ID: 1089733691

View in Genome Browser
Species Human (GRCh38)
Location 11:120535264-120535286
Sequence TCCTGGGACCAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 0, 2: 7, 3: 48, 4: 476}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089733681_1089733691 8 Left 1089733681 11:120535233-120535255 CCTGAGGAGGTGGGGGATCCAGG 0: 1
1: 0
2: 2
3: 49
4: 471
Right 1089733691 11:120535264-120535286 TCCTGGGACCAGAGGGAAGAGGG 0: 1
1: 0
2: 7
3: 48
4: 476
1089733686_1089733691 -10 Left 1089733686 11:120535251-120535273 CCAGGGAAGAACCTCCTGGGACC 0: 1
1: 0
2: 1
3: 15
4: 192
Right 1089733691 11:120535264-120535286 TCCTGGGACCAGAGGGAAGAGGG 0: 1
1: 0
2: 7
3: 48
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089733691 Original CRISPR TCCTGGGACCAGAGGGAAGA GGG Intronic
900430318 1:2598299-2598321 TCCTGGGGGCAGAAGGTAGAGGG + Exonic
900568609 1:3347472-3347494 GCCTGGGACCAGACGCAGGAGGG - Intronic
900983559 1:6060148-6060170 TCCTGAGAGCAGAGGCAGGAGGG - Intronic
901067591 1:6501819-6501841 GCCTGGGACCAGTGGGGAAAGGG - Intronic
901924201 1:12555556-12555578 TTCTGGGCCCACAGTGAAGAGGG + Intergenic
902127132 1:14224262-14224284 GCCTGGAACCAGTGGGAAGAAGG + Intergenic
902599299 1:17530282-17530304 TTCTGGAACCAGAGAGAAGAGGG + Intergenic
902801079 1:18830655-18830677 TCGTCGGCCCAGGGGGAAGAAGG + Intergenic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
903484278 1:23677942-23677964 TCCTGGACCCAGAAGGAGGAAGG - Intergenic
903667532 1:25017114-25017136 TCCTGGGGGCACAGGGATGAAGG + Intergenic
903747517 1:25598059-25598081 TGCTGGGATCCGAAGGAAGAGGG + Intergenic
903758795 1:25683619-25683641 AGCTGGGACCTGAAGGAAGATGG + Intronic
903893129 1:26583469-26583491 TCCTGGGAGGAGAGGGTACAGGG + Intergenic
904345519 1:29866315-29866337 TTCTGGGAGCAGAGGGGAGAGGG - Intergenic
905028222 1:34865591-34865613 CCCTGGGCCCAGTGGGCAGAGGG + Exonic
905264409 1:36741067-36741089 GCCAGGGGCTAGAGGGAAGAGGG - Intergenic
905328808 1:37177442-37177464 GCCTGGCACCAGAGGGCAGCAGG - Intergenic
905363621 1:37436766-37436788 TCCTGGGAACACAAGGGAGAAGG + Intergenic
905780567 1:40705392-40705414 TCCTGGGAAGAGAAGGCAGAAGG - Intronic
906191793 1:43903655-43903677 CCCTGGGAGGAGAGGGAGGAGGG + Intronic
906551369 1:46668582-46668604 TGCTGGTCCCAGAGGGAGGAAGG - Intronic
907071003 1:51534826-51534848 CCCTGGGTCCAGAGGAGAGAAGG - Intergenic
907117044 1:51978100-51978122 TTCTGGGAGCACAGGGAAGCTGG - Intronic
907587562 1:55634724-55634746 GCCTGGGATCAGAGCCAAGAAGG - Intergenic
907604697 1:55804997-55805019 TCCTGGGGCCAGAAGTAGGAGGG - Intergenic
908062449 1:60366764-60366786 TTCTGGGAGAGGAGGGAAGAGGG + Intergenic
908485169 1:64584556-64584578 TCCAGGGACAAAAGGGAATAAGG - Intronic
909957665 1:81800567-81800589 TCCTGGGCCTAGAGGGGAGGGGG + Intronic
910328966 1:86046842-86046864 TCCTGGGATCCGTGGAAAGAAGG - Exonic
911829796 1:102536386-102536408 TCATGAGAACAGAGGGAAGGGGG + Intergenic
912201759 1:107465704-107465726 TCCAGGGACCAGGGAGAACATGG + Intronic
912203842 1:107488876-107488898 TCCTGGGGCCAGTGTGAAGATGG - Intergenic
912501756 1:110127246-110127268 TCCTGGCACCAGCAGGAAGTGGG + Intergenic
912730151 1:112095045-112095067 TCATGGGGCCAGATAGAAGAGGG + Intergenic
912802408 1:112728398-112728420 TCATGGCAGGAGAGGGAAGAGGG - Intergenic
913128669 1:115816919-115816941 ACCTGTGGCCAGAGGGAAGCAGG + Intergenic
913229622 1:116730877-116730899 GCCTGGGGCAAGAAGGAAGAAGG + Intergenic
914247529 1:145897164-145897186 TCCTGGGACTTCAGGGAAGGGGG - Intronic
914374400 1:147061039-147061061 ACCTGGGACCAAGGGTAAGAAGG + Intergenic
915351954 1:155232513-155232535 TCCTGGGCCCATTGAGAAGAAGG - Intergenic
915895854 1:159810073-159810095 ACCTGGGAGCAGGGAGAAGAAGG - Exonic
918093002 1:181313696-181313718 TCCTGGGAGCAGACGGAGGCTGG - Intergenic
918114252 1:181483388-181483410 TTCAGGGACCAGAGAGGAGAGGG - Intronic
919143965 1:193609558-193609580 TCCTGGTTCCAGCAGGAAGAAGG - Intergenic
919264679 1:195247246-195247268 TCCTGGGAGCTTAGGCAAGATGG + Intergenic
920191947 1:204199257-204199279 CCCTAGGAGCAGAGGGGAGAAGG + Exonic
920635077 1:207694453-207694475 TCTTGGAAGCAGAGGGAAAAAGG + Exonic
920914956 1:210251962-210251984 TCCTGGGGCGGAAGGGAAGAGGG - Intergenic
921280715 1:213564427-213564449 GCCTGGGAAAAGAAGGAAGAGGG + Intergenic
921480319 1:215657674-215657696 TTCTGGGACCCAGGGGAAGAGGG + Intronic
921797739 1:219367029-219367051 TCCTGGGGCAAGTGGGAAAAGGG - Intergenic
921980808 1:221256818-221256840 TTGTGGAGCCAGAGGGAAGAGGG + Intergenic
922729289 1:227941616-227941638 CCCTGGGAGCACAGGGGAGATGG + Intronic
922878532 1:228960825-228960847 GCCTCTGACCAGAGGGGAGAGGG + Intergenic
923408058 1:233682484-233682506 TCCTGGGACCACGCAGAAGATGG + Intergenic
924517843 1:244781072-244781094 TCCTGGAAACCGAGAGAAGAAGG - Intergenic
