ID: 1089736077

View in Genome Browser
Species Human (GRCh38)
Location 11:120551032-120551054
Sequence CCTTCTCAAGGCCTTCATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089736077_1089736087 21 Left 1089736077 11:120551032-120551054 CCAGAATGAAGGCCTTGAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 183
Right 1089736087 11:120551076-120551098 ACGAATGGTTTGGCCTCTTATGG 0: 1
1: 0
2: 0
3: 6
4: 53
1089736077_1089736088 22 Left 1089736077 11:120551032-120551054 CCAGAATGAAGGCCTTGAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 183
Right 1089736088 11:120551077-120551099 CGAATGGTTTGGCCTCTTATGGG 0: 1
1: 0
2: 0
3: 2
4: 55
1089736077_1089736086 11 Left 1089736077 11:120551032-120551054 CCAGAATGAAGGCCTTGAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 183
Right 1089736086 11:120551066-120551088 GATTCACGAGACGAATGGTTTGG 0: 1
1: 0
2: 1
3: 1
4: 19
1089736077_1089736085 6 Left 1089736077 11:120551032-120551054 CCAGAATGAAGGCCTTGAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 183
Right 1089736085 11:120551061-120551083 GCTGGGATTCACGAGACGAATGG 0: 1
1: 0
2: 0
3: 2
4: 53
1089736077_1089736089 28 Left 1089736077 11:120551032-120551054 CCAGAATGAAGGCCTTGAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 183
Right 1089736089 11:120551083-120551105 GTTTGGCCTCTTATGGGAGCAGG 0: 1
1: 0
2: 1
3: 12
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089736077 Original CRISPR CCTTCTCAAGGCCTTCATTC TGG (reversed) Intronic
903369239 1:22824626-22824648 CCTTCTCCGGGGCTTCATTCTGG - Intronic
903454463 1:23477630-23477652 CCTCGTCAAGGCCTTCTTTGAGG - Intronic
905313701 1:37067842-37067864 CCTTCTCAAAGGCTTCATTTGGG + Intergenic
905393957 1:37655587-37655609 CCTCCTCAAGGTGCTCATTCTGG + Intergenic
906078552 1:43069040-43069062 CCTGCTCATGGCCTTCTGTCTGG + Intergenic
907939780 1:59076480-59076502 CCTTCTAAAGGGCTGTATTCAGG - Intergenic
912211893 1:107565623-107565645 CATTCTTAAGGCCTTTCTTCTGG - Intergenic
912628218 1:111223616-111223638 CCTTCTCAAAGCTTGCTTTCAGG + Intronic
914582906 1:149034945-149034967 CCTTCTCAAGTCCCTCTTTAAGG - Intronic
917139628 1:171822599-171822621 CCTTCTCATGACCTTCCGTCTGG - Intergenic
917216801 1:172687454-172687476 CCTTCTCCATGCCCTCCTTCAGG + Intergenic
920335067 1:205239521-205239543 CCTTCTCAAGAACTGAATTCTGG - Intronic
920574778 1:207051268-207051290 CAATCTCCAGACCTTCATTCAGG - Intronic
1063475068 10:6321106-6321128 TCTTCTCAAAGCCTTCCCTCTGG + Intergenic
1064161441 10:12950057-12950079 TCTTCTCCATGCCTTCACTCTGG + Intronic
1068033707 10:51734532-51734554 CCTTCTCAAGGCCTACATTTGGG - Intronic
1068932058 10:62601332-62601354 CCTTCTCAAGCCCTTCTGTAAGG + Intronic
