220647-53220669 CCCTACTGAGGGTGCGCAGACGG - Intergenic
907289047 1:53401149-53401171 ACACAAAGAGGGAGAGAAGAGGG + Intergenic
908224393 1:62041282-62041304 ACAAATAGAGGGAGAGCAGAGGG + Intronic
909077723 1:71072215-71072237 AAATACAGAGGGAAAGCAGTTGG - Exonic
909607006 1:77517791-77517813 CTATACTGAAGGAAAGCAGAAGG + Intronic
909654645 1:78017696-78017718 CCATACAGATGAAAAGTAGATGG - Exonic
909702621 1:78544124-78544146 CCACCCAGAGGGAGTGCTGAGGG - Intergenic
916115236 1:161480375-161480397 CAGCACAGAGGGATAGCAGAGGG - Intergenic
917675659 1:177316847-177316869 CCAAACAGAGAGAGAAAAGAAGG - Intergenic
917968863 1:180194827-180194849 CCATAATGAGGGAACGCAGAGGG - Intronic
919133794 1:193483641-193483663 CCTTTCAGAGGGAGAGCATCAGG - Intergenic
920037860 1:203077166-203077188 CCAGCCAGAGGGAGAGCCAATGG + Exonic
920301385 1:204991244-204991266 CCAGACAGAGGGAGAAAGGATGG - Intronic
920679476 1:208061460-208061482 AGATACAGAGGGAAAGCAGTGGG + Intronic
921008057 1:211113544-211113566 CCATACAATGGAAGAGGAGAAGG + Intronic
921189009 1:212693514-212693536 CCCCACAGAGAGAGAGGAGAAGG + Intronic
921335514 1:214081785-214081807 CCAGAGAGAGGGCAAGCAGATGG - Intergenic
921538890 1:216387824-216387846 GCAGAGAGAGGGAGGGCAGATGG - Intronic
922550855 1:226493331-226493353 CCATGGAGAGGGACAGCAGTTGG + Intergenic
922903162 1:229154204-229154226 TCAGACAGAGTGAGTGCAGAAGG - Intergenic
923105741 1:230851923-230851945 CCATACAGAGGTGCAGCAGTTGG + Intronic
1063227810 10:4032898-4032920 CCAGACAGGGGGACAGCAGAGGG + Intergenic
1064868824 10:19914043-19914065 GCAGGCAGAGGGAGAGCAGGAGG + Intronic
1067295442 10:44972927-44972949 CCAGACAGTGGCAGATCAGAGGG + Intronic
1067494822 10:46752390-46752412 CCAGATAGAGGCAGAGTAGAAGG + Intergenic
1067599834 10:47588007-47588029 CCAGATAGAGGCAGAGTAGAAGG - Intergenic
1068032283 10:51718734-51718756 CCATAGAGACAGAGAGTAGAAGG + Intronic
1069329141 10:67270083-67270105 CCATACAAAGGAAGAACAGCTGG + Intronic
1070341662 10:75503804-75503826 CCTGAGAGAGGGAGAACAGATGG + Intronic
1070469431 10:76764121-76764143 AAAGTCAGAGGGAGAGCAGATGG + Intergenic
1071176564 10:82932985-82933007 GAATAAAGAGGGAGAGAAGAAGG - Intronic
1071338830 10:84624040-84624062 CCAAACAGAAGGACAGCAGGAGG - Intergenic
1071406354 10:85337032-85337054 CCTCACAGAGGGAGGGAAGAAGG + Intergenic
1071651370 10:87395890-87395912 CCAGATAGAGGCAGAGTAGAAGG - Intergenic
1072003539 10:91220706-91220728 GCCTGCAGGGGGAGAGCAGACGG + Intronic
1072316815 10:94211282-94211304 GCCTACAGAGGGAGGGCAGGTGG + Intronic
1073341167 10:102745491-102745513 CCATAGAGACTGAAAGCAGACGG - Intronic
1074214808 10:111373880-111373902 GCACACAGATGGAGAGCAGCAGG + Intergenic
1075214877 10:120523572-120523594 GGAGACAGATGGAGAGCAGATGG - Intronic
1076438743 10:130464620-130464642 CAACACAGATGAAGAGCAGATGG - Intergenic
1077473591 11:2776201-2776223 CCCTGCAGAGGGAGGGCAGCTGG + Intronic
1077654546 11:4006234-4006256 CCATACACAGCCAGAGCAGGAGG - Intronic
1078304427 11:10169365-10169387 TCATAGAGAGAGAGAGAAGAAGG - Intronic
1078458718 11:11496614-11496636 CCACACAGAGGGTGGGAAGAAGG + Intronic
