ID: 1089732343

View in Genome Browser
Species Human (GRCh38)
Location 11:120527154-120527176
Sequence GGGTTGCCCTGATCCCGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 89}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089732331_1089732343 21 Left 1089732331 11:120527110-120527132 CCAGCACCCAGTCCTGGGGAACC 0: 1
1: 0
2: 4
3: 37
4: 375
Right 1089732343 11:120527154-120527176 GGGTTGCCCTGATCCCGCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 89
1089732335_1089732343 14 Left 1089732335 11:120527117-120527139 CCAGTCCTGGGGAACCTGGAGGA 0: 1
1: 0
2: 4
3: 42
4: 295
Right 1089732343 11:120527154-120527176 GGGTTGCCCTGATCCCGCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 89
1089732339_1089732343 0 Left 1089732339 11:120527131-120527153 CCTGGAGGATGCAAAGGCAGGTG 0: 1
1: 0
2: 1
3: 28
4: 363
Right 1089732343 11:120527154-120527176 GGGTTGCCCTGATCCCGCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 89
1089732333_1089732343 15 Left 1089732333 11:120527116-120527138 CCCAGTCCTGGGGAACCTGGAGG 0: 1
1: 0
2: 3
3: 24
4: 336
Right 1089732343 11:120527154-120527176 GGGTTGCCCTGATCCCGCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 89
1089732336_1089732343 9 Left 1089732336 11:120527122-120527144 CCTGGGGAACCTGGAGGATGCAA 0: 1
1: 0
2: 0
3: 19
4: 242
Right 1089732343 11:120527154-120527176 GGGTTGCCCTGATCCCGCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 89
1089732327_1089732343 27 Left 1089732327 11:120527104-120527126 CCAGAGCCAGCACCCAGTCCTGG 0: 1
1: 0
2: 1
3: 33
4: 395
Right 1089732343 11:120527154-120527176 GGGTTGCCCTGATCCCGCCTCGG 0: 1
1: 0
2: 0
3: 3
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089732343 Original CRISPR GGGTTGCCCTGATCCCGCCT CGG Intronic
900148657 1:1168896-1168918 CAGCTGCCCTGATCCCTCCTGGG - Intergenic
906681009 1:47725402-47725424 TGGTGGCCCAGATCCAGCCTTGG - Intergenic
910232244 1:84998230-84998252 GAGTTGCCCTGCGCCCGCGTCGG + Intergenic
916065615 1:161133162-161133184 GTGGTGCCCAGATCCCGTCTCGG + Intergenic
919283050 1:195517493-195517515 GGGTTGCCCAGATCCCAAGTGGG - Intergenic
1066759561 10:38739229-38739251 GCCCTGCCCTGATCCCACCTTGG + Intergenic
1070087631 10:73252370-73252392 GGGTTGCCTCCATCGCGCCTGGG + Intronic
1078222704 11:9364674-9364696 GGGTCTCCCGGATCCCGCCCGGG + Intergenic
1082738629 11:56885285-56885307 GGCTAGCCCTGATCCTGCCATGG - Intergenic
1084192553 11:67505438-67505460 GGGCTGCCCGGACCCCGCCGGGG - Intronic
1084450695 11:69234880-69234902 GGCTTGCACTGCTCCCGCCATGG - Intergenic
1084953387 11:72678875-72678897 GGGTTGGCCTGAACACCCCTGGG + Intergenic
1089732343 11:120527154-120527176 GGGTTGCCCTGATCCCGCCTCGG + Intronic
1090046218 11:123336237-123336259 GGGTTTACCTGATCCGGGCTGGG - Intergenic
1102635887 12:114323565-114323587 TGATTGCCCAGATCCCACCTTGG + Intergenic
