ID: 1089735197

View in Genome Browser
Species Human (GRCh38)
Location 11:120546104-120546126
Sequence GAGGTACAGCCGTTCTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089735191_1089735197 12 Left 1089735191 11:120546069-120546091 CCGTGGTCTTTGTGGGTGGGTCA 0: 1
1: 0
2: 0
3: 15
4: 178
Right 1089735197 11:120546104-120546126 GAGGTACAGCCGTTCTCTGTAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1089735184_1089735197 28 Left 1089735184 11:120546053-120546075 CCCATGACCAAAGAATCCGTGGT 0: 1
1: 0
2: 0
3: 3
4: 102
Right 1089735197 11:120546104-120546126 GAGGTACAGCCGTTCTCTGTAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1089735186_1089735197 21 Left 1089735186 11:120546060-120546082 CCAAAGAATCCGTGGTCTTTGTG 0: 1
1: 0
2: 2
3: 10
4: 82
Right 1089735197 11:120546104-120546126 GAGGTACAGCCGTTCTCTGTAGG 0: 1
1: 0
2: 1
3: 7
4: 72
1089735185_1089735197 27 Left 1089735185 11:120546054-120546076 CCATGACCAAAGAATCCGTGGTC 0: 1
1: 0
2: 1
3: 3
4: 50
Right 1089735197 11:120546104-120546126 GAGGTACAGCCGTTCTCTGTAGG 0: 1
1: 0
2: 1
3: 7
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089735197 Original CRISPR GAGGTACAGCCGTTCTCTGT AGG Intronic
910182680 1:84503349-84503371 GAGGTACAGCTGTAATCTGCAGG - Intronic
917424363 1:174898643-174898665 GAATAACAGCAGTTCTCTGTTGG + Intronic
917730450 1:177870172-177870194 GAGGTACAGCCATACTCAGAAGG + Intergenic
922795660 1:228338262-228338284 GAGGGACAGGAGTTTTCTGTTGG - Intronic
923167771 1:231383282-231383304 GAGGTACTGCTGTTCTTTGGAGG - Intronic
923281522 1:232447524-232447546 GAAGTTCAGCCATTCTCTGTCGG - Intronic
1067088435 10:43254733-43254755 GAGGTAAAACGGGTCTCTGTGGG + Intronic
1069543807 10:69315254-69315276 GAGGTACAGCTGTTATCTGTTGG + Intronic
1071525856 10:86357853-86357875 CAGGAACAGCAGCTCTCTGTGGG + Intronic
1083901020 11:65643563-65643585 GTGTTTCAGCAGTTCTCTGTGGG - Intronic
1084068058 11:66716824-66716846 GAGGTATGGCTGTTCTCTTTTGG + Intronic
1088848653 11:113688144-113688166 GAGGTCCATGCGTTCTGTGTCGG + Exonic
1089735197 11:120546104-120546126 GAGGTACAGCCGTTCTCTGTAGG + Intronic
1098433787 12:70448256-70448278 GAGGTCCAGCCCTTCGCTGCTGG + Intergenic
1101624737 12:106428316-106428338 GAGGTAAAGCAGTTTTCTTTAGG - Intronic
1107964491 13:45587015-45587037 GAGGCGCAGCCGGGCTCTGTGGG - Intronic
1112332442 13:98486699-98486721 GTAGTTCAGCGGTTCTCTGTTGG - Intronic
1115512208 14:34148607-34148629 GAGGTTCAGCTATTCTCAGTGGG - Intronic
1121432600 14:93898484-93898506 GAGGTGCCGCCGTCCTCTGCAGG + Intergenic
1121951829 14:98177609-98177631 GGGGTACAGCCTTGGTCTGTGGG + Intergenic
1122025456 14:98872711-98872733 GAGGCACAGCCCTTCCCTGTGGG + Intergenic
1202923059 14_KI270724v1_random:2773-2795 CTGGGACAGCCGTTCTCTGGTGG + Intergenic
1127183394 15:56450378-56450400 GAGGTGCAGCATTTCTCTTTGGG - Intronic
1130287805 15:82570355-82570377 GTGGTACAGCCATTCGCTGTTGG - Intronic
1133397649 16:5461193-5461215 GAGATGCAGCCATTCTCTGCTGG - Intergenic
1139534166 16:67561695-67561717 GCGGGAGAGCTGTTCTCTGTGGG - Intergenic
1140691513 16:77488863-77488885 GAGTGACAGCCTTGCTCTGTAGG - Intergenic
1142603962 17:1071543-1071565 GTGGGACAGCCGTTCCCTGGGGG - Intronic
1143706965 17:8705347-8705369 GAGGTACTGCCGTTATCTAAGGG - Intergenic
1144330975 17:14223939-14223961 AAGGTACACTTGTTCTCTGTCGG + Intergenic
1144834779 17:18151125-18151147 GAGGCACAGCCGACGTCTGTAGG + Exonic
1149000310 17:51750664-51750686 GAGATCCAGCCCTGCTCTGTGGG - Intronic
