ID: 1089738329

View in Genome Browser
Species Human (GRCh38)
Location 11:120564659-120564681
Sequence CGCCGCGGGCGCTGCCCTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 1, 2: 2, 3: 16, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089738329_1089738336 6 Left 1089738329 11:120564659-120564681 CCGCGAGGGCAGCGCCCGCGGCG 0: 1
1: 1
2: 2
3: 16
4: 190
Right 1089738336 11:120564688-120564710 CTAATGCACCCTAAAGGGCACGG 0: 1
1: 0
2: 0
3: 8
4: 76
1089738329_1089738339 22 Left 1089738329 11:120564659-120564681 CCGCGAGGGCAGCGCCCGCGGCG 0: 1
1: 1
2: 2
3: 16
4: 190
Right 1089738339 11:120564704-120564726 GGCACGGCCGCCGCCGCAGCAGG 0: 1
1: 0
2: 0
3: 35
4: 390
1089738329_1089738334 0 Left 1089738329 11:120564659-120564681 CCGCGAGGGCAGCGCCCGCGGCG 0: 1
1: 1
2: 2
3: 16
4: 190
Right 1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG 0: 1
1: 0
2: 0
3: 7
4: 65
1089738329_1089738335 1 Left 1089738329 11:120564659-120564681 CCGCGAGGGCAGCGCCCGCGGCG 0: 1
1: 1
2: 2
3: 16
4: 190
Right 1089738335 11:120564683-120564705 GAATACTAATGCACCCTAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089738329 Original CRISPR CGCCGCGGGCGCTGCCCTCG CGG (reversed) Intronic
900513410 1:3070563-3070585 CGCCCGGGCCGCTCCCCTCGAGG + Intronic
900985692 1:6071845-6071867 CGCGGCAGGAGGTGCCCTCGCGG - Intronic
901045584 1:6393683-6393705 CGCCCCAGACGCTTCCCTCGGGG - Intronic
901526228 1:9824590-9824612 CGCCCCGGGACCTGCCCCCGGGG + Intergenic
902823248 1:18956250-18956272 GGCGGCGGGGGCTGCCCTGGCGG - Exonic
902861692 1:19251554-19251576 CGCCGCGGGCTCCGCCTCCGCGG + Exonic
903497371 1:23778653-23778675 CGCCGCGGCCGCTGCCCTCGCGG - Exonic
904941046 1:34165034-34165056 CGCCGCGAGCCCTCCCCGCGGGG + Exonic
905173987 1:36125090-36125112 CGCCGCCCGGGCCGCCCTCGAGG - Exonic
905390809 1:37634482-37634504 CGCGGCGGGCCCTCCCGTCGGGG - Intronic
915463175 1:156081705-156081727 CGCTGCGGGGGCCGCCGTCGGGG + Exonic
918114134 1:181482687-181482709 CGCCGAGGGCGCTGCCTGCGGGG + Intronic
920217251 1:204369645-204369667 CGCTGAGGCAGCTGCCCTCGCGG + Intronic
923079807 1:230642465-230642487 CGGCGCGGGCGCTGCCATGTTGG + Intergenic
1063450020 10:6144973-6144995 CGCCGGGGGCGCTCCCCGCGGGG - Intronic
1071695343 10:87863762-87863784 CCCCGAGGGCGCTGCCCCCGCGG - Exonic
1073105947 10:101032153-101032175 AGCCGCGGGCGCTGCTCCCTTGG - Intronic
1075430443 10:122375268-122375290 CCCCGCGGGCACAGCCCTGGAGG - Intronic
1075616032 10:123891566-123891588 AGCCCAGGGCGCAGCCCTCGAGG - Exonic
1076356085 10:129854876-129854898 CACCAGGGGCGCTGCCCGCGGGG + Intronic
1076374006 10:129971739-129971761 CGGCGGGGGCGCGGCGCTCGGGG - Intergenic