1078537547 11:12187089-12187111 CCACACGGGGAGAGAGCAGAGGG - Intronic
1079397675 11:20079619-20079641 CCAGATAGAGGGATAGCACATGG + Intronic
1079743636 11:24097281-24097303 TTATACAGAGGCAGAGGAGAGGG + Intergenic
1080447642 11:32352159-32352181 CCTTACAGAGTGAGAGCAATGGG + Intergenic
1081329445 11:41786447-41786469 CCAAAGAGATGGAGAGCAGTAGG - Intergenic
1082085138 11:48043968-48043990 CCCTTCAGAGGGAGGGGAGAGGG - Intronic
1083143079 11:60737735-60737757 CCATACAGAGAAAGTGGAGAGGG - Intronic
1083968583 11:66058306-66058328 CCTTACAGAGGAAGAGGAAATGG + Exonic
1084164649 11:67369864-67369886 CCCTACACAGGGACAGCAGGGGG + Intronic
1084750977 11:71204402-71204424 CTTTACAGAGGCAGCGCAGATGG - Intronic
1085349185 11:75787713-75787735 CCAAACACAGGAAGAGCAAAAGG - Intronic
1086606151 11:88698948-88698970 CCATATAGCTAGAGAGCAGATGG - Intronic
1086964314 11:93011861-93011883 CCACAGAGAGGGAGAGGAGTAGG - Intergenic
1087058813 11:93958888-93958910 GGATACAGAGGAAGAGCAGCCGG + Intergenic
1087233287 11:95690406-95690428 CCATTTAGAGGGAAATCAGATGG - Intergenic
1087836740 11:102882512-102882534 CCATACAGAGGAAGAAAAGGAGG + Intergenic
1088497921 11:110450499-110450521 CCACACAGCAGGTGAGCAGAGGG - Intronic
1089583181 11:119494338-119494360 TCATAAGGAGGGAGAGAAGAGGG - Intergenic
1089730419 11:120515512-120515534 CCATACAGAGGGAGAGCAGAAGG - Intronic
1090066360 11:123507137-123507159 ACAAACACATGGAGAGCAGAAGG - Intergenic
1093465884 12:19448535-19448557 ACATACTGAGTGAGTGCAGAAGG - Intronic
1094087190 12:26607165-26607187 CAGTACAGATGGTGAGCAGAAGG - Intronic
1094267167 12:28572399-28572421 CCAGCCAGAGGGAAAGGAGAAGG - Intronic
1095794740 12:46205980-46206002 GCATGCAGAGGGGAAGCAGAGGG + Intronic
1096005416 12:48166470-48166492 CCATAGAAAGGGAGAGAAGGGGG + Intronic
1096203477 12:49703237-49703259 CCATAGAGAGGGGAGGCAGAGGG - Intronic
1096256615 12:50065750-50065772 CCACACAGAGGGCATGCAGAAGG - Intronic
1096880198 12:54661318-54661340 ACATGCTGAGGGAGACCAGAGGG + Intergenic
1101939453 12:109089241-109089263 ACATCTGGAGGGAGAGCAGAGGG - Intronic
1102250924 12:111387050-111387072 CCATAGAGACAGAGAGCAGATGG - Intergenic
1102550609 12:113689125-113689147 ACAGAGAGAGAGAGAGCAGATGG - Intergenic
1103606295 12:122088186-122088208 CCCTGGAGAGGGACAGCAGAGGG - Intronic
1103713952 12:122932314-122932336 CCATACAGAGACAGGGGAGAAGG - Exonic
1104646692 12:130502499-130502521 CCAGGCAGGGGGAGTGCAGAGGG - Intronic
1104723996 12:131065022-131065044 ACATACAAAGAGAGAGGAGAGGG - Intronic
1105610779 13:21968094-21968116 CCAGACAAAGGGGGAGCATATGG + Intergenic
1105966767 13:25391764-25391786 CCATACAGAGGCCGTACAGAAGG + Intronic
1106026506 13:25960427-25960449 ACAGAGGGAGGGAGAGCAGAGGG - Intronic
1111251656 13:85608855-85608877 CCATACAGAGATAGAGACGAGGG - Intergenic
1111285343 13:86084036-86084058 CCATAGAGATGGAAAACAGATGG + Intergenic
1111791286 13:92858649-92858671 CCAAAAAGAGGGAGGGCAGGAGG + Intronic
1112148278 13:96726846-96726868 ACATACAGAGGGAAAAGAGAAGG - Intronic
1112943726 13:104898118-104898140 CCAAATACAGGGAGAGCATATGG + Intergenic