924800079 1:247322962-247322984 GGCTGGGACCACAGGGAAGGAGG + Intronic
1063496495 10:6514072-6514094 TGCTGGGACCAGAGCATAGAGGG - Intronic
1064137571 10:12764028-12764050 TCCTGGGGGAGGAGGGAAGACGG - Intronic
1065627033 10:27640308-27640330 TCCTGGAAGCACAGTGAAGAAGG + Intergenic
1066088850 10:31997696-31997718 TCCTCAGGCCAGCGGGAAGATGG - Intergenic
1066438037 10:35412181-35412203 TCCTGTGACTAGGGGGCAGAGGG + Intronic
1066501164 10:35996207-35996229 TCCGAGAACCAGAGGGATGATGG + Intergenic
1067655809 10:48190356-48190378 TCCTTTGACCAAAGGGAAGTAGG + Intronic
1067782444 10:49218653-49218675 TCCTGGGACCACAGAGAGGAGGG - Intergenic
1067945117 10:50684357-50684379 ACCTGGAAACAGAAGGAAGAAGG - Intergenic
1068529267 10:58166352-58166374 GCCAGGGACAGGAGGGAAGAGGG - Intergenic
1068938880 10:62661623-62661645 TCCTGGGGACTCAGGGAAGAGGG + Intronic
1069077526 10:64053374-64053396 GCATGGGACAAGGGGGAAGAAGG + Intergenic
1069533038 10:69232929-69232951 TCCTGTGACCGCAGGGAAGGCGG + Intronic
1069618830 10:69823795-69823817 TTCTGGGCCCAGAGGGAGGGAGG - Intronic
1070566940 10:77610719-77610741 GACTGGGAGCAGAGGGAATAGGG + Intronic
1070703609 10:78621186-78621208 TTCTGTTACCAGTGGGAAGATGG - Intergenic
1070748544 10:78950052-78950074 TCCTGTGACCAGAGCAGAGAAGG + Intergenic
1070866622 10:79711229-79711251 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1070880411 10:79849350-79849372 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1071234960 10:83634478-83634500 TCCTGGTATCAGAGAGACGAGGG - Intergenic
1071471635 10:85987659-85987681 GCCAAGGACCAGAGGGACGAAGG - Intronic
1071633534 10:87233452-87233474 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1071646981 10:87365668-87365690 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1072252420 10:93591959-93591981 TTATGGGAACTGAGGGAAGATGG + Exonic
1073067772 10:100773922-100773944 TCCTGGGAGCTGGGGGAAGCAGG - Intronic
1073150994 10:101311333-101311355 TCCTGGTACCTAAGGAAAGAGGG - Intergenic
1073995660 10:109313196-109313218 TCTTAGTTCCAGAGGGAAGAAGG - Intergenic
1075280758 10:121136256-121136278 TCCTTGGACAAGAGAAAAGAAGG - Intergenic
1075871020 10:125772967-125772989 GCCTGGGAGCAGAGGGGAGCGGG + Intronic
1076740068 10:132478525-132478547 CCCCGGGCCCAGAGGGCAGAGGG - Intergenic
1077147785 11:1053639-1053661 GCCTGGGCCCAGAGGGGAGTTGG + Intergenic
1077409549 11:2397113-2397135 CCCTGGGACCCCAGGGCAGAAGG - Exonic
1078480200 11:11668790-11668812 CTCTGGGACCATGGGGAAGATGG + Intergenic
1078722511 11:13897672-13897694 TTCTGGGCCCAAAGGGAGGAGGG - Intergenic
1080740724 11:35062186-35062208 TCCTGGGATCAGAGGGTGGGGGG + Intergenic
1080820405 11:35800585-35800607 TCCTGGGTCGAGTGGGAAGTTGG - Intronic
1081660154 11:44883125-44883147 TCTTGGGAGCAGAGGGAAGGTGG - Intronic
1081747413 11:45482807-45482829 TCATTGGACCAGGGTGAAGAAGG + Intergenic
1081854467 11:46295105-46295127 GCCAGGGACCTGAGGGAAGAGGG + Intronic
1083238649 11:61369280-61369302 TACTTGACCCAGAGGGAAGATGG + Exonic
1083259269 11:61514419-61514441 TGCTGGGAGCAGAGGGCGGATGG + Intergenic
1083332865 11:61907101-61907123 GGCTGGGAGGAGAGGGAAGAAGG + Intronic
1083698321 11:64457370-64457392 TCCTGGTCCCTGAGGGAACATGG + Intergenic
1083844274 11:65321804-65321826 CCCAGGGACCTGAAGGAAGAAGG - Exonic
1084547196 11:69820350-69820372 TCCTGGGGCCAGCAGGAAGCAGG + Intergenic
1084581881 11:70029268-70029290 GCCTGTGTGCAGAGGGAAGAGGG - Intergenic
1084668622 11:70592210-70592232 CCCTGCGTGCAGAGGGAAGACGG - Intronic
1085701816 11:78752380-78752402 TGCTGGGACCAGAGGAGGGAGGG - Intronic
1085969741 11:81573477-81573499 TACTGGGGCCAGAGGGAAGATGG + Intergenic
1086448528 11:86892780-86892802 TCCTGGAATCAGAGTGAAAAAGG + Intronic
1087788658 11:102384340-102384362 TCCTGAGATGAGAAGGAAGAGGG + Intergenic
1088200396 11:107326557-107326579 TCCTTGGTTCAGAGGGAAGTGGG - Exonic
1088853914 11:113729096-113729118 TCCTGGGAGCAGAGGCAAGCGGG + Intergenic
1088907832 11:114168255-114168277 TCCTGGGGCTGGAGGGAAGCAGG - Intronic
1089095730 11:115918471-115918493 TCCTGGTACCTGAGGGAAGCAGG - Intergenic
1089581678 11:119485297-119485319 TCCTGGGAGCAGAGGCAAGACGG - Intergenic
1089733691 11:120535264-120535286 TCCTGGGACCAGAGGGAAGAGGG + Intronic
1089800706 11:121024462-121024484 CCCTGGGGCTAGAGGGAGGATGG + Intronic
1090136962 11:124209232-124209254 TCCTGAGACCAGAAAGAATAAGG + Intergenic
1090188129 11:124751586-124751608 GCCGGGGACCAGAGGGAGGTGGG + Intronic
1091703928 12:2681079-2681101 TCATGAGGCCAGAGGGGAGAAGG - Intronic
1091710607 12:2737555-2737577 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1091713453 12:2759617-2759639 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1091832077 12:3557092-3557114 TCCTGGAATGAGAGGGAAGGAGG + Intronic
1093458086 12:19384141-19384163 TCCTAGGCCCAAAGGGAAGAGGG + Intergenic