1077106066 11:843142-843164 CGCCTCGGCCTCTGCCCGCGGGG + Intronic
1077386300 11:2271034-2271056 CGCGGCGCGTGCTGCCCCCGGGG - Intergenic
1079163170 11:18012969-18012991 CGCCGCGGGGGCGGCCTCCGAGG + Exonic
1079238393 11:18705787-18705809 CGCCGCGGGGTCCGGCCTCGAGG - Intronic
1081873095 11:46392008-46392030 AGCAGGGGGCGCTGCCCTCCGGG + Intergenic
1082793986 11:57366898-57366920 CCCTGCGGGCTCTGCCCTCATGG - Intronic
1082794367 11:57369096-57369118 CCCTGCGGGCTCTGCCCTCATGG - Intronic
1083885785 11:65572870-65572892 CGCCGCCGGCGCCGCCAACGCGG + Exonic
1087857431 11:103109368-103109390 CGCGGTGGGCGTTGCCCTCTCGG - Intergenic
1089065562 11:115659611-115659633 CGCAGCGGGCACTGCCCGGGGGG - Intergenic
1089499112 11:118922452-118922474 CACCGTGGGGGCTGCCCTCAGGG - Intronic
1089738329 11:120564659-120564681 CGCCGCGGGCGCTGCCCTCGCGG - Intronic
1090002952 11:122977777-122977799 AACCGCGGGGGCTGCCCTCGGGG + Exonic
1094155464 12:27333198-27333220 AGGCGCGGGCGCTTCCCTCGGGG - Intronic
1096647672 12:53047421-53047443 CGCCCCTGGCACTGCCCGCGCGG - Intronic
1102254462 12:111407529-111407551 CTCCTCGGGACCTGCCCTCGTGG + Intronic
1103764667 12:123271659-123271681 CGCCGCCGCCGCCGCCCTCGCGG - Exonic
1103800526 12:123534200-123534222 GGCCGGGGGCGCTGGTCTCGCGG + Intergenic
1108689266 13:52847296-52847318 CGCCGCCGCCGCTGCACTCGGGG - Exonic
1108727794 13:53201121-53201143 CGCCGCCGCCGCTGCCCTCGGGG + Intergenic
1113798847 13:113076037-113076059 CGGCGCGGAGGCTGCCCTCCAGG + Exonic
1114031424 14:18583864-18583886 CACCGCGGGCGCGCCCCTGGTGG - Intergenic
1115320824 14:32077385-32077407 CGCCGGGGCCGCTGCCGTTGAGG + Exonic
1116436155 14:44897382-44897404 CGCCGCGGCGGCTGCCATGGAGG + Exonic
1117315161 14:54566197-54566219 GGCCGCGGGCCATGCCGTCGGGG - Intergenic
1121422515 14:93825224-93825246 CCCCGCGGGCGCCCCCCTCCTGG - Intergenic
1122298776 14:100720132-100720154 GGCCTGCGGCGCTGCCCTCGAGG - Intergenic
1122582159 14:102777669-102777691 CGCCGCGGCCCCTTACCTCGCGG - Exonic
1122788826 14:104175973-104175995 CCCTGCGGGCCCTGGCCTCGGGG + Exonic
1122883773 14:104701533-104701555 AGCCGCCGTCGCTGCCCTCCAGG - Exonic
1123001957 14:105300638-105300660 GGCTCCGGGCGCTGCCCGCGCGG - Exonic
1128880245 15:71236048-71236070 AGCCCCGGGGACTGCCCTCGAGG - Intronic
1129483308 15:75844113-75844135 CGCCGCGGACTCCCCCCTCGGGG - Intronic
1132111568 15:99105571-99105593 GGGCGCGCGCGCCGCCCTCGAGG + Exonic
1133304876 16:4802542-4802564 CGCCGCCGTCGCTGCCATCACGG + Exonic
1136226510 16:28863911-28863933 CGCCGCCGGAGCTAACCTCGGGG + Intronic
1137617701 16:49856947-49856969 CGCCGCCGCCGCTGCCCAGGAGG - Intronic