1113222697 13:108123231-108123253 ACAAGAAGAGGGAGAGCAGATGG + Intergenic
1114360340 14:21965321-21965343 CAAGACAGAGGGAGAGATGAGGG + Intergenic
1118038680 14:61894534-61894556 CCACACAGAAGGTGAACAGATGG + Intergenic
1120613384 14:86671043-86671065 TCATAGAGATAGAGAGCAGAAGG - Intergenic
1121103441 14:91265022-91265044 CCATACGGATGGAGAGGTGACGG + Intergenic
1122824687 14:104363945-104363967 GCAGCCAGAGGGAGAGCACAGGG - Intergenic
1122882940 14:104698146-104698168 CTTTCCAGATGGAGAGCAGAGGG + Intronic
1122903905 14:104793227-104793249 CCATGGACAGGGAGAGCAAACGG - Exonic
1125797803 15:42416390-42416412 CCATACAGTGGGAGAGATGGAGG + Exonic
1126789028 15:52203812-52203834 TCATAAAGATGGAGAGTAGAAGG - Intronic
1127682317 15:61309869-61309891 CCACACCCAAGGAGAGCAGAAGG - Intergenic
1128343483 15:66838896-66838918 CCATAGATAGGGAGAACTGATGG - Intergenic
1129519721 15:76178052-76178074 CCATTTAGAGGGTGAGCAGAGGG + Intronic
1129710946 15:77819958-77819980 CGAGACAGACGGAGAGCAGCGGG - Intronic
1131459129 15:92606182-92606204 CCATGCATTGGGAGATCAGAGGG + Intergenic
1131814644 15:96209515-96209537 CGAGTCAGAGGGAAAGCAGAGGG - Intergenic
1133136108 16:3713251-3713273 CCAAACAAAGGGAGAGCAGAGGG + Intronic
1134870279 16:17646640-17646662 ACAAACAGAGGCAGAGCTGAAGG + Intergenic
1136088696 16:27903316-27903338 CCACACAGAGAGAGAGAAGTGGG + Intronic
1138549449 16:57739644-57739666 GCCCACAGAGGGAGGGCAGAGGG - Intronic
1138653227 16:58473714-58473736 CCACACAGCGGGAGTGCAGGAGG - Intronic
1139857573 16:69992827-69992849 CCATACAATGGGAGAGCCAACGG + Intergenic
1140657461 16:77155432-77155454 CTATAGAGAGGGAAAGTAGAGGG - Intergenic
1141114077 16:81293489-81293511 CGATTCTGAGGAAGAGCAGATGG - Intergenic
1141345274 16:83239224-83239246 CACTGCAGAGGGAGAGCAGCAGG + Intronic
1141663102 16:85452371-85452393 CCAGACAGAGGGAGAGGTGGGGG - Intergenic
1141965398 16:87438809-87438831 CGCTACAGAGGAACAGCAGAGGG + Intronic
1142276348 16:89120883-89120905 CCACGCAGAGGGAGACGAGAGGG + Exonic
1143088929 17:4437022-4437044 ACATACAGAGGAAGTGCTGATGG - Intronic
1143090537 17:4446985-4447007 CGGTCCAGAGGGAAAGCAGAGGG - Intronic
1143566815 17:7727101-7727123 TTCTACAGAAGGAGAGCAGAGGG - Exonic
1143764130 17:9126622-9126644 CCACACTGAGCCAGAGCAGAAGG - Intronic
1144792773 17:17870493-17870515 CCATACAGGGTTAAAGCAGAGGG + Intronic
1145825448 17:27873772-27873794 GCGAACAGAGGGAGAGCACAGGG - Intronic
1146351762 17:32101350-32101372 CCACATAGAGGGAGGGCAGGTGG + Intergenic
1146845316 17:36178653-36178675 CCATCCCCAGGAAGAGCAGATGG - Intronic
1146873532 17:36390496-36390518 CCATCCCCAGGAAGAGCAGATGG - Intronic
1146880890 17:36441584-36441606 CCATCCCCAGGAAGAGCAGATGG - Intergenic
1147065857 17:37922377-37922399 CCATCCCCAGGAAGAGCAGATGG + Intergenic
1148324421 17:46774942-46774964 GGACACAGAGGGAGAGGAGATGG - Intronic
1148638796 17:49169498-49169520 GCAAAGAGAGGGAGAGCAGAAGG - Intronic
1149406715 17:56359492-56359514 AAATGCAGAGGGAGAGGAGAGGG - Intronic
1149572556 17:57683731-57683753 GCAGACAGTGGGAGAGCAGAGGG + Exonic
1149869172 17:60167493-60167515 CCACAGAGAGGGAGGGCAGGTGG + Intronic