1094284881 12:28781836-28781858 TCCTGGCACCAGAGAGATGAAGG + Intergenic
1095734050 12:45536856-45536878 TAATGGCACCAGAGGGAAAATGG - Intergenic
1096622993 12:52876011-52876033 TCTTAGGCCCAGAGGGCAGAGGG - Intergenic
1096820815 12:54232617-54232639 ACTTGGGAGCAGAGGGAAGTTGG + Exonic
1096843050 12:54390800-54390822 TCCTGGGCCCAGAAGGATGTCGG + Intronic
1098527760 12:71505896-71505918 TCCTGAGACAAAAGAGAAGATGG - Intronic
1100715513 12:97301418-97301440 TCTTGGAATCAGAGGTAAGATGG + Intergenic
1101534149 12:105602071-105602093 TCCTGGGAGCAGCTGGAAGTGGG - Intergenic
1101838617 12:108312133-108312155 TCCTCAGGCCAGGGGGAAGATGG - Intronic
1101846920 12:108370123-108370145 TCCTGGGAGCAAAGGGCAAATGG + Intergenic
1101875630 12:108595140-108595162 TCCTGGGATCAGACAGAGGAAGG - Intronic
1102232732 12:111274743-111274765 GCCTGGGCCCAGATGGGAGAAGG + Intronic
1104088123 12:125493972-125493994 TCCAGGGAGAAGAGGGAGGAGGG - Intronic
1104088208 12:125494246-125494268 TCCAGGGAGGAGGGGGAAGAGGG - Intronic
1104088311 12:125494543-125494565 TCCAGGGAGGAGAGGGAGGAGGG - Intronic
1104088390 12:125494785-125494807 TCCAGGGAGGAGGGGGAAGAGGG - Intronic
1104088466 12:125494998-125495020 TCCAGGGAGGAGAGGGAGGAGGG - Intronic
1104779939 12:131413584-131413606 TCCGGGGACCAGAGCACAGAGGG + Intergenic
1104848716 12:131860787-131860809 ACCTGGGATGTGAGGGAAGAGGG + Intergenic
1104925439 12:132311654-132311676 TCCTGGGATCTGAGGGTGGAGGG - Intronic
1105048607 12:133027964-133027986 TCCTGCGACCAGAAAGAAGTAGG - Intergenic
1105644148 13:22298776-22298798 TGCTGGCATCAGAGGGTAGATGG + Intergenic
1106909949 13:34452942-34452964 TCCTGGGACATGAGAGAAGATGG + Intergenic
1107230432 13:38103786-38103808 TACTGGGACAAGAGCCAAGATGG + Intergenic
1112091310 13:96087136-96087158 TTCTGGCACCAAAGGGAAAATGG + Intergenic
1112232794 13:97606498-97606520 TCCTGGAAAGGGAGGGAAGAAGG - Intergenic
1112265572 13:97920352-97920374 TCGGGGGAGAAGAGGGAAGATGG - Intergenic
1112937482 13:104819502-104819524 TCCTAGGAACAGAGAGATGATGG + Intergenic
1113601919 13:111575620-111575642 TCTGGGGACCAGAGAGAAGATGG - Intergenic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1114188908 14:20426118-20426140 TTCTGGGGCCAGAATGAAGAAGG + Intergenic
1114530296 14:23391278-23391300 TCCTGGGAGCAGAGGCATGGTGG - Intronic
1114549737 14:23525883-23525905 TTCGGGCACCAGAGGGAAGGGGG + Exonic
1115019088 14:28653113-28653135 TCCTGAGGCAAGAGGGAACATGG + Intergenic
1115141643 14:30178185-30178207 TGCTGGGGCCAGAGGCAAGAGGG - Intronic
1115880889 14:37916983-37917005 TATTGGGATGAGAGGGAAGAAGG + Intronic
1117185273 14:53233776-53233798 TCCTGGAACAAGAGAGAGGAGGG + Intergenic
1118503152 14:66382275-66382297 TCCTAGGAAAAGAAGGAAGAAGG - Intergenic
1119058134 14:71444650-71444672 TCCAGGGACCAAAGGGAAAGAGG - Intronic
1122771701 14:104100598-104100620 TCCAGGGAGCAGCAGGAAGAAGG - Intronic
1123030855 14:105450421-105450443 GCCTGGGCCTAGAGGGAGGAGGG - Intronic
1124165059 15:27318885-27318907 ACCTGGGAACAGAGGAAATAAGG + Intronic
1124201429 15:27681706-27681728 TCCTGGGAACAAAAGGATGAGGG - Intergenic
1124613728 15:31226428-31226450 TCCTGGGTCCACTGGGAAGTTGG - Intergenic
1125341827 15:38683064-38683086 TCCTGGGACCAGTGAGAAGGAGG - Intergenic
1125523375 15:40360312-40360334 TCCTGAGATCAGAGGGCAGCAGG + Intronic
1126567225 15:50113066-50113088 ACCTAGGGCCAGAGGGAGGAAGG - Intronic
1126802694 15:52314320-52314342 GGCTGGGACCAGAAGGAAGGAGG + Intronic
1127613677 15:60661830-60661852 TTCTGGTCCCAGAGGGAACAGGG + Intronic
1127783932 15:62339762-62339784 ACAAGGGACCAGAGGGAAAAGGG - Intergenic
1127903354 15:63357614-63357636 CCCTGAGACCAGAGAGAAAAAGG - Intronic
1128090908 15:64918335-64918357 GCCTGGGAGCAGAGAGAAGCCGG - Intronic
1128402937 15:67303268-67303290 GCCTGGAACTAGTGGGAAGAGGG + Intronic
1129141548 15:73602703-73602725 TCCTGGGAGCAGAGGAAATGGGG + Intronic
1129171836 15:73812636-73812658 TGCAGGGACCAGAGGGCAGCTGG - Intergenic
1129542742 15:76364288-76364310 CCCTGGGACCACCGGGAAGAAGG - Intronic
1129946749 15:79545142-79545164 TCATGGGAACAGAGAGGAGAGGG + Intergenic
1131094110 15:89645327-89645349 TCCAGGGTCCAGAGGTAAGCTGG - Exonic
1131533861 15:93217410-93217432 TCCTGGGTCCTGAGGGAAGCTGG + Intergenic
1132253137 15:100349733-100349755 TCCTGCAACCAGCGTGAAGAGGG - Intergenic
1132759427 16:1501604-1501626 TCCTGAGACCAGAGGCTCGAGGG + Intronic
1133047155 16:3094867-3094889 TCCTGGGGCCAGTCGGAAAATGG + Intronic
1133180308 16:4049257-4049279 ACCTGGGACCAGAGAGAAGAGGG + Intronic
1133298874 16:4769461-4769483 TCCTGGGGCCGGAGAGAACACGG + Intergenic
1134017047 16:10895920-10895942 TCCAGGGAAGAGAGGGGAGATGG + Intronic
1134021975 16:10927604-10927626 ACCTGGGACAAGGGGGAACATGG + Exonic
1135353337 16:21749025-21749047 TCATGGGAATAGTGGGAAGAAGG + Intronic