1070590646 10:77798343-77798365 CCTCCTCAGAGCCTTCACTCGGG - Intronic
1070808803 10:79286928-79286950 CCGTCTCAAGGCCATCAGCCTGG + Intronic
1073170501 10:101503813-101503835 CCTTCTCAAAGGCTTTTTTCAGG + Intronic
1073566505 10:104539966-104539988 CCTTGTCAAGGGCTTCTTTGGGG - Intergenic
1073612357 10:104957075-104957097 CCTTCTCAGGTACATCATTCAGG + Intronic
1076630358 10:131848648-131848670 CCTCCTCTCGGCCTTCCTTCAGG + Intergenic
1079241775 11:18726856-18726878 TCTTCTCAAGGACTTCCATCTGG + Intergenic
1079839946 11:25383494-25383516 CACTCTCAATGCCTTCTTTCTGG + Intergenic
1080637680 11:34138161-34138183 CCTCCTCAAGGCCTGCACTCTGG - Intronic
1081501843 11:43674746-43674768 CCACATCAAAGCCTTCATTCCGG + Intronic
1082848993 11:57748667-57748689 TCTTCTCAATGCCTTAATTCAGG + Intronic
1083420391 11:62549212-62549234 CCTTCTCTAGCCCTCCAGTCTGG - Intronic
1083683335 11:64361302-64361324 CCTGCTCTGGGCCTGCATTCTGG + Intronic
1084219773 11:67670811-67670833 CCTCCTCCAGGCCCTCATGCAGG - Intronic
1088470591 11:110184585-110184607 CCATCTCCAGGGCTTCCTTCAGG - Intronic
1089736077 11:120551032-120551054 CCTTCTCAAGGCCTTCATTCTGG - Intronic
1090383962 11:126345812-126345834 CATTCTCAAGGCCTTCCCACAGG - Intergenic
1092676911 12:10930753-10930775 CCTGCTGAGGGCCATCATTCTGG - Exonic
1097023356 12:56036050-56036072 AGTTCTCAAAGCCTACATTCAGG + Exonic
1100697376 12:97110378-97110400 CTTGCTCAAAGCTTTCATTCTGG + Intergenic
1101528602 12:105554581-105554603 CCTTATCCAGGCCCTCATGCAGG - Intergenic
1101724065 12:107374947-107374969 CCATCCCAAAGCATTCATTCAGG - Intronic
1102937998 12:116913592-116913614 CATTCTCATTGCCTTCATGCTGG + Intronic
1103019793 12:117524943-117524965 CCAGCTCAAGGCCTTCAAGCGGG - Exonic
1103973206 12:124685342-124685364 CCTTCTCCAGGACAGCATTCGGG + Intergenic
1106217734 13:27718294-27718316 ACTTCTCAGGACCTGCATTCTGG + Intergenic
1106351681 13:28936811-28936833 CCACCACAAGGTCTTCATTCAGG - Intronic
1107974457 13:45675924-45675946 CCTTCTCAAGGGGGTCATTGGGG + Intergenic
1111540194 13:89659122-89659144 CCTTCTCAAGGACTTCAGAGGGG - Intergenic
1113131671 13:107043500-107043522 CAGTCTCAAGGCATTCTTTCAGG + Intergenic
1116359931 14:43981335-43981357 GCTTCTCAAGACTATCATTCAGG + Intergenic
1118149316 14:63172826-63172848 CCATCTCAGGGTCTTCTTTCAGG - Intergenic
1118282795 14:64444456-64444478 CCTTCTCACCTCCTTAATTCAGG + Intronic
1118740667 14:68737235-68737257 CCTCCTCCAGGCCTCCATCCAGG + Intergenic
1118975849 14:70675996-70676018 ACTCCTATAGGCCTTCATTCAGG + Intergenic
1119758821 14:77137407-77137429 CCATTTCAAGGTCTTCCTTCTGG + Intronic
1124841481 15:33245828-33245850 CCTTTTCAAGGTCTGAATTCAGG + Intergenic