1150058982 17:62047565-62047587 GCATGGAGAGGGAGAGCATAAGG + Intronic
1152180923 17:78821318-78821340 TCCTGCTGAGGGAGAGCAGAGGG + Intronic
1153777538 18:8466930-8466952 CCAGACAGAGGGAAAGCAGAAGG + Intergenic
1154383104 18:13870094-13870116 CCCTACAGAGTGACTGCAGAGGG + Intergenic
1155809303 18:30211599-30211621 TCACACAGAGGGAGTGCTGAAGG + Intergenic
1155845731 18:30703725-30703747 CCATAGAGAGGAGGAGCAGATGG + Intergenic
1157307977 18:46530781-46530803 CCACACAGAAGGAGAGCAGGAGG - Intronic
1157851827 18:51061384-51061406 CCATAGAGACAGAGAGTAGAAGG - Intronic
1158623154 18:59049830-59049852 CCCTTCAGAAGGAGAGCAGAAGG - Intergenic
1158943575 18:62428645-62428667 CCATTCAGAGGGAAAGAAGAAGG - Intergenic
1159476748 18:68930596-68930618 CCCAACAGAGATAGAGCAGAAGG - Intronic
1159904506 18:74077706-74077728 CAATACTGAGGGCCAGCAGATGG + Intronic
1160938771 19:1610294-1610316 CCACACAGAGGGAGGGCAGCAGG + Exonic
1161482928 19:4519694-4519716 CCAAACAGTGGGGGAACAGAAGG + Intergenic
1161567797 19:5013101-5013123 CCCCAGAGAGGGAGGGCAGAAGG + Intronic
1161687634 19:5711273-5711295 CCCTACAGCGGGAGGGCAGGTGG + Intronic
1161748858 19:6079482-6079504 CTATAGAAAGGGACAGCAGATGG + Intronic
1161796856 19:6392301-6392323 CCAGGCAGAAGAAGAGCAGATGG + Intronic
1161939670 19:7394787-7394809 GGATCCAGAGGGAGAGCAGCAGG - Intronic
1162183690 19:8888387-8888409 GCATAGAGAGGGAGGGAAGAGGG + Intronic
1163888897 19:19993563-19993585 CTATTCAGAAGGAGACCAGAGGG - Intergenic
1164476977 19:28583197-28583219 CCATACGGTGGGAGAGTGGAGGG - Intergenic
1164578335 19:29419024-29419046 CCAGACACAGGAAGGGCAGAGGG - Intergenic
1165800164 19:38544411-38544433 CCAGACAGAAGCAGAGCAAATGG - Intronic
1165862666 19:38917450-38917472 CCAGAGAGAGGGGGAGCAGCAGG + Intronic
1168197911 19:54789187-54789209 ACATAAAGAGGGAGAAAAGAGGG + Intronic
1168593777 19:57657250-57657272 GCAGACAGACGGAGGGCAGACGG - Intergenic
926599304 2:14824726-14824748 CCAAACAGTGGGAAAGCAGTGGG + Intergenic
928374850 2:30765895-30765917 TCAGAGAGAGGGAGAGCAGGAGG - Intronic
932613005 2:73213594-73213616 CCCTAGAGTGGGACAGCAGAAGG - Intergenic
932839823 2:75071816-75071838 GCAAAGAGAGGGAGAGCAGGAGG - Intronic
933184598 2:79264966-79264988 CTGTACAGAAGCAGAGCAGATGG - Intronic
933412099 2:81939672-81939694 CCACAGAAAGGGAGAGCTGAGGG + Intergenic
933656645 2:84894143-84894165 CAGTATACAGGGAGAGCAGAAGG + Intronic
933967021 2:87438345-87438367 GTAAACAGAGAGAGAGCAGAAGG + Intergenic
933989249 2:87621905-87621927 ACATACAAGGGAAGAGCAGAAGG - Intergenic
935914594 2:107935643-107935665 TCAGACTCAGGGAGAGCAGAAGG - Intergenic
936304594 2:111328921-111328943 ACATACAAGGGAAGAGCAGAAGG + Intergenic
936326776 2:111512152-111512174 GTAAACAGAGAGAGAGCAGAAGG - Intergenic
937349745 2:121153365-121153387 CCATAGAGATGAAGAGGAGATGG - Intergenic
938876948 2:135541554-135541576 CCAAAGAGAGGGAGAAGAGATGG + Intronic
939626590 2:144484704-144484726 CCATAGAGAGGGTGATGAGAGGG - Intronic
940205228 2:151195174-151195196 CTATACAGAGGGAGTGAGGATGG - Intergenic
942750568 2:179282323-179282345 CCATAGAGATAGAGAGTAGAAGG + Intergenic