1135435816 16:22425942-22425964 TGCAGGGACAAGAGGGAGGAAGG + Intronic
1135451824 16:22565148-22565170 TCATGGGAATAGTGGGAAGAAGG + Intergenic
1135991978 16:27223857-27223879 GCCTGGGATCAGGAGGAAGAGGG - Intergenic
1136518154 16:30780229-30780251 TCCAGGTACCAGGGTGAAGAGGG + Exonic
1137564415 16:49524459-49524481 TCCTGCGATGAGGGGGAAGATGG + Intronic
1137676033 16:50304305-50304327 TCCTGGGCCGAGAGGGGAGGAGG + Intronic
1137883698 16:52079336-52079358 TTCTGGCTCCAGAGGGAGGAAGG + Intergenic
1138276734 16:55740590-55740612 TCCTGGGATCAGAGGTGGGAGGG - Intergenic
1138286307 16:55812834-55812856 TCCTGGGACCAGAGACAGGAGGG + Intronic
1138686891 16:58733913-58733935 TGCGGGGACCAGAGGGATGTGGG + Intronic
1139348695 16:66321835-66321857 CCCTGGGACCAGAGGCCATATGG - Intergenic
1139877825 16:70160543-70160565 TCCTGGGGCCAGAGTGAAACCGG - Exonic
1140033336 16:71355478-71355500 TCCTGCGTCTAGAAGGAAGATGG - Intergenic
1140221528 16:73047887-73047909 TCCTGGGGCCAGCGGGAGGTGGG - Exonic
1140873264 16:79126241-79126263 TGCTGGAAACAGAGGTAAGAAGG + Intronic
1140905413 16:79405174-79405196 TCCTAGGACCCCAGGGGAGAAGG + Intergenic
1141094485 16:81153404-81153426 ACCTGGGAACAGAGGGAAGGAGG - Intergenic
1141292062 16:82727455-82727477 TCCTGGGTAGAGAGGGAATAAGG - Intronic
1142080488 16:88146430-88146452 ACCCGGGTCCACAGGGAAGAAGG - Intergenic
1142665560 17:1461396-1461418 TCCTGAGAGGAAAGGGAAGAAGG - Intronic
1142697386 17:1640890-1640912 TCCTGGGACCCAGGGAAAGACGG - Intronic
1143351466 17:6291207-6291229 TCCTCCCAGCAGAGGGAAGAAGG - Intergenic
1143599196 17:7932835-7932857 TCCTGGGAACAGCGTTAAGAGGG - Exonic
1143730904 17:8882161-8882183 TGCCGGGCCCAGAGTGAAGAAGG + Intronic
1143970138 17:10789481-10789503 TCCTGTGCCCAGAGAGAAGATGG + Intergenic
1144650697 17:17005104-17005126 CCCTGGGACCTGAGGGCTGAGGG - Intergenic
1144701344 17:17342883-17342905 TCCAGGAACCAGAGAGACGATGG - Intronic
1144792116 17:17866307-17866329 AGCTGGGAGGAGAGGGAAGATGG + Exonic
1146057095 17:29586963-29586985 GCCCGGGAGCAGAGGGAGGATGG + Intronic
1146548114 17:33756582-33756604 TCCTGGGTCCAGATGCTAGAAGG - Intronic
1146618857 17:34380456-34380478 TTTTGGGACAAGAGGGAAAAGGG - Intergenic
1146624032 17:34422522-34422544 TCCTGGGGACAGAGGGATGAGGG - Intergenic
1146942837 17:36855604-36855626 ACCTGGAACCAGAGAGAAGAGGG + Intergenic
1147192619 17:38746894-38746916 ACCTTGGACCAGAGTGAAGGGGG + Intronic
1147838171 17:43349991-43350013 TCCTTGGAGGAGAGGAAAGAGGG + Intergenic
1148475624 17:47926878-47926900 TCCTGGGGCTAGAGGGCTGAGGG + Intronic
1148554232 17:48568473-48568495 TCCTGGGAGCAGAGCAGAGAGGG + Intronic
1148732451 17:49845732-49845754 TCCTGGGACCAGCAGGAACCTGG + Intronic
1148891937 17:50814224-50814246 TGCTGGAGCCAGAGGGCAGAGGG + Intergenic
1149030099 17:52072855-52072877 TCCTGGGACCTAAGGAAAGCTGG - Intronic
1150950800 17:69801041-69801063 TCCTGGGCCCAGAGAGCACAGGG - Intergenic
1151232216 17:72693227-72693249 TCCTGGGACAAGAGGACAGTGGG - Intronic
1151367190 17:73625343-73625365 TCCTGGAGCCTGAGAGAAGAGGG + Intronic
1151490752 17:74431274-74431296 TCCTGGGGCCGGAGGGGAAAGGG + Exonic
1151980711 17:77506798-77506820 TGCTGGGAGCAGAAGGCAGAGGG - Intergenic
1152040021 17:77897130-77897152 TCCTGGGAGCAGGGGGGAGCTGG - Intergenic
1152329619 17:79664779-79664801 TCCAGGGACCGGGGGGAGGAGGG - Intergenic
1152484159 17:80578844-80578866 GCCTGGGAGCAGAAGGAAGCAGG + Intronic
1152546013 17:81000429-81000451 TCCTGGGCCCAGAGGGTGGTGGG + Intronic
1152640829 17:81448515-81448537 TCTGGGGCCCACAGGGAAGACGG - Intronic
1153235271 18:2980207-2980229 TCCTAGAACAAGGGGGAAGAAGG - Intronic
1153997866 18:10456813-10456835 TCCGGGGATCTGAGGGAGGAGGG + Intronic
1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156779779 18:40837578-40837600 GCCAGGGACCAGATGGAACAGGG - Intergenic
1157295299 18:46437873-46437895 ACCTGGGACCTGTGGGCAGAGGG + Intronic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1158657524 18:59352640-59352662 TCCTGGGAGTTGGGGGAAGAGGG - Intronic
1158875337 18:61728892-61728914 TCCTGGAACCACAGAGAAAAAGG - Intergenic
1158945970 18:62447245-62447267 TCCTAGAACCAGAGCTAAGATGG - Intergenic
1160410311 18:78671225-78671247 TGCTGTGATCAGAGAGAAGACGG - Intergenic
1160710337 19:548521-548543 TCCTGGGGACAGAGGGAATCAGG - Exonic
1161008257 19:1947384-1947406 TCCTGGGGACAGAGGTCAGATGG - Intronic
1161244145 19:3239834-3239856 TCCTGGGGCCAGCACGAAGAAGG - Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1162433748 19:10644427-10644449 TCCTGGCCCCAGGGGAAAGAGGG + Exonic
1163382973 19:16980758-16980780 TTCTGGGGCCAGAGGGAGGTTGG + Intronic
1164594419 19:29524582-29524604 TGCTGGGGGCAAAGGGAAGAAGG - Intergenic
1164782113 19:30901216-30901238 TCCTAGGGGCAGAGGGTAGAGGG - Intergenic
