ID: 1089735418

View in Genome Browser
Species Human (GRCh38)
Location 11:120547298-120547320
Sequence AAGGCCAGAGACCTTGCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089735411_1089735418 28 Left 1089735411 11:120547247-120547269 CCTGGGCACTCCTCTATCGTGGC 0: 1
1: 0
2: 0
3: 5
4: 44
Right 1089735418 11:120547298-120547320 AAGGCCAGAGACCTTGCCTTGGG 0: 1
1: 0
2: 1
3: 20
4: 202
1089735409_1089735418 29 Left 1089735409 11:120547246-120547268 CCCTGGGCACTCCTCTATCGTGG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1089735418 11:120547298-120547320 AAGGCCAGAGACCTTGCCTTGGG 0: 1
1: 0
2: 1
3: 20
4: 202
1089735413_1089735418 18 Left 1089735413 11:120547257-120547279 CCTCTATCGTGGCTCTTGGCATC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1089735418 11:120547298-120547320 AAGGCCAGAGACCTTGCCTTGGG 0: 1
1: 0
2: 1
3: 20
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089735418 Original CRISPR AAGGCCAGAGACCTTGCCTT GGG Intronic
900313998 1:2048161-2048183 AAGGCCACAGCCCTGGCCATGGG + Intergenic
902239813 1:15080985-15081007 AAGTTCAGAGGCCTTGCCGTAGG + Intronic
902383046 1:16061576-16061598 AAGTCCAGCCCCCTTGCCTTGGG + Intronic
903386968 1:22933311-22933333 ACAGCCAGAGTCCTTGGCTTGGG + Intergenic
906730678 1:48078252-48078274 AGGGCCAGAGAAAGTGCCTTGGG + Intergenic
907588843 1:55646410-55646432 AAATCCAGAGACCTTGGCTCTGG - Intergenic
907866260 1:58402256-58402278 AAGGAAAGAGACCTTGGCCTGGG - Intronic
908456099 1:64306438-64306460 GAGGCCAGAGACCCTGTCTGAGG - Intergenic
909860103 1:80594266-80594288 CAGGGCTGAGACCTTGCTTTAGG - Intergenic
912473622 1:109922610-109922632 AGGGCCCTAGACCCTGCCTTGGG - Intronic
912699377 1:111865272-111865294 ACGGCCACAGGTCTTGCCTTCGG + Intronic
913685396 1:121227086-121227108 AATCCCAGAGAACTTGCCTTTGG + Intronic
914037243 1:144014690-144014712 AATCCCAGAGAACTTGCCTTTGG + Intergenic
914152212 1:145053242-145053264 AATCCCAGAGAACTTGCCTTTGG - Intronic
914932828 1:151949956-151949978 AAGGCCAGAGGGCTTCCCTGGGG - Intergenic
915106607 1:153538580-153538602 AAGGCCAGAGATCAGGCCTGGGG + Intronic
915460083 1:156065083-156065105 CAGGCCAGAGTTTTTGCCTTTGG - Intronic
918651970 1:186976588-186976610 AAGGCCATGGAGCTTGCATTTGG + Intronic
919727825 1:200895322-200895344 CAGGCCTGAGACCTGGCTTTGGG + Intronic
920472714 1:206245644-206245666 AATCCCAGAGAACTTGCCTTTGG + Intronic
921597711 1:217072968-217072990 AAGGGCAGAGAACATGCCCTTGG - Intronic
1063211930 10:3888501-3888523 AAGACCAGAGGCGTTCCCTTTGG + Intergenic
1063784708 10:9367522-9367544 AGGCCCAGAGACCATGCTTTGGG + Intergenic
1064266708 10:13831202-13831224 AAGGTCAGAGGCATTGCGTTTGG - Intronic
1064766297 10:18676858-18676880 AAGCCCAGAAAGCTTTCCTTTGG - Exonic
1067284636 10:44898747-44898769 ATGGCCAGAGATCTTGACCTTGG - Intergenic