944204958 2:197148575-197148597 AGAGACAGAGGAAGAGCAGAGGG - Intronic
944477851 2:200125543-200125565 CCATACAGAGACAGAGGAGGGGG + Intergenic
945634502 2:212330708-212330730 GAATACAGAGGCAGAGCAGCTGG - Intronic
946203871 2:218089531-218089553 CCATAAAGGAGAAGAGCAGAAGG + Intronic
946413942 2:219530007-219530029 CTACACAGGGGGAGTGCAGAAGG - Intronic
947066045 2:226226620-226226642 ACACACAAAGAGAGAGCAGAGGG - Intergenic
947164783 2:227250780-227250802 CTAGGCAGAGGGAGAGCAGGTGG + Intronic
947588866 2:231373216-231373238 GCAGACAGAGGAAAAGCAGAGGG + Intronic
947615536 2:231554722-231554744 GCCTGCAGAGGGAGGGCAGAGGG - Intergenic
1168820604 20:770873-770895 CCAAATGGAGGAAGAGCAGAAGG - Intergenic
1168958205 20:1849330-1849352 GAATAAGGAGGGAGAGCAGAGGG - Intergenic
1169829773 20:9811481-9811503 TAATACAGAGTGAGAACAGAAGG + Intronic
1170342360 20:15343503-15343525 TCATAAAGAGAGACAGCAGAGGG - Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171187788 20:23135873-23135895 CCATAGAGACCGAAAGCAGAAGG + Intergenic
1172487466 20:35306979-35307001 ACATACAGAGGGAGAACAGGGGG + Intronic
1173079233 20:39850067-39850089 CCGTACAGAGCCAGGGCAGAGGG + Intergenic
1173421322 20:42903881-42903903 CATTAGAGAGGAAGAGCAGAAGG - Intronic
1174197777 20:48785726-48785748 GCTTACTGAGGGAAAGCAGAGGG - Intronic
1174503868 20:51004422-51004444 CCACGCAGAGGAAGAGCAGCAGG + Exonic
1175683765 20:61011123-61011145 CTATAGAGAGAGAGAGGAGAAGG - Intergenic
1176221766 20:63972677-63972699 ACTTACACAGGGAGAGCTGACGG - Intronic
1180156731 21:45981743-45981765 CCAGCCAGAGTGAGAGCGGAGGG - Exonic
1180224132 21:46379562-46379584 CCAGACAGAGGGAGAGAAAAGGG - Intronic
1180238033 21:46477096-46477118 CCACACAGAGGAAGAGCAGGAGG - Intronic
1181047598 22:20222973-20222995 CCAGACAGAGGGAGAGAGGGAGG + Intergenic
1181641897 22:24205779-24205801 CCTTACAGAGACAGAGCAGGGGG + Intergenic
1181680148 22:24489779-24489801 TCATGCAGATGGAGAGTAGAAGG + Intergenic
1181922815 22:26333752-26333774 CCATAAGGAGGGTGAGCACAAGG + Intronic
1184693284 22:46127125-46127147 CCATGCAGAGGGTGGGCAGCAGG - Intergenic
1184852825 22:47130469-47130491 CCATCCAGAGAGAGGCCAGAAGG - Intronic
1185305745 22:50114939-50114961 ACATAAAGAGAGAGAGCAGCTGG - Intronic
1185331267 22:50253041-50253063 CCATGCAGAGGAAGGACAGAGGG - Exonic
950694972 3:14691924-14691946 TCATGGAGATGGAGAGCAGATGG - Intronic
950891980 3:16412390-16412412 CCTCACAGAGGAAGAGCTGAAGG + Intronic
951651302 3:24954652-24954674 CAATAGAGAGGGAGAGAAGGGGG + Intergenic
952433668 3:33250091-33250113 CCATGGAGATAGAGAGCAGAAGG - Intergenic
953738441 3:45515936-45515958 CAATACAGAGGGAGAGAAAGCGG + Intronic
953911752 3:46896705-46896727 CCCTACAGAGGGAGAGAAGGGGG + Intronic
954449476 3:50563915-50563937 CCATGCAGTGGGTAAGCAGATGG - Intronic
955971787 3:64444685-64444707 CCATACAGAAGAGGAGCAGTTGG - Intronic
956449022 3:69355217-69355239 CTATCAAGAGGGAGAGCACAAGG + Intronic
957297198 3:78347438-78347460 TCATACACAGGGTGAGCAAAAGG + Intergenic
958747582 3:98155393-98155415 CCGTACAGAGAGGGAGCAGTTGG + Intergenic
958756268 3:98252904-98252926 CCGTAGGGAGGGAGAGCATAAGG + Intergenic