1164995829 19:32720048-32720070 TCCTGGCGCCCGAGGGCAGATGG - Intronic
1165006173 19:32809211-32809233 TCCAGGGACAGGAGGGATGAAGG - Intronic
1165454208 19:35901252-35901274 TACTGGGTCCAGAGGGAGGCAGG + Intronic
1166328487 19:42065541-42065563 TCCTGGGTCCTGGGGGAAGGAGG + Intronic
1166373645 19:42315533-42315555 TCCTGGGTCCTGGGGGAGGAGGG + Intronic
1166545883 19:43634833-43634855 TCCTGGAACCTGATGGAGGAGGG - Intronic
1166545944 19:43635063-43635085 TCCTGGGTCCTGAAGGAGGAGGG - Intronic
1166546055 19:43635483-43635505 TCCTGGGTCCTGAGGGAGGAAGG - Intronic
1166807191 19:45494488-45494510 TGCTGGGACCAAAGCCAAGAGGG - Intronic
1166809947 19:45508747-45508769 GCCTGGGTCCCTAGGGAAGAGGG - Intronic
1167253615 19:48414660-48414682 TCCTGGGTCCCAAGGGAGGAGGG - Intronic
1167328037 19:48837000-48837022 TCCTGGGTCCTGAGAGAGGAAGG - Intergenic
1167378641 19:49125831-49125853 TCCTGTGACCTGAGGGAGGCGGG + Intronic
1167478207 19:49713093-49713115 TCCTGGTTCCTGAGGAAAGAGGG - Intronic
1167724506 19:51201178-51201200 GCCTAGGACCTGAGGGACGAGGG - Intergenic
1168091616 19:54089215-54089237 TGCTGGGATTAGAGGAAAGAAGG + Intergenic
1168107591 19:54174007-54174029 TCCCGGGACCAGCTGGCAGAGGG + Exonic
1168144991 19:54415726-54415748 TCCTGGGTCCCGAGGGAGAAGGG + Intronic
1168167986 19:54566761-54566783 TCCTGGAACCAGTGTAAAGAAGG - Intergenic
925083033 2:1084591-1084613 TCCTGGAGCCAGAACGAAGAGGG - Intronic
925878261 2:8329966-8329988 TTCTGGGCACAGAAGGAAGATGG + Intergenic
926813317 2:16775749-16775771 TCCTGGGACCTCAGGGCATAGGG - Intergenic
927853078 2:26511987-26512009 TGCTGGGGCCAGAGGGCAGTGGG - Intronic
928169197 2:28992459-28992481 TCCTGGGACCAGGGGGAACCTGG + Intronic
928195785 2:29215641-29215663 TCCTTGGATCCCAGGGAAGAGGG - Intronic
928915811 2:36469167-36469189 TCTTGGCACCACTGGGAAGAGGG - Intronic
929863346 2:45697674-45697696 TCCTGGGAACAGAGGCAGGTTGG - Intronic
929891701 2:45923793-45923815 TTCTAGGAGCAGAGGGAAGGAGG + Intronic
930779211 2:55206740-55206762 TACTGGCATCAGAGGAAAGAAGG + Intronic
932190947 2:69741510-69741532 TGCTGGGCGCACAGGGAAGAGGG + Intronic
932348075 2:71008629-71008651 TCCTGAGACAAGTGGGAAGAAGG - Intergenic
932631163 2:73344644-73344666 TGGTGGGACAAGAGGCAAGAGGG - Intergenic
932861641 2:75298966-75298988 GCATGGGACAAGAGGGAGGAGGG + Intergenic
934919623 2:98332310-98332332 TGCTGGGAACAGTGGGAAGGGGG - Intronic
935332649 2:101988528-101988550 TCCTGGGCCCACGGGGCAGAAGG + Intergenic
935947455 2:108299268-108299290 TCCAGGGACGAAAGTGAAGAGGG - Intronic
936244441 2:110814312-110814334 TCCTGGGATCAGGAGTAAGAGGG + Intronic
936855527 2:116953245-116953267 TGGTGGGACCAGAAGGAAGGAGG + Intergenic
936866241 2:117078029-117078051 TCCTGGGAACAGAGAGCTGAAGG - Intergenic
936918218 2:117661585-117661607 CCTGGGGACCCGAGGGAAGAGGG + Intergenic
938976117 2:136480342-136480364 TCCTGGGACCAGAGAGGGCAAGG + Intergenic
939682623 2:145157538-145157560 TGCAGGGAACAGAGGGAAGAGGG - Intergenic
939994324 2:148906125-148906147 CCTTGGGGCCAGAGGGAAAAAGG + Intronic
940040373 2:149353848-149353870 TTCTGGCACCAGAGAGATGATGG + Intronic
940223753 2:151381131-151381153 ACTTGGGGCAAGAGGGAAGATGG - Intergenic
942449189 2:176098646-176098668 TCTTGGGATCAGAGGCAGGAGGG + Intergenic
942560517 2:177213346-177213368 GCCTGGGATTGGAGGGAAGAGGG + Intronic
943734467 2:191339275-191339297 ACCTTGGACTAGAGGGTAGAGGG + Intronic
943789346 2:191914674-191914696 TCCTGAGACCATTTGGAAGAGGG + Intergenic
945225361 2:207528125-207528147 ACATAAGACCAGAGGGAAGAGGG + Intergenic
945726506 2:213476880-213476902 TCCTGTGACCAAAAGGAATAAGG + Intronic
947627324 2:231628143-231628165 TCCAGGGTCAAGATGGAAGAAGG + Intergenic
947872947 2:233449807-233449829 TGCCAGGACCAGGGGGAAGATGG + Intronic
948536239 2:238649942-238649964 GCCTGAGACCAGATGCAAGATGG - Intergenic
948680725 2:239632889-239632911 TCCAGGGAGCAGATGGCAGAGGG - Intergenic
1168842224 20:916854-916876 ACATGGAACCAGAGGGAGGAAGG - Intergenic
1169066760 20:2698227-2698249 TGCTGGGGGCAGTGGGAAGAGGG + Intronic
1169551023 20:6701305-6701327 TCCTGAGCCCAGAGGGAGGCAGG + Intergenic
1170973335 20:21137401-21137423 TCCTGTGACCAGTGTTAAGATGG - Intronic
1172779138 20:37425352-37425374 TCCTGGGAGCAGCTGGAAGAAGG + Intergenic
1172784319 20:37456522-37456544 TCTTGGTCCCAGAGTGAAGAAGG - Intergenic
1172958559 20:38779919-38779941 TCCTGGGAGCAGGGGGCGGAAGG - Intergenic
1173854975 20:46244404-46244426 TCCCGGCTCCAGAGTGAAGAGGG + Intronic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175466859 20:59195218-59195240 TCCTGGGGGCAGAGAGAAAAGGG + Intronic
1175829249 20:61953097-61953119 TCCTGGCAGCTGAGGGATGAAGG - Intergenic
1176119904 20:63449719-63449741 TCCTGGGAGAAGAGGGAAGAGGG + Intronic
1176653822 21:9572504-9572526 TCCTGGGAAGAGAGGGCAGGAGG + Intergenic
1176657155 21:9597295-9597317 TCCTGGGACCTGTGGGGAAAAGG + Intergenic