1067721129 10:48728450-48728472 AAGGCCACATACTTTCCCTTGGG + Intronic
1067774691 10:49154455-49154477 AAGGCCAGTGTCCTCTCCTTGGG - Intergenic
1067922170 10:50470496-50470518 AAAGCTAGAGACCATGCCTGGGG - Intronic
1069200983 10:65616470-65616492 ATGGCCTGTGAGCTTGCCTTAGG - Intergenic
1069621793 10:69841809-69841831 AAGGGCAGAGACCCTGCAGTGGG + Intronic
1070919032 10:80172544-80172566 AAGGCAAGAGACCCAGCCCTGGG + Intronic
1071595788 10:86922947-86922969 CAGGCCTGAGACCTTCCCTTAGG - Intronic
1072229186 10:93399075-93399097 CTGGCCAGAGAGCTTGCCTAAGG + Intronic
1072438855 10:95436633-95436655 AGGGCCAGAATCCTTGCATTGGG - Intronic
1076807485 10:132866341-132866363 AAGGCCTGAGCTCTGGCCTTGGG - Intronic
1077077392 11:707739-707761 AAGGCCAGGTTCCTGGCCTTCGG - Intronic
1077121165 11:909300-909322 AATGCCAATGACCTTCCCTTGGG + Intronic
1077365772 11:2161019-2161041 AAGGCCAGGTGCCCTGCCTTGGG + Exonic
1082904928 11:58297293-58297315 AAAGCCAGAGACCTGGCATGGGG - Intergenic
1083198021 11:61102548-61102570 AAGGCCAGAAACCATGCCCATGG + Exonic
1083536157 11:63468507-63468529 AACTCCAGAGACCTTGTTTTAGG + Intronic
1083761595 11:64821704-64821726 AAGGCCAGGTAACTTGCCTGTGG + Intergenic
1084003484 11:66311550-66311572 AAGGCTAGACACCTTCCCTGGGG - Intergenic
1086080371 11:82897733-82897755 AAGGCCAAACACCTTGGCATGGG - Intronic
1089039063 11:115428441-115428463 AAGGCAAGAGTCCTTGCATCTGG + Intronic
1089559629 11:119337351-119337373 AAGGCAACAGACCTTGCATCAGG + Intergenic
1089735418 11:120547298-120547320 AAGGCCAGAGACCTTGCCTTGGG + Intronic
1090764084 11:129862069-129862091 AATTCCAGAGATCTTGTCTTAGG - Intergenic
1091661727 12:2389226-2389248 AAGGACAGAGGCGTGGCCTTTGG + Intronic
1091963781 12:4721203-4721225 AGGGCCATAGACCTGTCCTTAGG + Intronic
1092495133 12:8985984-8986006 AAGGCCAGAGGCCTTCCCCTTGG + Intronic
1093912337 12:24762298-24762320 AAAGCCAGAGAGTTTGCATTTGG - Intergenic
1094735131 12:33225534-33225556 AAGGACTAAGACATTGCCTTGGG - Intergenic
1095493569 12:42761330-42761352 AAGGCCAGAGAAATTTTCTTGGG + Intergenic
1096793930 12:54062118-54062140 GAGGCCAGAGGCCTTCCATTTGG - Intergenic
1098247720 12:68537571-68537593 GAGGCCACAGACCATGCCCTGGG + Intergenic
1100043723 12:90352899-90352921 CAGGCCAGAGACCTTGTGTAGGG - Intergenic
1103558782 12:121781268-121781290 CAGGCAAGTGACCCTGCCTTAGG + Exonic
1103893184 12:124255006-124255028 AAGGCCGGATACCTTGCATGGGG + Intronic
1104622647 12:130329959-130329981 AAGGCCAGTGACTTTGCCCTTGG + Intergenic
1105967131 13:25395277-25395299 AAAGCCAGAGATCTTGTCTTGGG + Intronic
1106449433 13:29866722-29866744 AAGCACAGAGGCCATGCCTTGGG + Intergenic
1113275753 13:108727788-108727810 AAGGCAAGAGAAGTTGCATTTGG - Intronic
1115299198 14:31865391-31865413 AAGACTTGAGAACTTGCCTTGGG - Intergenic