1125289211 15:38127252-38127274 CATTCTGAAGGACTTCAGTCAGG + Intergenic
1129199517 15:73990565-73990587 CCTTCTCAGGGCTCTCAATCTGG + Intronic
1129348983 15:74943122-74943144 ACAGCTCAGGGCCTTCATTCTGG + Intergenic
1132293269 15:100717917-100717939 CCTTCTCCAGTCCTTCTTTCAGG - Intergenic
1133497225 16:6330436-6330458 CCTTTTCAAAGCCTTCATAGTGG - Intronic
1134559756 16:15198198-15198220 CCATCTCAAGGCCTTCACACAGG + Intergenic
1134920295 16:18109809-18109831 CCATCTCAAGGCCTTCACACAGG + Intergenic
1135817916 16:25652816-25652838 CTACCTCAAGACCTTCATTCTGG + Intergenic
1138762918 16:59565539-59565561 AATTCTCAAGTCCTTGATTCTGG - Intergenic
1141904956 16:87018524-87018546 CCATCTCTAGATCTTCATTCTGG - Intergenic
1144552397 17:16252811-16252833 TCTTCTCATGGGCTTCTTTCTGG + Intronic
1148025689 17:44586023-44586045 CCTTCTCCAGGGCTTGCTTCTGG + Intergenic
1148223951 17:45885154-45885176 CCTTCTCAACTCTTTCATCCCGG + Intergenic
1155984350 18:32214128-32214150 CCTGCTCAATACCTTCCTTCTGG - Intronic
1157601181 18:48894070-48894092 CCTTCTCCTGGCCTTCATCTTGG - Intergenic
1159402276 18:67954011-67954033 CCTCCTCAAGGCCCTGATTGTGG - Intergenic
1161278605 19:3433305-3433327 CCTTCACACAGCCTTCATCCGGG - Intronic
1161807707 19:6454558-6454580 CCGCCTCAAGGTCTTCATGCAGG - Exonic
1164435346 19:28223901-28223923 CCTTTTCAAGGTTTACATTCTGG + Intergenic
1165326117 19:35115497-35115519 CCTCCTCCAGGCATTCCTTCCGG - Intergenic
1166318502 19:42002412-42002434 CCTTCTCAAGGACATCCCTCCGG - Intronic
1166941651 19:46370503-46370525 CCTTCTCAAGGGCCTCACGCAGG - Intronic
1167466700 19:49653976-49653998 CCTGCTCAAGCCATTCTTTCTGG - Intronic
1167868054 19:52344273-52344295 CCTTCCCCAGGCCTTTGTTCTGG + Intronic
926344532 2:11933193-11933215 CCTGCTGAAGGCCTGCTTTCTGG + Intergenic
929228670 2:39537259-39537281 CCTTCTCATGGCCTTGTATCTGG + Intergenic
930303351 2:49645669-49645691 CCTTGTAAAGTCATTCATTCAGG - Intergenic
931043127 2:58319634-58319656 CCTTCTCAATACCTCCATCCAGG - Intergenic
931161622 2:59698523-59698545 CCTTCTCCAGGACATCAGTCTGG - Intergenic
936385687 2:112026647-112026669 CGTTGTCTAGGCCTACATTCAGG + Intronic
937285485 2:120748317-120748339 ACTGCTCAAGGCCTTCACTCTGG - Intronic
939464432 2:142539060-142539082 CTCACTCAAGGCCTTCCTTCCGG + Intergenic
940864765 2:158807094-158807116 CCTTCTCCAGTGCGTCATTCAGG - Exonic
942320095 2:174729181-174729203 TCTTCACAAGGCATTCTTTCTGG + Intergenic
945003979 2:205383498-205383520 CTTTCTCAAGCCCTTCAGTGTGG + Intronic
945848369 2:214975701-214975723 AGATCTCATGGCCTTCATTCAGG + Intronic
945901009 2:215537683-215537705 CCTTCACCATGCCTCCATTCTGG + Intergenic