1140504751 16:75464342-75464364 CGGCGTGGGCGCTGTCCTCCGGG - Intronic
1141830125 16:86505748-86505770 CGGCGGGGCGGCTGCCCTCGCGG + Intergenic
1141959056 16:87392478-87392500 CGCCGCACCCGCCGCCCTCGCGG - Intronic
1142408287 16:89903241-89903263 CACTGCAGGCTCTGCCCTCGGGG + Intronic
1142699343 17:1649775-1649797 CACCCCGGGCGCCGCCCTCCTGG + Exonic
1143781511 17:9231885-9231907 TGCTGAGGGCGCTGGCCTCGGGG + Intronic
1145059708 17:19724849-19724871 CCCCGTGGACCCTGCCCTCGGGG + Intergenic
1145969660 17:28949695-28949717 CCGCGCGCCCGCTGCCCTCGGGG - Intronic
1146057677 17:29589388-29589410 CGACGCGGCCGCAGCCCTCTGGG + Exonic
1146161954 17:30564868-30564890 CTCAGCGGGGGCTGCCCTCAGGG + Intergenic
1147159537 17:38562218-38562240 CGCCGCCCGGGCTGCCGTCGGGG - Exonic
1147429553 17:40363057-40363079 CGCCACCGGCCCTGCCCTCCCGG - Exonic
1148356598 17:46979362-46979384 CGCCGCGGGCGCAGCCTCCCCGG + Intronic
1152111584 17:78360077-78360099 CGCCGCGGAGGCCGCGCTCGCGG + Exonic
1152125546 17:78444566-78444588 CGCCGGGGGCCCCGCCCCCGAGG - Intronic
1152617838 17:81346038-81346060 CCCCGCGGCCGCCGCCCTCCGGG + Intergenic
1152649299 17:81484524-81484546 GGCTGCGCGCGCTGCCCACGCGG - Intergenic
1152759049 17:82098746-82098768 CGCCGCCGTCGCTGCCCGCGCGG + Intergenic
1153226786 18:2906274-2906296 CGCTGTGGCCGCGGCCCTCGTGG + Intronic
1155007507 18:21741525-21741547 CGCCGCCGCCGCTGCCGCCGGGG - Exonic
1155054457 18:22171665-22171687 CGCCGCGGCTGCTGCCGCCGCGG - Exonic
1156088810 18:33440756-33440778 CGCCGCCGCCGCCGCCCCCGCGG - Intronic
1156448562 18:37253981-37254003 CGCCCGGGGCGCTGCCGGCGGGG + Intronic
1156502274 18:37567216-37567238 CGCGGCGTGCGCTGCCCCCGCGG + Intergenic
1160613664 18:80108434-80108456 AGGCGCCTGCGCTGCCCTCGTGG + Intergenic
1160837593 19:1132052-1132074 CGGGGCGGGCGAGGCCCTCGGGG - Intronic
1160887051 19:1354974-1354996 CGCCGCCGCCGCTCCCCGCGGGG - Intronic
1161001392 19:1912848-1912870 CGCCCCGGCCGCTGCCCCCCAGG + Exonic
1161073922 19:2275899-2275921 CGCTGCAGGCGCTGCTCTGGGGG - Exonic
1162030916 19:7916920-7916942 CGCCGCCGCCGCCGCCATCGCGG + Exonic
1162954294 19:14089946-14089968 CGGCGCCGCCGCTGCCCCCGAGG + Exonic
1163157884 19:15449275-15449297 GGTTGCAGGCGCTGCCCTCGGGG + Intronic
1163426726 19:17244561-17244583 CGGCGCGCGGGATGCCCTCGAGG - Intronic
1163666532 19:18606401-18606423 CGCCCCCGGCGCAGCCCTCGGGG - Intronic
1165320416 19:35081371-35081393 GACCGCGGGCTCTGCCCTTGGGG + Intergenic
1165454019 19:35900471-35900493 CGCCGAGGCCGCGGCCCTGGGGG - Exonic
1166746864 19:45145789-45145811 CGCAGGGGGCTCTGCCCTCTCGG - Exonic
1167040889 19:47021794-47021816 CGCTGGGGGCGCCGCCCTGGGGG + Exonic