1115574409 14:34696497-34696519 AAGGTCAGTGACCTTTCCTGTGG - Intergenic
1115917584 14:38333502-38333524 CAGGAAAGAGACCATGCCTTAGG + Intergenic
1119592770 14:75905639-75905661 AAGGCCAACGACTTTGGCTTTGG - Intronic
1120504369 14:85336216-85336238 GAGGCCAGACAACTTGGCTTTGG - Intergenic
1121272120 14:92644782-92644804 AAGGCCAGAGACCTTGGCCCTGG + Intronic
1121337090 14:93084028-93084050 ATGGCCACAGGACTTGCCTTGGG + Intronic
1122359968 14:101153269-101153291 AATCCTAGAGACATTGCCTTGGG + Intergenic
1122494701 14:102144527-102144549 AAGCCCAGCTACCTTACCTTTGG - Intronic
1126067651 15:44838294-44838316 CAGGCCAGAGACCTTGTGATGGG - Intergenic
1126092229 15:45062588-45062610 CAGGCCAGAGACCTTGTGATGGG + Intronic
1126941556 15:53772402-53772424 AAGGCAAGATACCTTCCTTTAGG - Intergenic
1128672024 15:69580871-69580893 ATGGCCAGAGTGCTTGTCTTTGG - Intergenic
1129727471 15:77908958-77908980 GGGGCCAGGGACCCTGCCTTCGG - Intergenic
1130258492 15:82336978-82337000 GGGGCCAGGGACCCTGCCTTCGG - Intergenic
1130282814 15:82532528-82532550 GGGGCCAGGGACCCTGCCTTCGG + Intergenic
1130596434 15:85252982-85253004 GGGGCCAGGGACCCTGCCTTCGG + Intergenic
1133428301 16:5712646-5712668 AAGTCCAGAGAAGTTGCCTGTGG + Intergenic
1133722282 16:8506325-8506347 AAGGACAGAGGTCTTGCCTGGGG - Intergenic
1134787328 16:16956455-16956477 AAGCCCAGCTTCCTTGCCTTGGG - Intergenic
1136174122 16:28505952-28505974 AATGCCAGAGATCTTACGTTAGG - Intronic
1136516828 16:30773481-30773503 CTGGCCAGAGACCCTGCCGTGGG - Intronic
1137480761 16:48850171-48850193 AATGACACAGACCTTGCCTCTGG + Intergenic
1138301289 16:55931799-55931821 GAGGACAGGGACCTTGCCTTGGG + Intronic
1138630521 16:58290939-58290961 CAGGCCAGTGCCCCTGCCTTTGG - Exonic
1138707890 16:58936507-58936529 AAGGCCAGGGACCCTCCCTAAGG - Intergenic
1138940165 16:61780684-61780706 AAAGCCACAGACCATGTCTTGGG - Intronic
1139659071 16:68408612-68408634 AAGGCCAGGGACCTGGACCTAGG + Intronic
1141383251 16:83595386-83595408 AAGGGCAAGGACCATGCCTTTGG - Intronic
1144698862 17:17323677-17323699 AGGGCCACAGACCTTTCCTCTGG - Intronic
1146607216 17:34270995-34271017 AAGGGCAGAGACATTGGGTTTGG + Intronic
1147213381 17:38885220-38885242 AAGGACAGAGACCTTGCCCAAGG - Intronic
1148189742 17:45670197-45670219 AAGGCTAGATAACTTGCCTGAGG - Intergenic
1151146807 17:72048791-72048813 AAAGTCAGACATCTTGCCTTTGG - Intergenic
1154134249 18:11761843-11761865 AAAACCAGAGAACATGCCTTAGG - Intronic
1154174956 18:12080301-12080323 AAGGCCAGAGAGTTGGCCCTGGG + Intergenic
1156050388 18:32925932-32925954 AAGGACAGAGTCCTTTCATTTGG + Intergenic
1161294828 19:3514339-3514361 AAGGGCAGAGACCCTGCTCTCGG - Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1167612263 19:50513252-50513274 AAGGTCAGTGACCTTGCCATGGG - Exonic
1167626854 19:50596107-50596129 AAGGCAAGAGGCCTTGCCTTTGG - Intergenic