1104915884 12:132264293-132264315 CTGTTGCCCTGATCGCTCCTGGG - Intronic
1105458831 13:20565738-20565760 GGGTTGGCCTCATCCCGTCAAGG - Intergenic
1117063292 14:51984218-51984240 GATTTGCCCTGATCCTGCCATGG - Intergenic
1121788013 14:96677405-96677427 CCATTGCCCTGATCCAGCCTGGG - Intergenic
1122117606 14:99535596-99535618 GGGTTCCCCTCCTCCCTCCTGGG - Intronic
1202930298 14_KI270725v1_random:28816-28838 GGCCTGCTCTGACCCCGCCTTGG + Intergenic
1125847953 15:42875546-42875568 GGATTGCCCTTAACCAGCCTGGG + Intronic
1126112967 15:45186550-45186572 GGGTTGGCCTTATCCCTCCCTGG - Intronic
1127415159 15:58750023-58750045 GGTTTGTCCTGGTCCCGCCCCGG + Intergenic
1134808382 16:17145340-17145362 GGGATGCTCTGATCCATCCTGGG - Intronic
1135789183 16:25377665-25377687 GGGTTTCGCTGATCCAGGCTGGG - Intergenic
1136723241 16:32340008-32340030 GCCCTGCCCTGACCCCGCCTTGG - Intergenic
1136773713 16:32860397-32860419 GCCCTGCCCTGACCCCGCCTTGG + Intergenic
1136841562 16:33546012-33546034 GCCCTGCCCTGACCCCGCCTTGG - Intergenic
1136862749 16:33712980-33713002 GCCCTGCCCTGAGCCCGCCTTGG + Intergenic
1136896899 16:34001122-34001144 GCCCTGCCCTGACCCCGCCTTGG - Intergenic
1140212697 16:72983377-72983399 GGGTTGCCCTCATTCCAGCTGGG - Intronic
1141987444 16:87589112-87589134 GGGTGGCTCTGATCCTCCCTGGG + Intergenic
1142149994 16:88508510-88508532 GGGTTCCCCTGGTCTCTCCTGGG + Intronic
1203003191 16_KI270728v1_random:177757-177779 GCCCTGCCCTGACCCCGCCTTGG + Intergenic
1203076131 16_KI270728v1_random:1122508-1122530 GCCCTGCCCTGACCCCGCCTTGG + Intergenic
1203134797 16_KI270728v1_random:1714163-1714185 GCCCTGCCCTGACCCCGCCTTGG + Intergenic
1143765229 17:9133361-9133383 GGGCTGCCCAGATCCTTCCTCGG - Intronic
1145799130 17:27672138-27672160 GGGGAGGCCTGATCCAGCCTCGG - Intergenic
1146973411 17:37091260-37091282 GCGTTGCCCTAATCCTGTCTGGG - Intronic
1147218330 17:38913663-38913685 GGGCTGCTCTGTTTCCGCCTGGG - Intronic
1157579450 18:48764918-48764940 GGGCTGCCCTGATCCCACAATGG + Intronic
1160252683 18:77217193-77217215 GTGTTGCACTGTTCCCGCGTGGG + Intergenic
1162370884 19:10278603-10278625 AGGTTGCAGTGATCCAGCCTGGG - Intronic
1162908964 19:13839496-13839518 GGGGTGTCCTGATGCAGCCTGGG - Intergenic
1165896609 19:39145430-39145452 GGGGTGCCCTGACCCCCGCTGGG - Intronic
925907169 2:8546338-8546360 GGTTTGCACTGAGCCCACCTTGG + Intergenic
928364430 2:30690397-30690419 GGCCTGCCCTGCTCCCTCCTAGG - Intergenic
932568674 2:72925079-72925101 GGGTTGCTCTGATCCGGCCCAGG + Intronic
938616412 2:133003894-133003916 GGCTTGCACTGATCCTGCTTGGG + Intronic
946477573 2:220023408-220023430 GGGTTGCCCTGGGCTAGCCTAGG + Intergenic
948556198 2:238813184-238813206 GGGTGGGGCTGATCCCACCTAGG + Intergenic
1172441610 20:34970308-34970330 GGGTTTCCCTCCTCCTGCCTTGG - Intergenic
