ID: 1089738324

View in Genome Browser
Species Human (GRCh38)
Location 11:120564640-120564662
Sequence GCGGCGTCGGCACCGATGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089738324_1089738331 -2 Left 1089738324 11:120564640-120564662 CCGGGCATCGGTGCCGACGCCGC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1089738331 11:120564661-120564683 GCGAGGGCAGCGCCCGCGGCGGG 0: 1
1: 0
2: 3
3: 30
4: 325
1089738324_1089738335 20 Left 1089738324 11:120564640-120564662 CCGGGCATCGGTGCCGACGCCGC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1089738335 11:120564683-120564705 GAATACTAATGCACCCTAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 100
1089738324_1089738334 19 Left 1089738324 11:120564640-120564662 CCGGGCATCGGTGCCGACGCCGC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG 0: 1
1: 0
2: 0
3: 7
4: 65
1089738324_1089738336 25 Left 1089738324 11:120564640-120564662 CCGGGCATCGGTGCCGACGCCGC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1089738336 11:120564688-120564710 CTAATGCACCCTAAAGGGCACGG 0: 1
1: 0
2: 0
3: 8
4: 76
1089738324_1089738328 -6 Left 1089738324 11:120564640-120564662 CCGGGCATCGGTGCCGACGCCGC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1089738328 11:120564657-120564679 CGCCGCGAGGGCAGCGCCCGCGG 0: 1
1: 0
2: 1
3: 19
4: 171
1089738324_1089738330 -3 Left 1089738324 11:120564640-120564662 CCGGGCATCGGTGCCGACGCCGC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1089738330 11:120564660-120564682 CGCGAGGGCAGCGCCCGCGGCGG 0: 1
1: 0
2: 3
3: 14
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089738324 Original CRISPR GCGGCGTCGGCACCGATGCC CGG (reversed) Intronic
900120173 1:1045488-1045510 GAGGCATCGTCACCGATGGCCGG + Exonic
900589787 1:3454539-3454561 GCGGCGCCGCCACAGGTGCCCGG + Exonic
903822066 1:26111002-26111024 GCGCCGTGGGCACCGCAGCCAGG + Intergenic
906640684 1:47438907-47438929 GCGCCGTAGGCAGCGAAGCCGGG - Exonic
910935711 1:92483763-92483785 GCGGCGGCGGCAACGACGGCGGG - Exonic
1074843286 10:117375442-117375464 GCGGCGGCGGCAGCGGGGCCGGG + Exonic
1075334215 10:121597415-121597437 GAGGCGACGGCTCCGGTGCCTGG - Intronic
1076857898 10:133126619-133126641 GCGCCCTCAGCACCGTTGCCAGG + Intronic
1077047808 11:554072-554094 GGGGCGTCGGCTCCGAGTCCTGG + Exonic
1083923600 11:65793284-65793306 GCAGCGGCAGCACCGATACCTGG - Intronic
1089738324 11:120564640-120564662 GCGGCGTCGGCACCGATGCCCGG - Intronic
1090855407 11:130606310-130606332 GCTGCGTTGGGAGCGATGCCAGG + Intergenic
1100963103 12:99984848-99984870 GCGGCGGCGGCGGCGAGGCCTGG + Intergenic
1103764671 12:123271670-123271692 GCGGCGGCGGCGGCGAGGCCGGG + Exonic
1103800410 12:123533918-123533940 GCGGCGGCGGCTGCGAGGCCGGG + Intergenic
1104660947 12:130611170-130611192 GTGGTGTTGGCAGCGATGCCTGG - Intronic
1104914691 12:132258599-132258621 GCGGCAGCTGCACCGAAGCCCGG + Intronic
1104939033 12:132386312-132386334 GCGGCTGCGGCTCCGAGGCCGGG - Intergenic
1106208403 13:27620489-27620511 GCGGCGGCGGCGGCGATTCCTGG - Intergenic
1106248255 13:27966472-27966494 GCGGGGTTGGCACCGGAGCCTGG + Intronic
1121074867 14:91060079-91060101 GCTGCGCTGGCCCCGATGCCTGG + Intronic
1121767638 14:96501854-96501876 ACGGGGTCGGCACCGCTGCCCGG + Intronic
1122301733 14:100735209-100735231 GGGGCGTCGGCACTGAGCCCTGG - Exonic