925210612 2:2042747-2042769 AAGGGCAGATGCCTTGCTTTGGG - Intronic
925903050 2:8522439-8522461 CAGGCCAGAGACCTCGCCCCTGG + Intergenic
927392021 2:22606437-22606459 AAAGACACAGACCTTGCCTCCGG + Intergenic
927478497 2:23432494-23432516 AAGGACAGGGACCTTGTCTCAGG - Intronic
927597734 2:24411940-24411962 AAGGCCAGAGGCACTGACTTAGG - Intergenic
927914346 2:26925267-26925289 AAGGCCAGAGCCCAGGCCTTGGG + Intronic
928744643 2:34396901-34396923 ACAACCAGAGACCTTGCCTGCGG - Intergenic
929545677 2:42854157-42854179 AAGGCCTGAGACTCTGCCCTGGG - Intergenic
931998068 2:67857908-67857930 AAGTCCAGCTCCCTTGCCTTAGG - Intergenic
932351427 2:71035446-71035468 AAGGCCAGACACATGGCATTTGG + Intergenic
936015871 2:108958666-108958688 AAGGCCTGAGAGCTGGACTTGGG - Intronic
937038876 2:118805755-118805777 AATGCCAATGCCCTTGCCTTTGG + Intergenic
937176393 2:119940062-119940084 AAGGGCAGACACCTTGAGTTTGG + Intronic
938405752 2:131032250-131032272 AAGGGCAGTGACCCTGCCCTGGG - Intronic
940002371 2:148979240-148979262 AAGGGCAGAGACCTTTGGTTGGG + Intronic
940870981 2:158860089-158860111 AAGGCCAGACACATGGCATTTGG + Intronic
942779585 2:179625654-179625676 GAGGTCAGGGACTTTGCCTTAGG - Intronic
948599472 2:239100150-239100172 CAGCCCAGAGACTCTGCCTTTGG + Intronic
1169757322 20:9056844-9056866 GAGGAAAGAGACCTTGCTTTGGG + Intergenic
1169995538 20:11552184-11552206 AAGGCCAGCCCCCTTGCCTCAGG - Intergenic
1170600600 20:17838658-17838680 AAGTCCAGCTCCCTTGCCTTGGG + Intergenic
1173065570 20:39707327-39707349 AAGGGCAGAGGCCTGGCCGTGGG + Intergenic
1173182848 20:40817672-40817694 GAGTCCAGAGAGCTTTCCTTCGG + Intergenic
1174930156 20:54804756-54804778 AAGCCCAGAGTCTTTGCCTGAGG - Intergenic
1175200432 20:57273206-57273228 AAGGCCAGAGAACCAGGCTTGGG - Intergenic
1178125997 21:29516319-29516341 GAGGACAGATTCCTTGCCTTAGG - Intronic
1178917944 21:36719445-36719467 AAGGACAGAGACCCTGGCCTGGG + Intronic
1180238423 21:46480572-46480594 TGGCACAGAGACCTTGCCTTGGG + Intronic
1184599621 22:45535378-45535400 GGGGCCAGCGACCTAGCCTTGGG + Intronic
950725573 3:14914745-14914767 GAGGCCAGAGGCCATGCCTGAGG - Intronic
950726598 3:14921087-14921109 AAGGCCACTGTCCTTGCCCTGGG - Intronic
951541462 3:23786175-23786197 AAGGACAGAGAACTTGGCTTAGG + Intergenic
953185253 3:40631570-40631592 CAGGGCTGAGAACTTGCCTTAGG - Intergenic
953727473 3:45412864-45412886 TAGGGCAGAGTCCTTGCCTGGGG + Intronic
953807679 3:46085603-46085625 AAGGCCAGACTCCTGACCTTGGG - Intergenic
953911851 3:46897185-46897207 AAGGCGAGAGGCCTGGCCTGGGG + Intronic
956111402 3:65873292-65873314 CAGGCCTGAGAGCTTGCCGTGGG - Intronic
960692536 3:120361860-120361882 AAGGCCAGTGAACATGGCTTGGG + Intergenic
961005963 3:123405552-123405574 AAGGCCACGGGCCTTGCATTTGG - Intronic
961273685 3:125709874-125709896 AAGGCCAGACACATGGCATTTGG + Intergenic