960537069 3:118826273-118826295 CCATAAGGAGGGAGAGAAAAGGG - Intergenic
961025357 3:123550833-123550855 CCATACAGGGAGACTGCAGAGGG + Intronic
962384483 3:134921878-134921900 AGAGACAGAGGGAGGGCAGAGGG + Intronic
962620309 3:137171608-137171630 CCAGACAAAGAGAGAACAGAAGG + Intergenic
962983303 3:140509781-140509803 CCCCACAGAGGTAGAGCTGACGG - Intronic
963088222 3:141457936-141457958 CCACACAAAGTGAGGGCAGAAGG - Intergenic
963173571 3:142275877-142275899 CCATACGGATGGAGAGAAGAGGG + Intergenic
963231987 3:142917045-142917067 CCATACAGAGGGAGCAGAGGGGG - Intergenic
963296229 3:143549653-143549675 CCATTCAGAGGGAGAACAGAAGG + Intronic
964769215 3:160206956-160206978 CCAAACAGAGCAAGAGCAAATGG - Intergenic
966433655 3:179859669-179859691 GCCAACAGAGGGAAAGCAGAAGG - Intronic
966872847 3:184302926-184302948 CCATTCAGTGGGATAGCAGAAGG + Intronic
967092131 3:186143816-186143838 CTATACAGAGGTTGAACAGATGG + Intronic
967270875 3:187731363-187731385 CAACACAGAGGAAGAGCTGAGGG + Intronic
968040903 3:195588504-195588526 GCATACAGATGGAGAGAAGTGGG + Intergenic
968385967 4:138315-138337 TCATAGAGACAGAGAGCAGAAGG - Intronic
969840485 4:9878045-9878067 CCCCACAGAGGAAGAGGAGAGGG - Intronic
971384895 4:26133536-26133558 CCACACAGCGGGTGAGCAGTAGG + Intergenic
974041862 4:56864379-56864401 CCATACACAGGCAGAGTAGTGGG + Intergenic
974508569 4:62807842-62807864 CCATTTAGTGGGAGAGCAGAGGG + Intergenic
976747630 4:88420016-88420038 CGAGAGAGAGAGAGAGCAGAGGG - Intronic
977422986 4:96827444-96827466 AAACACAGAGGGAGGGCAGAAGG + Intergenic
977564353 4:98566560-98566582 CCATACAGAGGAGAAGCAGGGGG + Intronic
980753446 4:137123784-137123806 CCAGACAGAGAGAGAGGAGAAGG + Intergenic
983743818 4:171169309-171169331 CAAGACAGAGTGAGAGCAGCTGG - Intergenic
984850900 4:184151698-184151720 TCATACACAGGCATAGCAGAGGG - Intronic
986061245 5:4193207-4193229 CCACACAGCGGGTGAGGAGAAGG + Intergenic
988431012 5:31118614-31118636 CCATAGAATGGGAGAGAAGATGG - Intergenic
990125762 5:52516097-52516119 CCATGTAGACGGAGAGTAGAAGG + Intergenic
990264888 5:54064325-54064347 ACTTACAGGGGGAGTGCAGAGGG - Intronic
991238416 5:64426795-64426817 TCATAGAGACAGAGAGCAGAAGG + Intergenic
992212039 5:74489982-74490004 CCATAGAGAGGAAGGGCAAATGG - Intergenic
992644800 5:78802005-78802027 ACATACACAGTGAGAGCAGTGGG - Intronic
993440380 5:87949872-87949894 CCAGACTGGGGGAGGGCAGAGGG - Intergenic
993849645 5:92990893-92990915 CCATTGAGAGGGAGAACAGAGGG - Intergenic
995013841 5:107288165-107288187 CCATCCAGAGGCAGAGCTGAGGG - Intergenic
995094890 5:108224486-108224508 ACACACAGAGGGAGGGGAGAAGG - Intronic
997202254 5:132018052-132018074 CAGTACAGAGGGAGAGAAGAGGG + Intergenic
997226047 5:132210278-132210300 CCTTACCAAGGGAGAGCAGGCGG + Exonic
997427774 5:133816001-133816023 CAATACAGAGGAAGACAAGAAGG + Intergenic
997505196 5:134411647-134411669 CCATGGAGAGGGAGAGCAGCTGG + Exonic
1000234833 5:159347750-159347772 TGATGCAGAGGGAGAGAAGATGG - Intergenic
1000684084 5:164225058-164225080 CCATACAGAGGAAGACCAAAGGG + Intergenic
1001034769 5:168290005-168290027 CCAAACAGAGGAAGTGTAGAGGG + Intergenic