1151153099 17:72104759-72104781 GAGTCACACCCTTTCTCTGTGGG - Intergenic
1151468659 17:74304213-74304235 GAGGTAGGGCCTTGCTCTGTAGG + Intronic
1152425313 17:80215270-80215292 GAGGTACAGCCAGTGTCTCTGGG - Intronic
1154147533 18:11878752-11878774 GAGATACAGCCTTGCTATGTTGG + Intronic
1158998383 18:62947124-62947146 GAGGAAGAGCCGTGCTCTGAAGG + Intronic
1164981032 19:32614661-32614683 GAGATAGAGCCTTGCTCTGTCGG - Intronic
1167094164 19:47364963-47364985 AAGGAACTGCCCTTCTCTGTGGG + Intronic
1167762514 19:51458411-51458433 GAGGAACAGACGTTCCCTGGCGG - Exonic
926583924 2:14664193-14664215 GAAGTACACGCATTCTCTGTTGG - Intergenic
936674930 2:114703989-114704011 GTGGTACAGCCCGGCTCTGTGGG - Intronic
944129556 2:196332370-196332392 GAGGTACAGCCTTTCAATTTTGG + Intronic
945206798 2:207341308-207341330 GAGGAACAGACGTTATCTGATGG - Intergenic
1168856287 20:1011589-1011611 AAGGGACAGCAGTTCTCTGGTGG + Intergenic
1171306688 20:24112828-24112850 GAGCTACATGCCTTCTCTGTAGG - Intergenic
1173825092 20:46043146-46043168 GAGCTCCAGAGGTTCTCTGTGGG - Exonic
1178455120 21:32741964-32741986 GAGGTTCAGCCTTGCTGTGTAGG - Intronic
1179270759 21:39849278-39849300 GAGGTACAGCAGGGCTCTGCAGG - Intergenic
1181873427 22:25921460-25921482 GAGGGACAGCAATTCTCTGCAGG - Intronic
1183285648 22:36961118-36961140 GAGACACAGCCATTTTCTGTAGG + Intergenic
949332778 3:2940674-2940696 GAGGAACCTCTGTTCTCTGTGGG + Intronic
949499239 3:4663157-4663179 CAGTTTCTGCCGTTCTCTGTTGG - Exonic
952827520 3:37536728-37536750 GAAATACAGACTTTCTCTGTAGG + Intronic
965433138 3:168613620-168613642 GGGGTACAGTCGTTCCTTGTTGG - Intergenic
966219662 3:177538247-177538269 GAAGTACAGCCCTTTTCTGCTGG + Intergenic
968856954 4:3132622-3132644 GAGCCACTGCCATTCTCTGTGGG + Exonic
970941935 4:21644387-21644409 GAGGCACAGCCTTGTTCTGTGGG + Intronic
973857850 4:55031358-55031380 GAAGAACAGCTGTTCTCTGTTGG - Intergenic
982878983 4:160686522-160686544 GAGGTCAAGGTGTTCTCTGTTGG - Intergenic
984581713 4:181517468-181517490 GAGGTACAGCCTGGCTCTGCAGG - Intergenic
985563533 5:603817-603839 GAGGGACCCCCTTTCTCTGTGGG - Intergenic
989792253 5:45419928-45419950 GAGTGACATCTGTTCTCTGTTGG + Intronic
999734834 5:154505517-154505539 GAGCTCCAGCTGTTTTCTGTGGG - Intergenic
1014685998 6:124501171-124501193 GAGGTGCAGTGGTTCTCTGTGGG - Intronic
1020116650 7:5479990-5480012 GAGGTACAGCCCTCCTGTGCAGG - Intronic
1021316486 7:19154266-19154288 GAGCTACAGCTGTACTCTGCAGG - Intergenic
1024750097 7:52455235-52455257 GAGCCACAGACGTTTTCTGTTGG - Intergenic
1028094149 7:86739499-86739521 GAGGTAAGGCCGTTCTACGTAGG - Intronic
1032515623 7:132504159-132504181 GAGGTACAGCTGAGCTCTCTGGG + Intronic
1035850444 8:2914642-2914664 GAGGTACAGCAGTTCTGTGCAGG - Intergenic
1037875368 8:22544186-22544208 GAGGCACAGCTGATCTCTATAGG + Intergenic
1038000146 8:23384446-23384468 GAGGAATTGCCGTTCCCTGTTGG - Intronic
1040480713 8:47823757-47823779 GAGGTACAGCAGATCCTTGTTGG - Intronic
1042233238 8:66580909-66580931 GGGGTACAGCGGTGCTCTCTCGG + Intronic
1049219674 8:141423264-141423286 GAGGGACAGCCATCTTCTGTAGG - Intronic
1052112702 9:24608400-24608422 GAAATACAGCCATTCTCTATAGG - Intergenic
1061744027 9:132726738-132726760 GTACTACAGCCGTTCACTGTTGG + Intronic
1062448639 9:136606342-136606364 GGGGTGCAGCCGTGCTCTGTGGG + Intergenic
1194947765 X:100089874-100089896 GAGGCAGGGCCTTTCTCTGTTGG - Intergenic
1197883706 X:131195780-131195802 GAGGTACTTCAGTTCTCTGAAGG + Intergenic