1178389598 21:32187461-32187483 TCTTGGGTCCAGAGGGATGGGGG + Intergenic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1179598684 21:42461117-42461139 TCCTGGGACCAGAGAGATGAGGG - Intergenic
1179635070 21:42703553-42703575 CGCTGGGAGCAGAGGAAAGAGGG + Intronic
1179911838 21:44455051-44455073 TCCTGATGCCAGAGGGAAGAGGG + Intergenic
1180115910 21:45704912-45704934 TCCAGAGACCAAAGGGAAGCTGG - Intronic
1180696317 22:17753736-17753758 TCCAAGGGCCAGTGGGAAGACGG + Intronic
1180835597 22:18928081-18928103 TCAAGGCACCACAGGGAAGAGGG + Intronic
1180959022 22:19754390-19754412 CCCTGGGACCAGGGAGCAGATGG + Intergenic
1181464275 22:23102390-23102412 CCCTGGGAGCAGAGGAAGGAAGG - Intronic
1181609916 22:24005441-24005463 TCCTGGGCCCAGATCGGAGAGGG - Intergenic
1181630386 22:24148058-24148080 TCTTGGGACCAAAAGGAGGAGGG + Intronic
1181807448 22:25383639-25383661 TCCTGGAGCCACAGGGCAGAGGG + Intronic
1181884467 22:26009215-26009237 TTCTGAGACCAGAGGGAATATGG - Intronic
1181966070 22:26657509-26657531 TCGCGGGACCAGAGGGAGGGAGG + Intergenic
1182621067 22:31618875-31618897 TCATGGCACCAGAGTGAACAGGG - Exonic
1183319430 22:37156059-37156081 TCCAGTGAGCAGAGGGAGGACGG - Intronic
1183933199 22:41247826-41247848 GGCTGGGAGCTGAGGGAAGAGGG + Intronic
1184224389 22:43120823-43120845 GCCTGGGCCCAGAGGCCAGATGG + Intronic
1184321597 22:43746113-43746135 TCCGGGGACAAGCGGGAAGCGGG + Intronic
1184919658 22:47596822-47596844 TCATGGGAGAGGAGGGAAGAGGG - Intergenic
1185179765 22:49352614-49352636 TCCTAGGGCCAGAGGGATGGAGG + Intergenic
1185332145 22:50256645-50256667 TCCTGGGGGCAGAGGAAAGGTGG + Exonic
1185414692 22:50703685-50703707 TCCTGGGTCCAGAGGTAAGAAGG - Intergenic
1203285685 22_KI270734v1_random:153380-153402 TCAAGGCACCACAGGGAAGAGGG + Intergenic
950360123 3:12444127-12444149 TCCTGAGCCCAGTGGGAAAATGG - Intergenic
950517307 3:13475801-13475823 TCCTGGGACAATCAGGAAGACGG + Intergenic
951168224 3:19507417-19507439 GCCTGGGCTCACAGGGAAGAGGG + Intronic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952120830 3:30242289-30242311 TTCTGGGAACAGAAGGAAAAGGG - Intergenic
954097756 3:48343539-48343561 GCCAGGGCCCAGAGGGAAGGTGG + Intergenic
954391716 3:50271092-50271114 TCCTGGGTCCAGCCGGAGGACGG - Exonic
954736576 3:52712646-52712668 TGCGGGAACCAGAAGGAAGATGG + Intronic
957219922 3:77369143-77369165 TCCTGGGACTAGAGTGAAGCAGG + Intronic
959975557 3:112454776-112454798 CCCTGGGAATAGCGGGAAGAGGG - Intergenic
960573415 3:119206797-119206819 CCCTGGAGCCAGAAGGAAGAGGG - Intergenic
960961798 3:123076036-123076058 TGCTGGTAGCAGAGGGAAGATGG + Intronic
961648310 3:128404506-128404528 TCCTGGCACCAGAGGGAGACGGG + Intronic
962315590 3:134357560-134357582 TCCTGGGACCAGATGGTCAATGG + Exonic
962418718 3:135208118-135208140 CCCTGTGGCAAGAGGGAAGATGG + Intronic
962978565 3:140467564-140467586 TCCTGGGGCCCCAGGGAGGAAGG - Intronic
963570901 3:146994084-146994106 TCACTGGACCAGATGGAAGATGG - Intergenic
964580327 3:158227293-158227315 TCTTGGGGGCAGAGGGAAGAGGG - Intronic
966854152 3:184182736-184182758 TCCTGGGAACACAGGGACAATGG - Exonic
967110552 3:186289707-186289729 GCCAGGGAACAAAGGGAAGATGG + Intronic
967724950 3:192853112-192853134 TGCTGGGACTATATGGAAGATGG - Intronic
968077645 3:195825226-195825248 CTCTGGGGCCAGAGGGAAGCTGG - Intergenic
968464492 4:743749-743771 TCCTGGTACCAGTGGGAACGTGG + Intronic
968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG + Intronic
968931461 4:3581689-3581711 TCCTGGCACCAGAGGGACCATGG - Intronic
969842461 4:9892396-9892418 TCCTGGGTGCTTAGGGAAGAAGG + Intronic
969868221 4:10089039-10089061 TTCAGAGCCCAGAGGGAAGAGGG - Intronic
971227466 4:24768264-24768286 TCCTGGCATCACAGGTAAGATGG + Intergenic
972833780 4:42844125-42844147 TTCAGGGACCAGATGGAAGAGGG - Intergenic
975617016 4:76256680-76256702 TTCTGGGAACAGAGGACAGAAGG - Intronic
976144891 4:82032753-82032775 TCCTGACACCAGAGGGAGGAAGG - Intronic
976307021 4:83570199-83570221 GCCTGGGGCCAGAGAGAAGAAGG - Intronic
976388029 4:84482725-84482747 TCCCGGGACCTCGGGGAAGAGGG + Intergenic
979785422 4:124711837-124711859 TCCTTGGCCCAGAGGAAGGAAGG - Intronic
980478679 4:133356372-133356394 TCATCAGCCCAGAGGGAAGATGG - Intergenic
985577405 5:679802-679824 GCCTGGGAGCAAAGGGATGAGGG + Intronic
985592337 5:771898-771920 GCCTGGGAGCAAAGGGATGAGGG + Intergenic
986300179 5:6472258-6472280 TCCTGTGACCACAGGGAGGTGGG - Intronic
986669051 5:10127151-10127173 TCCTGGGACCAGAGTGACACAGG + Intergenic
986788789 5:11140616-11140638 ACATGGGAAGAGAGGGAAGAAGG + Intronic
988453653 5:31368323-31368345 TCCTGGTAACAAAGGGGAGAGGG + Intergenic
989563357 5:42875908-42875930 TCCGGGGGCCACAGAGAAGAAGG + Intronic
992409944 5:76495521-76495543 TCCTGTGAGGAGAGGGATGATGG - Intronic