948389034 2:237598864-237598886 CCCTCCCAAGGCCTTGATTTTGG - Intronic
1168968502 20:1914665-1914687 CCTTCTCGGGGCCTGCATCCTGG + Intronic
1168998786 20:2151503-2151525 CCGTCTCAGGGCCTTCACACTGG + Intronic
1169926561 20:10790401-10790423 CCTTCTCAAGGTTTCCTTTCTGG + Intergenic
1169930735 20:10829934-10829956 ACTTCTCATGGTCTTCATTCTGG + Intergenic
1171159067 20:22905140-22905162 CCTTGCCAGGGCCTTCCTTCAGG + Intergenic
1171515847 20:25734345-25734367 CCGTCACTTGGCCTTCATTCGGG + Intergenic
1172080150 20:32334066-32334088 CCGTCTGAGGGCCTTCATGCCGG + Exonic
1172518440 20:35552053-35552075 CCTTCTCCAGGACTTCACTCCGG - Intronic
1177274843 21:18896690-18896712 CCTTCATAAGGACTTCATTGAGG - Intergenic
1178452057 21:32710834-32710856 CCTTCCTAAGGCCTCCATTCTGG - Intronic
1179224064 21:39436987-39437009 GCTTCACAAGGCATGCATTCTGG + Intronic
1179416576 21:41203380-41203402 CCTCCTCAAGGCCGTCGTACTGG - Intronic
1180015849 21:45083101-45083123 CCTTCCTGAGGCTTTCATTCTGG - Intronic
1181108605 22:20588865-20588887 CCTCCTCAAGGTCTGCCTTCTGG + Intergenic
1183163901 22:36133072-36133094 CCTTCTCACCCCCCTCATTCTGG + Intergenic
1183517668 22:38276514-38276536 CCCTCTCAAGACCTTTACTCAGG + Intergenic
949489203 3:4571669-4571691 CCTTCTTTAGGCCTTCATCAGGG + Intronic
950541436 3:13615550-13615572 CCTTCTCAGAGCCTTCACTGTGG + Intronic
950934052 3:16821018-16821040 ACTTCTCTTGGGCTTCATTCAGG - Intronic
951104458 3:18726782-18726804 CTTACTCAAGTCCCTCATTCAGG + Intergenic
953028458 3:39159454-39159476 CCCTCTCTAGGCCTTCATCTTGG + Intergenic
954816478 3:53285378-53285400 GCTTCTCTAGGGATTCATTCTGG + Exonic
955419185 3:58719921-58719943 CCATCTCCAGGCCTTCGTACTGG + Intronic
956712000 3:72047311-72047333 CCTACTCATGGCGTTGATTCTGG + Intergenic
960190151 3:114694434-114694456 CATTTTCAAGGCTTTCATTGTGG - Intronic
960727047 3:120681182-120681204 ACTTCTCAAACCCTGCATTCAGG + Intronic
964783754 3:160371120-160371142 CCTTCACACGGCCTACACTCTGG + Intronic
964874304 3:161348396-161348418 CTTTCTCAAGGCCATCATTAAGG - Intronic
964918356 3:161864038-161864060 GCTTTTCAAGGTCCTCATTCAGG + Intergenic
965509020 3:169547799-169547821 CCTTCTCATGGCCTTCCCTCTGG - Intronic
965751109 3:171975912-171975934 CCTTCTCATGTACTTCCTTCCGG - Intergenic
970473178 4:16396677-16396699 CCTTCCCAAAGCCTGGATTCTGG - Intergenic
970625126 4:17868828-17868850 CTTTCTCCAGGCTTACATTCTGG + Intronic
973555643 4:52079806-52079828 CCTTCTCAGTGACTTCATCCAGG + Exonic
974039785 4:56847452-56847474 CATTCTCTCTGCCTTCATTCTGG - Intergenic
976400507 4:84601615-84601637 CATTTTAAATGCCTTCATTCAGG + Intronic
976560199 4:86492211-86492233 CCTTCTCGAGACCTACCTTCTGG - Intronic
978072415 4:104490624-104490646 CCTTCTCAGAAGCTTCATTCAGG - Intronic