1173471944 20:43330681-43330703 TGGTGGGCCTGATCCCCCCTGGG - Intergenic
1175210352 20:57350426-57350448 GGGGTACCCTGAGCCCACCTCGG - Intergenic
1176307004 21:5128818-5128840 GGGTAGTCCTGACCCCGCGTGGG - Intergenic
1176592310 21:8657398-8657420 GGCCTGCTCTGACCCCGCCTTGG + Intergenic
1179850055 21:44133212-44133234 GGGTAGTCCTGACCCCGCGTGGG + Intergenic
1179939104 21:44626868-44626890 GGGTGGGCCTGATCCCAGCTGGG - Intronic
1180275161 22:10634527-10634549 GGCCTGCTCTGACCCCGCCTTGG + Intergenic
1180708675 22:17825115-17825137 GGGTTAGCCTGATCCCGCCCTGG + Intronic
1181355048 22:22292350-22292372 GCCCTGCCCTGACCCCGCCTTGG - Intergenic
1184859644 22:47165791-47165813 GGGAGGCCCTGATGCCACCTGGG - Intronic
952863389 3:37833472-37833494 GGGAGGCCCTGATCCCTCCCTGG - Intergenic
954389394 3:50260791-50260813 GGATTGCCCTGGTGCCGTCTTGG + Intergenic
962309088 3:134313110-134313132 GGGTTCCCCGCACCCCGCCTGGG - Intergenic
968627504 4:1633727-1633749 GGGCTGCTCTGATCCCCTCTCGG - Intronic
985512054 5:318581-318603 GGGCAGCCCTGGTCACGCCTGGG - Intronic
1001149832 5:169217549-169217571 TAGTGGCCCTGATCCAGCCTGGG + Intronic
1001287828 5:170436507-170436529 GGGTTTCCGTGTTCCCTCCTGGG - Intronic
1002098761 5:176847085-176847107 TGGGTGCCCCGCTCCCGCCTGGG + Intronic
1004537841 6:16519972-16519994 GGGCTGCCCTCATCCTGCCCAGG + Intronic
1018088165 6:160322928-160322950 CTGTTGCCCTGGTCCCTCCTTGG + Intergenic
1018705458 6:166460701-166460723 GGGTTTCCTTAATCCTGCCTAGG + Intronic
1019341315 7:510360-510382 GGGTTGCCAGGGTCCCTCCTGGG - Intronic
1023421735 7:39987382-39987404 GGATTGCCCTGATCTCGCTCTGG - Intronic
1025792359 7:64701324-64701346 GGGTTGCAGTGAGCCAGCCTGGG - Intronic
1027252845 7:76409863-76409885 AGGTAGCCCTGATCCAGCCCAGG + Intronic
1029514234 7:101015990-101016012 GGGTGGACCTGACCCAGCCTGGG + Intronic
1029943141 7:104501680-104501702 TGGTTGACCTGATACAGCCTGGG + Intronic
1032785726 7:135197965-135197987 GGGTTGTCCTGAACACCCCTGGG - Intronic
1036767741 8:11559637-11559659 GGGTTGGCCAGATCTGGCCTTGG - Intronic
1037787569 8:21911866-21911888 GGGCTGCCCTGCTCTCCCCTGGG - Intronic
1037892297 8:22629744-22629766 GGGGTACCCTGAGCTCGCCTGGG + Intronic
1047247876 8:123160527-123160549 GGGCTGGGCTGATCCTGCCTTGG + Intergenic
1048709161 8:137188357-137188379 GAGTGGCACTGATCCCACCTGGG - Intergenic
1049311488 8:141936066-141936088 GGGCTGCCCTGGTCCCTCCTGGG + Intergenic
1049767676 8:144362507-144362529 GGGTGGTCCTGAGCCCCCCTGGG - Intergenic
1062044538 9:134418934-134418956 GGGTGGCCCTGACCCAGCCACGG - Intronic
1203622364 Un_KI270749v1:136245-136267 GGCCTGCTCTGACCCCGCCTTGG + Intergenic
1190715198 X:53097067-53097089 GGGTTGCAGTGAGCCAGCCTGGG + Intergenic
1198416902 X:136429564-136429586 GGGGTGCTCTGATCCCTTCTTGG - Intergenic
1201191138 Y:11441968-11441990 TGCTGGCCCTGATCCTGCCTTGG + Intergenic