1167058787 19:47130652-47130674 CCCCGAGGGCGTTGCCCACGTGG - Intronic
1167843280 19:52139486-52139508 GGCAGCGGGCGCTCCCCTCCAGG + Intronic
1168130147 19:54312552-54312574 CGCCGTGAGCCCTGCCCTCATGG - Exonic
925927286 2:8679287-8679309 CGCCGCGGGGCCTGCCCTAGAGG + Exonic
926096034 2:10080781-10080803 CGCAGCGCGCGCAGCCCTCAGGG - Intronic
926166212 2:10523260-10523282 AGCCGCAGGTGCTGGCCTCGGGG + Intergenic
926374068 2:12209401-12209423 CTCCCCGGGTGCTGCCCTCCAGG - Intergenic
927552134 2:24010059-24010081 GCCCGCGGCCGTTGCCCTCGGGG - Exonic
928606423 2:32947852-32947874 CTCCGCGGGCGGTGCGCGCGAGG - Intronic
933791708 2:85888693-85888715 TGCCCTGGGCGCTGCCCGCGGGG + Intronic
936403189 2:112181743-112181765 CGCCGGCCACGCTGCCCTCGGGG - Exonic
940748534 2:157597509-157597531 CCCCGCGGGAGCTGTCGTCGGGG - Intronic
942045135 2:172095586-172095608 CCCCGCGGGAGTTCCCCTCGCGG - Intergenic
942061899 2:172234972-172234994 CGCCGGGGGAGCCGCGCTCGGGG + Intergenic
944070007 2:195657620-195657642 CACCCCGGGCGCGGCCCGCGAGG - Intronic
945251258 2:207768203-207768225 CGCCAGGGGCGCCGGCCTCGGGG - Exonic
945649140 2:212538065-212538087 CGGTGCGGGTTCTGCCCTCGGGG + Intronic
946921468 2:224585301-224585323 CGCCGCCGCCGCCGCCATCGCGG - Exonic
947841327 2:233209596-233209618 GGCTGCAGGCGCTGCCCTCCAGG - Intergenic
948824646 2:240568396-240568418 CGCCGGGGGCGCTGTGCGCGGGG - Intronic
948910250 2:240999098-240999120 CGCCCCGGCCGCTGCCCGCCGGG + Intronic
948920940 2:241065638-241065660 CGGGGCCAGCGCTGCCCTCGAGG - Intronic
1172118522 20:32584896-32584918 CGCCGCGCCCGGCGCCCTCGGGG + Intronic
1172146658 20:32762442-32762464 CTCCGCGGCCGCAGCCCGCGTGG + Exonic
1172474528 20:35226884-35226906 CGCCGCCGCCGCCGCCCGCGCGG - Exonic
1173729212 20:45316987-45317009 TGGCGCGGGCGCAGCCCTCCAGG - Exonic
1175715806 20:61253373-61253395 CGCCGCGCTCTCTGCCCCCGCGG - Intronic
1176178184 20:63738319-63738341 CGCAGGGTGCGCTGGCCTCGAGG + Exonic
1176194812 20:63831982-63832004 CACCTCGGGCGCAGGCCTCGTGG + Intergenic
1176423220 21:6532752-6532774 CGCAGCGGACGCTCCCCACGAGG - Intergenic
1176548356 21:8211506-8211528 CGCCGCGGGCCTCGCCCTCCGGG - Intergenic
1176567287 21:8394541-8394563 CGCCGCGGGCCTCGCCCTCCGGG - Intergenic
1176575186 21:8438751-8438773 CGCCGCGGGCCTCGCCCTCCGGG - Intergenic
1179561595 21:42219239-42219261 CGCCGCCGCCGCCGCCCCCGGGG + Exonic
1179698713 21:43141068-43141090 CGCAGCGGACGCTCCCCACGAGG - Intergenic
1179821515 21:43939923-43939945 AGCTGCGGGCTCTGCCGTCGGGG - Intronic
1179976842 21:44873309-44873331 GGCCGCGGGAGCTGCCGTCGCGG - Intronic
1180064223 21:45404871-45404893 AGCCTCGGGCGGTTCCCTCGGGG + Intergenic