978830649 4:113080207-113080229 CTTTCTTAATGCCTTGATTCTGG + Intronic
980079376 4:128327852-128327874 TCTTATCAAGGCCTTCAGACAGG + Intergenic
980999172 4:139811591-139811613 ACTTGGCAAGTCCTTCATTCTGG - Intronic
981011893 4:139933573-139933595 GCTTCTCAAGGCCTACATCCTGG + Intronic
985424383 4:189814123-189814145 CCTTCTCATTTCCTTCACTCTGG - Intergenic
986195168 5:5531669-5531691 GCTTCTCAAGGACATCACTCTGG + Intergenic
986744697 5:10733472-10733494 ACCTCTCAAGGCCTCCATTTAGG + Intronic
987302109 5:16606303-16606325 CCTTCTCAAGGTGCTCTTTCTGG + Intronic
988695138 5:33614307-33614329 CATTGTCAAGGCCATCTTTCTGG + Exonic
989833795 5:45957253-45957275 GCTTCTCAAAACCTTCTTTCTGG - Intergenic
990605999 5:57410793-57410815 CCTTCTCAAATCCATCTTTCTGG - Intergenic
996153287 5:120066335-120066357 CCTTTTCAAGTCTATCATTCAGG + Intergenic
996571724 5:124939222-124939244 CCTGCTCAAGGACATCACTCTGG - Intergenic
997105048 5:131008654-131008676 CCTTCACTGGGACTTCATTCAGG - Intergenic
997409282 5:133678811-133678833 ACTTCTCCAGGCCTTAATCCTGG - Intergenic
997910599 5:137868824-137868846 TCTACTCAAGGCCCTCCTTCAGG + Intronic
999157246 5:149466919-149466941 CATTATCAAGGCTTTCATTCAGG - Intergenic
999294923 5:150453222-150453244 CCCTCTCAAAGTCTACATTCTGG + Intergenic
1001307225 5:170584314-170584336 CCTTCTCTAAGCCTACATTAAGG - Intronic
1001534256 5:172487754-172487776 TCTTCTCATGGCCTTCCTTCGGG - Intergenic
1001543608 5:172556391-172556413 CCTTCTCCCTGCCTTCATTCAGG - Intergenic
1006256857 6:32838803-32838825 CCCAGCCAAGGCCTTCATTCTGG + Exonic
1006627495 6:35407480-35407502 CCATCTCCAGGCTTTCAATCTGG + Intronic
1010412760 6:75579375-75579397 CCTTCCCTAGGCCGTTATTCTGG - Intergenic
1011388337 6:86822059-86822081 CCTTCTGAAGGGCTTCACTCTGG + Intergenic
1011806474 6:91078418-91078440 CTGCCTCAAGGCCTTCATGCAGG - Intergenic
1013162044 6:107554219-107554241 GTTTCTCAAGGCCTACATCCTGG - Intronic
1013639680 6:112061033-112061055 ACTTCTCCAGGCCTTCCTTCAGG - Exonic
1014329626 6:120045962-120045984 CCTTCTCAAGAGTTTCAGTCAGG - Intergenic
1014619054 6:123643070-123643092 CTTTCTCATGGCCTTTCTTCTGG - Intergenic
1015112370 6:129607950-129607972 CCTGCTGAAGCTCTTCATTCGGG - Exonic
1015745014 6:136500361-136500383 CCTTCTCAATTCCTTCTTTATGG + Intronic
1015858661 6:137652744-137652766 CCTTCTCAAGCCCTATGTTCTGG - Intergenic
1017015060 6:150093242-150093264 TCCTCTCAAGGCACTCATTCTGG - Intergenic
1017508289 6:155088935-155088957 CTTTATCAAGGACTGCATTCTGG + Intronic
1018953665 6:168394163-168394185 TGTTCTCACGGCCTCCATTCGGG + Intergenic
1019201132 6:170316668-170316690 CCTTCTTAACACCTTTATTCAGG + Intronic