992868637 5:80983211-80983233 TGCTGGGAGCAGAGGAAACAGGG - Intronic
997194971 5:131973290-131973312 TCGTGGGACCACAGGGAAGATGG + Exonic
997263314 5:132479998-132480020 TCCTGGGATCAGAGGGGATGGGG + Intergenic
998394548 5:141810227-141810249 TCCAGGACCCAGAGGGGAGAAGG - Intergenic
999180288 5:149665307-149665329 TCCAGGGACCAATGGCAAGAGGG + Intergenic
999194774 5:149774480-149774502 TCGTGGGACCAGAAGCCAGAAGG - Intronic
999319356 5:150603811-150603833 TCCTGGGGCCAGAGGAGAGGTGG - Intronic
999439979 5:151593471-151593493 TCCTGGGGCCAGCAGGGAGAAGG - Intergenic
1000685363 5:164242463-164242485 GCCAGGGACCAGGGGGAAGGAGG + Intergenic
1000702751 5:164473667-164473689 TCCTATTACCACAGGGAAGAAGG - Intergenic
1000724581 5:164753540-164753562 TCCTAGGGCAAGAGGCAAGAGGG - Intergenic
1001942463 5:175750488-175750510 TCCTGAGCCCAGAGAGAGGAAGG + Intergenic
1002437781 5:179242747-179242769 GACTGGGATCTGAGGGAAGAGGG - Intronic
1002567425 5:180119731-180119753 AGCTGGGCCCAGAGGGAGGAGGG - Intronic
1003057945 6:2840436-2840458 TCTGGGGACCAGAGGTAACACGG - Exonic
1003593022 6:7451649-7451671 GCCAGGGACTAGAGGGAAGAGGG + Intergenic
1003838417 6:10095171-10095193 TGGTGGGCCCAGAGGGAGGAAGG + Intronic
1004035236 6:11917129-11917151 TACTGGCACCCCAGGGAAGATGG + Intergenic
1004527639 6:16424253-16424275 TCAAGGGACGAGAGGGAAGAAGG + Intronic
1005870862 6:29973856-29973878 TCCAGGGGCCAGGGGGAAGGAGG + Intergenic
1005952996 6:30645194-30645216 TCCTTAGACCAGAGGGAAATAGG - Intronic
1006266649 6:32931345-32931367 GCCTAAGAGCAGAGGGAAGAGGG + Intergenic
1006575310 6:35040908-35040930 TTCTGGGATACGAGGGAAGAGGG - Intronic
1006581258 6:35079063-35079085 TCCTGGCTCCCCAGGGAAGACGG - Intronic
1006688778 6:35861630-35861652 GCCTGGGACCAGAGCGGGGAGGG - Intronic
1007145495 6:39625842-39625864 TCCTGAGACTAGAGGAAAGTAGG + Intronic
1007273353 6:40655523-40655545 ACCTGTGTCCAGAGGGAAAAGGG + Intergenic
1007680220 6:43628808-43628830 TCCCGGGACCCCAGGGAGGAAGG - Intronic
1008379185 6:50823386-50823408 TCCTGGGAGCGGAGAGAGGAAGG - Exonic
1010187780 6:73162986-73163008 TCCTGGCAGCAGAGGGCACAAGG - Intronic
1011637599 6:89388660-89388682 TCCAGGGACCAGTGGGATGGTGG + Intronic
1014461261 6:121698521-121698543 TTCTGGGACCTGTGGGGAGAGGG + Intergenic
1015010969 6:128347224-128347246 TGATGGGATCAGAGGGAACAAGG + Intronic
1015013548 6:128381561-128381583 ACCTTGGGCCAGAGGGAAGGAGG + Intronic
1017912195 6:158802937-158802959 TCCTGACACCACAGGGAAGCAGG + Intronic
1018589937 6:165408742-165408764 GCCAGGGAGAAGAGGGAAGAAGG + Intronic
1018640967 6:165903822-165903844 TCCTAGGAACCAAGGGAAGAGGG + Intronic
1018922353 6:168184116-168184138 CTCTGGGACCAGAAGGAGGAAGG + Intergenic
1019372784 7:671732-671754 TGCTGGGGCCACAGGGAACAAGG - Intronic
1019534747 7:1523190-1523212 TGCAGGGAGCAGAGGGAAAAGGG - Intergenic
1019699249 7:2465698-2465720 TCCACTGACCAGAGGGTAGATGG - Intergenic
1021360023 7:19701369-19701391 TACAGGGAACGGAGGGAAGAAGG + Intronic
1021596251 7:22320170-22320192 TCCTGGGACCAGTGAAGAGAGGG - Intronic
1022959596 7:35413762-35413784 TCCTGGGACCAGAGGAGAGGAGG - Intergenic
1023359961 7:39405854-39405876 TCCTGGGACAAGAGTGAAACAGG - Intronic
1023983166 7:45081262-45081284 GCCTGGGAGTAGAGGGCAGAGGG + Exonic
1024608884 7:51046144-51046166 TGCTGGGAGGAGAGGGAACATGG + Intronic
1024730357 7:52246871-52246893 ACCTGAGACCAGAGAGATGATGG - Intergenic
1025014890 7:55431259-55431281 TCCTGGGACCAGAGACATCACGG + Exonic
1025280166 7:57621170-57621192 TCCTGGGAAGAGAGGGCAGGAGG + Intergenic
1025304567 7:57844331-57844353 TCCTGGGAAGAGAGGGCAGGAGG - Intergenic
1026192283 7:68140341-68140363 TCCTGGTCCCAGAGGGGATATGG - Intergenic
1026509954 7:71019484-71019506 CACTGGGAACAGAGGGGAGATGG - Intergenic
1028295813 7:89130147-89130169 TCCTGGCCACAGAGTGAAGAGGG + Intronic
1029177039 7:98672111-98672133 CCCTGGATCCAGAGAGAAGATGG + Intergenic
1029519482 7:101051054-101051076 TCATGGCAGAAGAGGGAAGAAGG + Intronic
1030847734 7:114442298-114442320 ACCTGGGGCCGGAGGTAAGAAGG + Intronic
1030857700 7:114581771-114581793 TCCAGGGACTAGGGGGAAGAAGG - Intronic
1032197307 7:129796749-129796771 TCCTGGGTCATCAGGGAAGAGGG - Intergenic
1032240141 7:130153733-130153755 GCCTGGGACCCGTGAGAAGACGG - Intergenic
1032322915 7:130900670-130900692 TCAGGGGACCACTGGGAAGAAGG + Intergenic
1032878545 7:136064222-136064244 TTCTGGGACCACAGGAAGGAGGG + Intergenic
1033314405 7:140285667-140285689 GCCTGGGACCAGAGGCAGTAGGG - Intergenic
1033515092 7:142097469-142097491 TCCTGGGACATGAGGCAAGTGGG + Intronic
1033781344 7:144672981-144673003 TCCTTAGACTACAGGGAAGATGG - Intronic
1034278298 7:149834002-149834024 TCCTGGGGCTCGAGGGAAGAGGG + Intergenic
1034940670 7:155228309-155228331 CCCTGAGTCCGGAGGGAAGAAGG + Intergenic
1035232074 7:157471279-157471301 ACCTCAGACCAGAGGGAAGCCGG + Intergenic