961809374 3:129513110-129513132 AAGGCCTGAGAGCCTACCTTTGG + Intronic
963648522 3:147947046-147947068 AAGGCCAAAGAAATTACCTTGGG - Intergenic
964623311 3:158736132-158736154 AAGCCCAGATACCCTGCCTGGGG - Intronic
967083073 3:186068637-186068659 AAGCCAAGAAACTTTGCCTTTGG - Intronic
967236002 3:187384236-187384258 AAGTATGGAGACCTTGCCTTGGG - Intergenic
967287707 3:187889565-187889587 GAGGTCTGATACCTTGCCTTAGG + Intergenic
969026501 4:4177280-4177302 AAGGCCAGACACATGGCATTTGG - Intergenic
969640520 4:8395619-8395641 AAGGCTAAGGACCTTGCCTGGGG + Intronic
969666623 4:8561026-8561048 AAGCCCAGAGGCCTTCCCTGAGG - Intronic
969825229 4:9752598-9752620 AAGGCCAGACACATGGCATTTGG + Intergenic
970752431 4:19380332-19380354 AAGGTCAAATATCTTGCCTTGGG - Intergenic
972659902 4:41106318-41106340 AAGCCCAAAGACCTTCACTTTGG + Intronic
972842189 4:42944440-42944462 AGGTTCAGAGACCGTGCCTTGGG + Intronic
975044493 4:69784594-69784616 AAGGCAATGAACCTTGCCTTAGG + Intronic
979045729 4:115860792-115860814 AAGACCAGAGATCTTTCTTTGGG - Intergenic
983852424 4:172598076-172598098 AAGACCAGGGAATTTGCCTTAGG - Intronic
984861333 4:184242957-184242979 AAGGACTGAGACCTTATCTTAGG - Intergenic
985904703 5:2824220-2824242 AAGAGCAGAGCCCTTTCCTTAGG + Intergenic
987025762 5:13925082-13925104 TAGGCTAGAGACCTTGACTGTGG + Intronic
987288603 5:16486597-16486619 AAACCCAGAGTCCTGGCCTTGGG - Intronic
988459988 5:31426301-31426323 AAAGGTAGAGACCTTGCCTAAGG - Intronic
989126024 5:38053107-38053129 AAGGCCAGAGATCTTTGTTTAGG + Intergenic
990033963 5:51297083-51297105 AAGTCCAGCTCCCTTGCCTTAGG + Intergenic
992151505 5:73909246-73909268 AACGCCAAAAACCTTGCCTTTGG + Intronic
992574244 5:78095336-78095358 AAGGCCAGACACATTCCCTGTGG - Intronic
996395824 5:123012884-123012906 CTGGCCAGAGACCTGTCCTTGGG + Intronic
996400267 5:123054675-123054697 AAGACAAGAGAACTGGCCTTTGG - Intergenic
997429783 5:133829806-133829828 AACCCCAGAGACCTTGTCTCTGG - Intergenic
999377265 5:151095562-151095584 AAGGCCATGGACCTTGACCTGGG - Intergenic
1000436526 5:161217296-161217318 AAGGCCAGGAATCTTGCCTAAGG + Intergenic
1001154478 5:169261350-169261372 AAGCCCAGAGGCATTGCCTCAGG + Intronic
1001222038 5:169908960-169908982 AAGGTCACAGAACTTGCCTCTGG + Intronic
1002200301 5:177524242-177524264 AAGGCCACAGAGCTTGCCCCAGG - Exonic
1005465670 6:26109973-26109995 AATGGCAAAGACCTTGCCTAAGG + Intergenic
1005851601 6:29827472-29827494 AGGGCCAGGGACCTTGCCGAGGG + Intronic
1007817995 6:44538343-44538365 GAGGAATGAGACCTTGCCTTAGG + Intergenic
1008486366 6:52040548-52040570 AAGGCCATATAACTTGCTTTGGG + Intronic
1009644304 6:66377879-66377901 AAGGGCTGAGACCTTGCCCCAGG - Intergenic
1010376868 6:75181008-75181030 GAAGCCAGAGACCTTGTATTTGG - Exonic
1010865280 6:80968720-80968742 TAGGCCACAGTCCCTGCCTTTGG - Intergenic