1024938553 7:54738700-54738722 GTTTCTCAAAGCTTTCATTCTGG - Intergenic
1026452461 7:70541140-70541162 CCTTCTCTAGGCCTGCTTTCAGG + Intronic
1029113370 7:98224450-98224472 CCTCCTCAAGCCCCTCAGTCTGG + Intronic
1031005981 7:116472614-116472636 CATCATCAAGGACTTCATTCTGG + Intronic
1031665806 7:124480966-124480988 CATTCTCGGGGCCATCATTCTGG + Intergenic
1032198504 7:129803511-129803533 CATTCTAAAGTCATTCATTCAGG - Intergenic
1034860474 7:154590898-154590920 CCTTGTCGAGGCCATCATTATGG - Intronic
1035233218 7:157479000-157479022 CCTCATAAAGGTCTTCATTCTGG + Intergenic
1036969570 8:13340120-13340142 CTTTCTCCTGGACTTCATTCCGG - Intronic
1037078364 8:14751476-14751498 CCTTTTCATGGCCTTTATTATGG - Intronic
1037157309 8:15719245-15719267 CTATCTTAAGGCCTTCATGCTGG + Intronic
1038228751 8:25681365-25681387 CCTTCAAAGGGCCTTTATTCAGG - Intergenic
1039445278 8:37626207-37626229 CTTTCTCAAGCCCCTGATTCTGG + Intergenic
1039718014 8:40132182-40132204 CCTTCACATGGCCTTCTTCCCGG + Intergenic
1042375060 8:68040492-68040514 CCTTCTCAGGGCCTTTGTACTGG + Intronic
1043756103 8:84005760-84005782 CCTTCTCATTGCCTGCAGTCTGG + Intergenic
1044004296 8:86923019-86923041 CACTCTCAAGGCCCTCCTTCTGG - Intronic
1044531238 8:93310009-93310031 CCTTCTCCAGGTCTCCATTTGGG + Intergenic
1052099571 9:24428815-24428837 CCTACTCAAGGACATCATTACGG + Intergenic
1052228752 9:26121479-26121501 CCTGTTCAAGGACTTCACTCTGG - Intergenic
1052334632 9:27306981-27307003 CCTTATCAGGGCCTTGATTTTGG + Intergenic
1053446928 9:38159740-38159762 ATTACTCAAAGCCTTCATTCTGG - Intergenic
1055376231 9:75650438-75650460 CCTTCTCATGACCTGCAATCTGG + Intergenic
1057833678 9:98427129-98427151 ACATCTCACAGCCTTCATTCTGG - Intronic
1058574920 9:106390504-106390526 CCTCCTCAAAGCCTTTATTTAGG - Intergenic
1059786446 9:117591409-117591431 CCTTCTCAGGGCCCTGACTCTGG + Intergenic
1060276376 9:122186039-122186061 CCTCCACAAAGCCTTCATTACGG - Intronic
1061247520 9:129408338-129408360 CCTTTTCAAGGCTGACATTCTGG - Intergenic
1062304879 9:135899908-135899930 CCTCCTCAAGCCCGTCATTATGG + Intronic
1203781416 EBV:103067-103089 CCTTCTCTAGGCCATTAATCTGG - Intergenic
1189290137 X:39878989-39879011 CTTTCTCAAAGCCAGCATTCTGG + Intergenic
1191760401 X:64641785-64641807 ATTTCTCAAGGGCTTTATTCAGG + Intergenic
1192816267 X:74596077-74596099 CCATCTCTAGACCTACATTCTGG - Intronic
1193578259 X:83230878-83230900 CTGACTCAAGGCCTTCATTAGGG + Intergenic
1196287919 X:113903778-113903800 TCTTCTAAAGTTCTTCATTCTGG + Intergenic
1198439606 X:136650376-136650398 CCTTCACAAAGCCTTCAAACTGG - Exonic
1201336155 Y:12882180-12882202 TCTCTTCAAGCCCTTCATTCTGG + Intergenic
1201672387 Y:16538466-16538488 CATTCTCAGGACCTACATTCAGG - Intergenic