1035545813 8:481709-481731 TCCTGAGGCCAGTGGGATGAAGG - Intergenic
1035839561 8:2795707-2795729 TCCTGGGAGGGGAGGGCAGAGGG + Intergenic
1035869124 8:3118026-3118048 TTGTAGGACCAGAGGGAAAAAGG - Intronic
1037454627 8:19051189-19051211 GATTGGGACCAGAGGGAGGAGGG - Intronic
1037589680 8:20302684-20302706 GCCCGGGACCAGAGAGTAGAGGG + Intronic
1037837674 8:22223877-22223899 CCCTGGGGCCAAAGGGAAGGTGG - Intronic
1038485971 8:27935583-27935605 TCCTGGGGCCAGAGGCACAAAGG + Intronic
1038574791 8:28695714-28695736 GGCTGGGACCAGAGGGAAGGAGG + Intronic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040641976 8:49345718-49345740 TGCTTGAACCAGAGGGAAGGAGG + Intergenic
1041639747 8:60184467-60184489 GGCTGGGAGCTGAGGGAAGAGGG - Intergenic
1041834555 8:62197086-62197108 TTCTGGGACGATAGAGAAGATGG - Intergenic
1042048640 8:64683403-64683425 TCCTGGGCACAGAGAGTAGAGGG + Intronic
1042185672 8:66134454-66134476 TCCTGGGGCCAGAGGCTGGAGGG + Intronic
1043618725 8:82160768-82160790 TCCTGTAACCAGAAGGAATAAGG - Intergenic
1047008941 8:120650176-120650198 TCCGGGAACCAGAGCCAAGATGG - Intronic
1047314517 8:123720195-123720217 GCCAGGGAGCAGAGGGCAGAGGG + Intronic
1048451913 8:134540978-134541000 CACTGGCACCAGAGGGGAGAGGG + Intronic
1048541465 8:135345753-135345775 TCTTGGGACCAGAAGGCAGGAGG - Intergenic
1048987020 8:139740200-139740222 GCCAGGGACAGGAGGGAAGAGGG - Intronic
1049009329 8:139876753-139876775 GCCTGGAACCACAGGGAAGATGG - Intronic
1049330771 8:142049313-142049335 TCATGGGGCCACAGGGAGGATGG - Intergenic
1049685664 8:143938320-143938342 TGCTGGTCCCAGAGGGAAGGAGG + Intronic
1049975550 9:858199-858221 TCATGTGGCCAGTGGGAAGAGGG + Intronic
1051350152 9:16191414-16191436 ACTTGGGAGCAGAGGGAGGAAGG + Intergenic
1051694449 9:19753032-19753054 TCCTGGCACCTGAGGGATCAGGG - Intronic
1052271229 9:26630291-26630313 TCCAGAGACCTGAGGGAAGGTGG + Intergenic
1054458669 9:65450240-65450262 TCCTGGCACCAGAGGGACCATGG + Intergenic
1055447988 9:76402102-76402124 TTCCGGGTACAGAGGGAAGAAGG + Intergenic
1055731845 9:79286685-79286707 ACCTTGGACCAGAAGGCAGAGGG + Intergenic
1056678508 9:88696933-88696955 TCCTTGGCCCGCAGGGAAGAGGG + Intergenic
1057056587 9:91966261-91966283 TCCTAGGAGCAGAGGGCACAGGG - Intergenic
1057081547 9:92177678-92177700 TCCTGGGTGTAGAGGGCAGAGGG - Intergenic
1057353825 9:94319728-94319750 ACCTGGAAACAGAAGGAAGAAGG + Exonic
1057653926 9:96937864-96937886 ACCTGGAAACAGAAGGAAGAAGG - Exonic
1057721064 9:97532291-97532313 TCATGGGTCCAGAGGGCAGAGGG - Intronic
1058003566 9:99892126-99892148 TCCTGGGATAAGAGGAGAGAGGG + Intergenic
1059341304 9:113599016-113599038 GCCGGGGAGCAGAGGGAAGGGGG - Intergenic
1059941545 9:119365048-119365070 TCCTGAGACCATACTGAAGAGGG + Intronic
1060223891 9:121779937-121779959 GCCTGGAAGCAGAGGGAAGGCGG - Intronic
1061151276 9:128829622-128829644 GCCTGGGATCAGCGGGAAGCAGG + Intronic
1062050663 9:134444817-134444839 ACCTGCCACCAGAGGGAAGGAGG - Intergenic
1062622492 9:137429149-137429171 TCCTGTGACCTGCGGGAAGGGGG + Intronic
1203631543 Un_KI270750v1:75956-75978 TCCTGGGAAGAGAGGGCAGGAGG + Intergenic
1186937517 X:14466800-14466822 TACTGGGACTAATGGGAAGAGGG - Intergenic
1187380216 X:18794794-18794816 TACTGGGAGCTGGGGGAAGAAGG + Intronic
1189163296 X:38833370-38833392 TTCTGGGAACAAAGTGAAGAGGG - Intergenic
1189308799 X:40006115-40006137 GCCTGGGGGCAGAGGGAAGTGGG + Intergenic
1190106779 X:47566802-47566824 GCCGGGGACCACAGGGCAGAGGG + Intronic
1190168465 X:48092591-48092613 TCCTGGTACCTGGGGGAAGAGGG - Intergenic
1190168778 X:48095094-48095116 TCCTGGTACCTGGGGGAAGAGGG + Intergenic
1190741194 X:53289769-53289791 TCCTGGGCCCAGAGTCAAGGAGG - Intronic
1190991455 X:55555084-55555106 TCCTGGTGGCAGAGGGAAGAAGG - Intergenic
1195097105 X:101513701-101513723 TGCTGAGAGCAGAGGGAATATGG - Intronic
1195688159 X:107603618-107603640 TGCTGTGAGCAGAGTGAAGAGGG - Exonic
1196768398 X:119270408-119270430 TCCTGGGTCCAGTGTGCAGAAGG - Intergenic
1197256249 X:124266524-124266546 TCCTGGGACCATAAGGCTGAAGG + Intronic
1197365846 X:125563621-125563643 TCTTGGGAGCAGGGGGAGGAGGG + Intergenic
1198018974 X:132639858-132639880 TCCTGGGACAAGAGGCACTAGGG - Intronic
1198577319 X:138024862-138024884 TCCTGCGGGCAGAGGCAAGATGG + Intergenic
1199894033 X:152115397-152115419 GCCTGGGACCAGAGGAGAGGAGG + Intergenic
1200079929 X:153571284-153571306 TCCTGGGAGCTGAGGGCAGCAGG + Intronic
1201782795 Y:17741941-17741963 TCATGGGGCCAGAAGGAAAAAGG - Intergenic
1201818758 Y:18164046-18164068 TCATGGGGCCAGAAGGAAAAAGG + Intergenic
1202174150 Y:22082105-22082127 TCTTGAGGCCAGAAGGAAGAAGG - Exonic
1202217210 Y:22504277-22504299 TCTTGAGGCCAGAAGGAAGAAGG + Exonic
1202325976 Y:23691782-23691804 TCTTGAGGCCAGAAGGAAGAAGG - Intergenic
1202544795 Y:25978272-25978294 TCTTGAGGCCAGAAGGAAGAAGG + Intergenic