1011101395 6:83726919-83726941 AAGGACAGAGACCCTGCCCTGGG + Intergenic
1012478926 6:99646390-99646412 ATGGCCACAGCACTTGCCTTTGG + Intergenic
1016367935 6:143339194-143339216 AAATCCAAAGTCCTTGCCTTAGG + Intronic
1019537412 7:1536484-1536506 AGGGCCAGAGACGCAGCCTTAGG - Intronic
1024361692 7:48475319-48475341 AAGACCAGAGAACTGGCCTTGGG - Intronic
1028021513 7:85781127-85781149 AAGGCTAGAGACTTAGCATTAGG + Intergenic
1032169930 7:129576169-129576191 GAGGCCAGAGGCCATGTCTTTGG - Intergenic
1032804052 7:135338640-135338662 AAGGCCAGAGACAGGCCCTTAGG - Intergenic
1033218644 7:139512929-139512951 AAAGCCAGAGATCTTGCCAAGGG - Intergenic
1034947181 7:155269974-155269996 AAGGCCAGCATCCTTGGCTTCGG - Intergenic
1035764284 8:2093004-2093026 AAAGCCAGTGACCCTGCCTTTGG + Intronic
1035875318 8:3182541-3182563 ACAGCCAGAGTCCTTGCCTGGGG - Intronic
1036615482 8:10384342-10384364 AAAGCCAGAGCTCCTGCCTTTGG + Intronic
1037776797 8:21840944-21840966 AGGAACAGGGACCTTGCCTTGGG + Intergenic
1037781722 8:21873946-21873968 AATGCCCCAGAGCTTGCCTTTGG - Intergenic
1041593522 8:59619733-59619755 AAGGTCAGAGACTTTACTTTTGG - Intergenic
1043604145 8:81978981-81979003 AAGGGAAGAGAACTTGCCATTGG + Intergenic
1047242220 8:123101147-123101169 AAGGCCAGAGATGTGGCTTTGGG - Intronic
1049205925 8:141363603-141363625 AAGGCCAGACCCCTGGGCTTGGG + Intronic
1051585552 9:18723115-18723137 AAGGGCAGACACCTCGCCCTAGG - Intronic
1052249467 9:26380400-26380422 AGTGCCAGAGACCTTCCATTGGG + Intergenic
1056318533 9:85415019-85415041 AAGCCCAGAGTCCTGGCCCTTGG + Intergenic
1056864034 9:90213735-90213757 AAGGCCAGACACATGGCATTTGG + Intergenic
1056915863 9:90745685-90745707 AAGGCCAGACACATGGCATTTGG - Intergenic
1057182973 9:93039821-93039843 GAGGCCAGAGCCCAGGCCTTCGG + Intergenic
1059129510 9:111731294-111731316 AAAGCAAGAGACCTAGCTTTTGG + Intronic
1059537937 9:115100559-115100581 AAATCCAGAGATTTTGCCTTTGG + Intronic
1060840407 9:126789005-126789027 AGGGCCAGAGAGCTTTCCTGAGG - Intergenic
1061561679 9:131408193-131408215 AAGGCCCGAGACCTCTCATTAGG - Intronic
1185481425 X:449296-449318 AAAGCCAGACATCTTGTCTTGGG - Intergenic
1187122772 X:16425275-16425297 AAGGCCAGTGTCCATTCCTTTGG - Intergenic
1189237054 X:39495197-39495219 AAGGCCAGCTTTCTTGCCTTGGG - Intergenic
1189237888 X:39502283-39502305 AGGGCCAAAGACCTGGCCTTGGG - Intergenic
1193537712 X:82733974-82733996 AAGGCCTGAGACCTTGGGTGTGG + Intergenic
1195045993 X:101055122-101055144 CAGGCCAGAGAATTTACCTTTGG + Intergenic
1199948063 X:152683079-152683101 CAGGCCAGGGACCTCTCCTTGGG - Intergenic
1199961616 X:152785375-152785397 CAGGCCAGGGACCTCTCCTTGGG + Intergenic
1201239921 Y:11948817-11948839 ACTTCCAGAGACCTTGCCTTGGG + Intergenic
1201930904 Y:19345798-19345820 CAGGGCTGAGATCTTGCCTTAGG + Intergenic