1180080301 21:45483596-45483618 CGCCCCCGGAGGTGCCCTCGAGG + Intronic
1180455537 22:15510921-15510943 CACCGCGGGCGCGCCCCTGGTGG - Intergenic
1180614902 22:17120686-17120708 CGCCGCGGCCGGGGCCGTCGGGG - Exonic
1180950665 22:19719140-19719162 CGCCGCTGCCGCCGCCCCCGCGG + Intronic
1182711342 22:32325239-32325261 AGGTGCGGGCCCTGCCCTCGAGG + Intergenic
1183683656 22:39349861-39349883 CGCGGCGGGCGCAGCTCGCGGGG - Intergenic
1203253235 22_KI270733v1_random:127806-127828 CGCCGCGGGCCTCGCCCTCCGGG - Intergenic
1203261290 22_KI270733v1_random:172887-172909 CGCCGCGGGCCTCGCCCTCCGGG - Intergenic
950487809 3:13283116-13283138 CTCCGCCGGCGCCGCCCCCGGGG + Intergenic
950743138 3:15065337-15065359 CGCGGCGTGCGCTGCCCGCCGGG - Intergenic
952948344 3:38496448-38496470 CGCTGCGGGAGCTGGGCTCGCGG + Exonic
953013649 3:39052203-39052225 CGCCGCGGCCCCACCCCTCGTGG - Intronic
954540650 3:51391314-51391336 CGCCGGGGGCGCTGCCTCCTCGG + Exonic
956681478 3:71785347-71785369 CGCCGGGAGCGCTGCCTGCGTGG - Intergenic
958638539 3:96776878-96776900 GGCGGCGGGCGCGGCCCGCGGGG - Intergenic
961545296 3:127629139-127629161 CGCCGCCGCCGCCGCCCGCGCGG + Intergenic
962222296 3:133573988-133574010 GGCGGCGGGCGCGGCCCGCGGGG - Exonic
964622617 3:158732299-158732321 CCCCGCGGGCGCCGCCACCGGGG + Exonic
966362832 3:179148533-179148555 CGCCGCCGCCGCCGCCCGCGGGG + Exonic
969225339 4:5793664-5793686 CGCCGCGGATGGTGCCCTCGTGG - Exonic
969278106 4:6150557-6150579 CGCCGTGGGAGCTGCCTCCGAGG - Intronic
969436636 4:7192726-7192748 CGCCGCGCTCGCCGCGCTCGCGG + Exonic
973945233 4:55948756-55948778 GGCCGCGGGCGCCGACCTCCAGG + Intergenic
983077677 4:163344508-163344530 GGCCGGGGGCGCAGCCCGCGGGG + Exonic
984972491 4:185203719-185203741 CGCCGCGGGCGCCCCTGTCGTGG + Intronic
998424212 5:142013075-142013097 CGCCGCGTGCGCCGCCCGCCGGG + Intergenic
1002102932 5:176866280-176866302 CGCCTCAGGCACTGCCCTCCAGG + Intronic
1002784921 6:393158-393180 CGCCTCGGCCGCCGCCCTCCAGG - Exonic
1003290554 6:4775901-4775923 CGGCGCGGCCGCTGCCGTCGGGG + Intronic
1004216944 6:13711807-13711829 CGCCGCGGCCGCTGCTCTCGCGG + Intergenic
1005303843 6:24495296-24495318 CGCCGTGCGCGCTGCCTACGAGG + Exonic
1006932589 6:37696993-37697015 CGGCGGGGCCGCTGCCCGCGTGG + Exonic
1007473317 6:42104527-42104549 CGCCCCGGGCGGCGCCCTCCAGG + Exonic
1013793527 6:113859850-113859872 GGCCGCCGCCGCTGCCCCCGAGG + Exonic
1016010792 6:139135630-139135652 CGCCGCGGGGGCTGCGGCCGCGG + Exonic
1016738971 6:147508627-147508649 CGCCGCCGACGCTGCCGCCGCGG - Intergenic
1017497737 6:154995893-154995915 CGCAGCGGGCGCTCCCCTCCGGG - Intronic
1017671962 6:156777685-156777707 CGCCGCCGCTGCTGCCCGCGCGG - Intergenic