1124248882 15:28094870-28094892 GGGGCGACGGCACCGGTGCCAGG + Intronic
1130335354 15:82952912-82952934 GCGGGGCCGGCACCGAGGACTGG - Intronic
1132365125 15:101251563-101251585 GCGGCGGCGGCGGCGCTGCCCGG - Exonic
1133188416 16:4116233-4116255 GCAGCGTCTGCACCGCCGCCCGG - Intergenic
1135776063 16:25258127-25258149 GAGGAGTCGGCACCGGGGCCTGG + Intergenic
1143527218 17:7479590-7479612 GCGGCGGCGGCAGCGGGGCCGGG - Intronic
1150398264 17:64837348-64837370 GAGGCGACGGCACCGGTGTCAGG + Intergenic
1150802447 17:68292253-68292275 GCGGCGTCGGCACAGGTGCATGG + Intronic
1151780144 17:76240264-76240286 GCGGCGCGGGCACCGGGGCCGGG - Exonic
1151857907 17:76736501-76736523 GCGGGGCCGGCCCCGCTGCCTGG - Exonic
1160280487 18:77485606-77485628 GCGGTGTGGGCACAGATGCCAGG - Intergenic
1161022149 19:2015570-2015592 GCGGCGGCGGCCGCGTTGCCGGG + Exonic
1161102375 19:2427504-2427526 GCGGCTTCGGCTCCGATTTCGGG - Exonic
1165243012 19:34482138-34482160 GCAGCGGCGGCCCCGAGGCCGGG + Exonic
1165405603 19:35629139-35629161 GCGACGACGGCAGCGATGGCTGG + Exonic
1166538771 19:43592402-43592424 GCGGCGGCGGCACCACTCCCAGG - Exonic
1168345388 19:55648227-55648249 ACGGCGGCGGCGCCCATGCCCGG - Exonic
934520145 2:95014980-95015002 GCAGCGTCAGCACTGAGGCCAGG - Intergenic
937047139 2:118857782-118857804 GCCGCGTGGACACAGATGCCCGG + Intergenic
938273026 2:129992537-129992559 GCGGCGGCGGCAGCGGTGCTGGG + Intergenic
938443198 2:131353569-131353591 GCGGCGGCGGCAGCGGTGCTGGG - Intronic
946422250 2:219571420-219571442 GCGGCGGCGGCGGCGATTCCCGG + Intronic
1169137201 20:3204349-3204371 GCGGCGCGGCCACCGATTCCAGG + Intronic
1172100892 20:32483569-32483591 GCGGCGGCGGCGCCGCGGCCCGG + Intronic
1172618825 20:36306770-36306792 GGGGCGGCGGCACCGGGGCCCGG + Intronic
1182532081 22:30968655-30968677 GCGGCCACGGGACCGAGGCCCGG - Intergenic
950128817 3:10527883-10527905 GTGGCCACGGCACCGAGGCCTGG + Intronic
955818798 3:62874856-62874878 GCGGCGCCGGCGCCGGAGCCGGG - Exonic
968120135 3:196120290-196120312 GCGGCGTCTGCCCCCATCCCTGG - Intergenic
989011538 5:36877208-36877230 GCGGCGGCGGCGCCGGCGCCAGG + Intronic
1004043939 6:12009131-12009153 GCGGCGGCGGCGGCGCTGCCGGG + Intronic
1004924047 6:20402356-20402378 GCGGCGGCGGCGGCGAAGCCGGG - Exonic
1006839954 6:37022337-37022359 GCGCCGTCGCCACCACTGCCGGG + Exonic
1007531605 6:42547774-42547796 GCTTCTCCGGCACCGATGCCGGG - Intergenic
1017842354 6:158232222-158232244 GCGGCGGCGGCGGCGATGCGGGG + Intronic
1026482402 7:70790216-70790238 GAGGCGGCGGCTCCGAGGCCCGG - Exonic
1026923783 7:74174710-74174732 GCCGCGGCGGCGCCGATGCCCGG + Intronic
1027422976 7:78035148-78035170 GCCGCATCAGCACCCATGCCAGG - Intronic
1033299974 7:140176835-140176857 GCGGCGGAGGCGCCGAGGCCCGG + Exonic
1034306278 7:150047654-150047676 GCGGCGGCGGCGCGGATGGCCGG - Intergenic
1035085487 7:156254113-156254135 GAGCCGTCGGAACAGATGCCAGG + Intergenic
1044832260 8:96261853-96261875 GCGGCGCCGCCACCGCGGCCTGG - Exonic
1049726091 8:144147244-144147266 GCGGGGGCGGCACCGAGACCGGG + Intergenic
1054798628 9:69325385-69325407 GCGGCGGCGGCAGCGGCGCCCGG - Intronic
1060599537 9:124868969-124868991 GCGGGGCCTGCACAGATGCCGGG + Exonic
1062555555 9:137112127-137112149 GCGGCACCGGCCCCGACGCCAGG - Exonic
1195802805 X:108732893-108732915 GCGGCTGCTGCGCCGATGCCCGG + Exonic
1197226948 X:123963103-123963125 GCGGTGTCAGCACCGCTGCTGGG + Intronic