1001598435 5:172913604-172913626 CCATACAGAGGAAGAACAGCTGG - Intronic
1002057003 5:176603899-176603921 CCAGACTGAGGGAGACAAGAGGG + Intronic
1003247857 6:4399537-4399559 CCAAACAGAAGGTGAGCAGGAGG - Intergenic
1004658148 6:17684821-17684843 CCAGAAAGAGGGAGAAAAGAGGG + Intronic
1010011392 6:71051637-71051659 CCACAGTGAGGGAGATCAGAAGG + Intergenic
1010921207 6:81682954-81682976 AAAGACAGAGGGAGAGAAGAAGG + Intronic
1011385472 6:86792974-86792996 TCATAGAGATGGAGAGTAGAAGG - Intergenic
1011626096 6:89285130-89285152 CCTCACAGAGGCAGGGCAGAAGG - Intronic
1015490645 6:133821577-133821599 CCAGACAGAGGGAGAAAAGAAGG + Intergenic
1015631249 6:135234046-135234068 CAATCCAGAGGCAGAGCAGATGG - Intergenic
1016188072 6:141222294-141222316 GCAGACAGAGAGAGAGCACAGGG + Intergenic
1016644886 6:146395300-146395322 ACCTACAGAGGGAGAGAATATGG + Intronic
1017591006 6:155977994-155978016 CCAGAAAGAGGGTGAGCAGAGGG - Intergenic
1017845562 6:158255137-158255159 CCATGCAGAGGGAGGCCACAGGG - Intronic
1017847301 6:158270429-158270451 CCCTACACAGTGAGAGAAGATGG - Intronic
1018392502 6:163351136-163351158 ACAGACAGAGGGAGTGCAGCAGG + Intergenic
1018536204 6:164822741-164822763 CCACAGAGATGGAGAGTAGAAGG + Intergenic
1019303336 7:320558-320580 CCACAGGGAGGGAGAGCAGATGG + Intergenic
1020118984 7:5492230-5492252 CCATGCAGACAGAAAGCAGAAGG + Intronic
1020960568 7:14797758-14797780 CCAAACAATGGGAGAGAAGAAGG - Intronic
1021132226 7:16924861-16924883 CCATACAGAGAGAAAGCAATTGG - Intergenic
1022577709 7:31514299-31514321 CAATCTAGAGGGAGAGAAGAAGG - Intronic
1022580260 7:31545880-31545902 GGATAGGGAGGGAGAGCAGAAGG + Intronic
1023267303 7:38420655-38420677 CAATACAGAGGAAGAGGAGATGG + Intronic
1023360910 7:39414433-39414455 CCAGGCAGAGGGAGAGTGGAGGG + Intronic
1023845025 7:44115730-44115752 CCATACAGGGTGGGAGCAGAGGG - Intronic
1024242782 7:47448229-47448251 GCATGCAGAGGGGGAGCACAGGG + Intronic
1024613364 7:51085715-51085737 TCACACAGAGGAAGAGCTGATGG + Intronic
1024619721 7:51147036-51147058 CCCTGCATAGGGACAGCAGAAGG + Intronic
1026098529 7:67365925-67365947 TCATACAGACAGAAAGCAGAAGG - Intergenic
1026117768 7:67510646-67510668 CCGTACATAGCCAGAGCAGAAGG - Intergenic
1026256119 7:68713363-68713385 CCATAGAGAGGGAGAGAGGCCGG + Intergenic
1026536167 7:71240421-71240443 CCAAATAGAGGGAGACAAGAAGG - Intronic
1027409102 7:77894800-77894822 TCAGACAGATGAAGAGCAGATGG + Intronic
1027909518 7:84231427-84231449 CCATCCAGTGGAAGATCAGAAGG + Intronic
1028603533 7:92629416-92629438 AGAAAGAGAGGGAGAGCAGAGGG + Intronic
1028660938 7:93274064-93274086 CCAAAAAGAGGGAGAGAAGGGGG - Intronic
1029101456 7:98134046-98134068 CCACATAGAGGCAGAGCAGTGGG + Intronic
1029488773 7:100859029-100859051 CCCTGGAGAGGGGGAGCAGAGGG - Exonic
1029572178 7:101377333-101377355 CCAGACAGTGTGAGAGCAGAAGG + Intronic
1032552763 7:132800770-132800792 CCAGAGAGAGGGAGAAGAGAGGG + Intronic
1034908410 7:154971544-154971566 CCAGCCAGAGGCAGATCAGATGG - Intronic
1035925026 8:3718933-3718955 CCAAACAGAGGGAGAATAGAAGG + Intronic
1038488503 8:27953077-27953099 CAATCCAGACGGAAAGCAGATGG + Intronic