1019343040 7:517504-517526 GGCCGCGGGCGCTGACCGTGTGG - Intronic
1019562634 7:1666080-1666102 CGCCGCCGCCGCCGCGCTCGGGG + Intergenic
1019724754 7:2595389-2595411 CTCAGCGGGCACTGCCCTCTGGG + Intronic
1022106157 7:27199456-27199478 CGCCGCCGCCGCCGCCTTCGCGG - Exonic
1022723039 7:32957635-32957657 CGCCACGGGCGCTGCCTGCCCGG - Exonic
1022739713 7:33109389-33109411 CGCCGCGGGGGTTGCCCGAGCGG - Exonic
1026776831 7:73235699-73235721 CGCAGCCGGCGGTGCCCCCGCGG + Intergenic
1027017680 7:74789069-74789091 CGCAGCCGGCGGTGCCCCCGCGG + Exonic
1027070342 7:75156863-75156885 CGCAGCCGGCGGTGCCCCCGCGG - Intergenic
1027421337 7:78020125-78020147 GGGCGCGGCCGCTGCCCTCTCGG - Intronic
1028160135 7:87475798-87475820 GGCGGCGGGAGCTGCTCTCGCGG - Intronic
1029701371 7:102248757-102248779 CGCCGCGCCCGCGGCCCCCGAGG + Exonic
1034578927 7:152025927-152025949 CGCCGCCGCCGCAGCTCTCGAGG - Intronic
1037813813 8:22101710-22101732 CGACGCGGGAGCTGCACTCCTGG - Exonic
1037886836 8:22599865-22599887 CGGCGCGGGCTCCGCCCGCGGGG - Intronic
1042307074 8:67343509-67343531 CCCGACGGGCGCGGCCCTCGAGG - Exonic
1042561061 8:70072191-70072213 CGCCCCGGGCGCGGCCTTCGGGG + Intergenic
1044698854 8:94949036-94949058 GGCCGCGCGCCCTGCCTTCGGGG - Intronic
1046031456 8:108787596-108787618 CGTGGCGGGCGCTGCCCACCCGG - Exonic
1049643634 8:143726605-143726627 CTCCGCGGGCCCGGCCTTCGGGG + Exonic
1049721180 8:144116205-144116227 CCCCGCGCCCGCTGCCCCCGCGG + Exonic
1049988538 9:972705-972727 CGCCGCGGGCGCTCCCGACAGGG + Intergenic
1050091005 9:2016462-2016484 CGCCGCGGGAGCTGCGGGCGTGG + Intronic
1052888918 9:33677318-33677340 CGCTGCCGGCGCCGCCCCCGCGG + Intergenic
1056143545 9:83707583-83707605 CCCCGCGGCCGCTGCCTCCGCGG - Exonic
1058058590 9:100473367-100473389 CGCCGCGGGCCCGGGCCTGGCGG + Exonic
1059102520 9:111483998-111484020 CCCCGCGTGCGCTCCCCGCGCGG + Exonic
1060629570 9:125143451-125143473 CGCCGCGGGAGCTGCTCCGGCGG + Exonic
1060700474 9:125746546-125746568 CGCCGCCGGCACCGCCCCCGGGG - Intergenic
1062305959 9:135907314-135907336 CGCCGCCGTCGCCGCCCCCGCGG + Intergenic
1203469637 Un_GL000220v1:110953-110975 CGCCGCGGGCCTCGCCCTCCGGG - Intergenic
1203477458 Un_GL000220v1:154925-154947 CGCCGCGGGCCTCGCCCTCCGGG - Intergenic
1190554426 X:51618786-51618808 CGCCGCCTGCGCGGCCATCGCGG - Intergenic
1190560727 X:51682744-51682766 CGCCGCCTGCGCGGCCATCGCGG - Intergenic
1190563564 X:51710577-51710599 CGCCGCCTGCGCGGCCATCGCGG + Intergenic
1195954799 X:110317834-110317856 CGCCGCCGCCGCAGCCCTGGGGG + Exonic
1198750415 X:139932511-139932533 CTCCGCGGCCGCCCCCCTCGGGG + Intronic
1200239497 X:154486404-154486426 AGCCGGGAGAGCTGCCCTCGGGG - Intronic