1041110440 8:54477966-54477988 CCTTAGAGAGGGAGGGGAGAAGG - Intergenic
1042450622 8:68940966-68940988 CTTTAAAGTGGGAGAGCAGAGGG + Intergenic
1043170184 8:76956249-76956271 GAATACAGAGGTGGAGCAGAAGG + Intergenic
1043528403 8:81122149-81122171 CCATCCAGAGGTAGAACAGAAGG - Intergenic
1043865030 8:85364985-85365007 GCCCACAGAGGGAGAGCAGAGGG - Intronic
1044899901 8:96933324-96933346 CCACACAGAGGAAGAACAAATGG - Intronic
1048529049 8:135230940-135230962 CAATAAAGAGGGAGATAAGAGGG - Intergenic
1048718738 8:137298526-137298548 CCACACAGGGAGTGAGCAGAGGG - Intergenic
1049202401 8:141346734-141346756 CCTTGCAGATGGAGTGCAGATGG - Intergenic
1049421687 8:142519422-142519444 CCACCCAGCTGGAGAGCAGAGGG - Intronic
1050160859 9:2717744-2717766 TCAAACAGAGTGAGAGGAGACGG + Exonic
1050293392 9:4180180-4180202 CCATGCACAAGGAGAGGAGATGG + Intronic
1050392761 9:5163579-5163601 TCATACAGATGGAAAGCAGAAGG + Intronic
1051094693 9:13453068-13453090 CCACACTGAGGTAGAGAAGAAGG + Intergenic
1053480873 9:38415376-38415398 CAATACAAAAGGAGAGCAAAGGG + Intronic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1055759318 9:79589859-79589881 CCCTAAAGAGAAAGAGCAGAAGG - Intronic
1056607902 9:88102203-88102225 GCATAGAGAGGGAGGGCAAAGGG + Intergenic
1056699280 9:88888862-88888884 CCATGCAGAGGGAAAGCACTGGG - Intergenic
1057350396 9:94292451-94292473 CCTTACCCAGGGAGACCAGATGG - Exonic
1059591877 9:115670667-115670689 GCATACAAAAGGAGAGTAGATGG - Intergenic
1060327314 9:122629670-122629692 CCTTAGGGAGGGAGAGTAGATGG - Intergenic
1061481445 9:130899298-130899320 CCAGACAGAGGCCGAGCACAGGG + Intergenic
1185513111 X:677737-677759 CCCTGCAGAGGGAACGCAGATGG - Intergenic
1186575955 X:10766171-10766193 CAAGACAGAGGCAGAGCCGATGG - Intronic
1186761260 X:12724793-12724815 TCATACAGTGGGAGAGGAGGTGG - Intergenic
1187470694 X:19566932-19566954 CCAAACAGAGGGACAGCAGCAGG + Intronic
1188372742 X:29388733-29388755 CCATAGAGACAGAAAGCAGATGG + Intronic
1188865625 X:35310083-35310105 GCATACAGATAGAGAGTAGAAGG + Intergenic
1189854922 X:45214487-45214509 CCAAACAGACGGAAGGCAGAAGG + Intergenic
1189908198 X:45783353-45783375 CCACTCATAGGGAGAGCAGCAGG + Intergenic
1192068366 X:67910847-67910869 CCCTCCAGAGGAAGAGCAGCAGG + Intergenic
1192590167 X:72352938-72352960 CTCTCCAGAGGGAGAGCATATGG + Intronic
1193707275 X:84837128-84837150 CCATGGAGATAGAGAGCAGAAGG + Intergenic
1193713332 X:84905087-84905109 CCAGAGAGAGGGAGAGAAAATGG + Intergenic
1194815383 X:98434480-98434502 AAATACTGAGGGAGAGCATAAGG - Intergenic
1196407699 X:115382397-115382419 CCATAGAGATAGAGAGTAGAAGG + Intergenic
1197756455 X:129998718-129998740 CCAGCCAGAGGGAAAGCAAAGGG - Intronic
1198322780 X:135535686-135535708 CCAAACTTATGGAGAGCAGATGG + Intronic
1198734105 X:139767391-139767413 ATATATAGAGGGAGAGGAGAAGG + Intronic
1198956330 X:142135740-142135762 CTTAACAGAGGGAGAGCACAGGG + Intergenic
1199333252 X:146586582-146586604 CCCTACATGGGGAGAGCAGGGGG - Intergenic
1200367964 X:155687886-155687908 GGATACAGAGGGAGAGCATTAGG + Intergenic
1202196926 Y:22306670-22306692 CCAGACAGAGGCAGAGGAGCGGG - Intergenic