ID: 1089738334

View in Genome Browser
Species Human (GRCh38)
Location 11:120564682-120564704
Sequence GGAATACTAATGCACCCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089738324_1089738334 19 Left 1089738324 11:120564640-120564662 CCGGGCATCGGTGCCGACGCCGC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG 0: 1
1: 0
2: 0
3: 7
4: 65
1089738327_1089738334 6 Left 1089738327 11:120564653-120564675 CCGACGCCGCGAGGGCAGCGCCC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG 0: 1
1: 0
2: 0
3: 7
4: 65
1089738329_1089738334 0 Left 1089738329 11:120564659-120564681 CCGCGAGGGCAGCGCCCGCGGCG 0: 1
1: 1
2: 2
3: 16
4: 190
Right 1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG 0: 1
1: 0
2: 0
3: 7
4: 65
1089738323_1089738334 30 Left 1089738323 11:120564629-120564651 CCTGGAGGTGGCCGGGCATCGGT 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG 0: 1
1: 0
2: 0
3: 7
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089738334 Original CRISPR GGAATACTAATGCACCCTAA AGG Intronic
900838960 1:5031977-5031999 AAAATAATAATGCACCCCAAAGG - Intergenic
903077089 1:20779289-20779311 GGAGTACTAATGCTCCTTTATGG - Intronic
911325294 1:96464259-96464281 AGAATACTAAAGCAGCCTGATGG + Intergenic
922540042 1:226411933-226411955 GAGATTCTAATGCACCCGAAAGG - Intergenic
1063915285 10:10875922-10875944 GGAATATAAATGCACCATTAAGG - Intergenic
1068243005 10:54329163-54329185 GGAATTCTAAGGTACACTAAAGG - Intronic
1069908215 10:71744577-71744599 GGAATGCTTATGCTCCCCAAGGG - Intronic
1077898749 11:6473750-6473772 GGAATACAAACGCACCCTTGGGG + Intronic
1078630613 11:13000515-13000537 GGGATTCTTATGCACACTAAAGG - Intergenic
1084471120 11:69359444-69359466 GGGATACTAACGCACCCTACAGG + Intronic
1086535318 11:87837302-87837324 GGAATACAGATGTACCCTCATGG - Intergenic
1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG + Intronic
1096719821 12:53512873-53512895 GTGATTCTAATGCACACTAAAGG - Exonic
1099552586 12:84066761-84066783 GGAATACTACTGAGCCATAAAGG + Intergenic
1107730089 13:43339871-43339893 GGAATATTAATGCAGACAAATGG + Intronic
1108225147 13:48281855-48281877 GGAATTCTAAAGAACCCTGAAGG + Intergenic
1109715912 13:66221804-66221826 GGAATACTAATGTTGTCTAAGGG + Intergenic
1118673658 14:68159063-68159085 GGGAAACTAATGCTCCCAAAAGG + Intronic
1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG + Intronic
1125424634 15:39536478-39536500 GGATTGCTGATACACCCTAAAGG - Intergenic
1139281501 16:65774537-65774559 GGAATACTGAGGCCCCCAAAGGG + Intergenic
1140139706 16:72243917-72243939 GGAATTTTAATGAGCCCTAAAGG + Intergenic
1141837204 16:86549636-86549658 GTGATTCTAATGCACACTAAAGG - Intronic
1149368793 17:55971946-55971968 GGAAAACTAGTTCTCCCTAATGG + Intergenic
1156993000 18:43432743-43432765 GGAATACTAATGAATACTAATGG + Intergenic
1157536532 18:48462752-48462774 GGCATACTACTGGACCCTAGTGG + Intergenic
1159532421 18:69671514-69671536 GGAATATTTATGCAACCTGAAGG - Intronic
929019157 2:37533187-37533209 AGAATACTCATGCACCTTAATGG - Intergenic
931357622 2:61550871-61550893 GGACCACTAAAGGACCCTAAAGG + Intergenic
937784965 2:125885934-125885956 GTAATACTAAGACACCTTAATGG + Intergenic
937852331 2:126646957-126646979 GTAATACTAAGACACGCTAATGG + Intergenic
940972536 2:159909271-159909293 GGAATGCTTATGCACACCAATGG - Intergenic
942809257 2:179977376-179977398 GGAATACTATTCAACCATAAAGG + Intronic
945350081 2:208767072-208767094 GGGATTCTAATGCACCCTGAAGG + Intronic
1179053132 21:37906465-37906487 GGGATTCTGATGCACTCTAAAGG - Intronic
1182977919 22:34640700-34640722 AGAATACTGATGAACCCCAATGG - Intergenic
949246125 3:1926691-1926713 GTAATACTAAGACACCCCAATGG - Intergenic
949893899 3:8754793-8754815 GTAATTCTAATGCACCCTCAAGG + Intronic
955936957 3:64111154-64111176 GGAATAATCATACAACCTAAGGG + Intronic
956047803 3:65215011-65215033 GGAATACTTATCCACCCTCATGG + Intergenic
965406017 3:168269959-168269981 GAAATACAAATGAACCATAATGG - Intergenic
969890590 4:10256281-10256303 GGAATACTGATGCTGCCTGATGG - Intergenic
972332857 4:38079948-38079970 GAAATTCTAATGCACACAAAAGG - Intronic
972594804 4:40520160-40520182 GGAATTCTAATACAACCTACAGG - Intronic
974516577 4:62922026-62922048 GGAATACTAATGTATCTTCATGG + Intergenic
984453980 4:179941623-179941645 ATAATGCTAATGCACCCTTATGG - Intergenic
986215330 5:5714323-5714345 GAAATACTATTGCACTCTAAAGG + Intergenic
986815018 5:11399246-11399268 GAGATAGTAATGCATCCTAAGGG + Intronic
987073005 5:14355441-14355463 GGAATATCAATGCCACCTAAAGG - Intronic
988198391 5:28037900-28037922 GGAATAATAAGGCAGCCAAAGGG + Intergenic
990961069 5:61394194-61394216 GGAGTACTGGTGCAACCTAAAGG - Intronic
991632479 5:68670156-68670178 GTGATACTAATGCACATTAAAGG + Intergenic
1002695108 5:181082380-181082402 GGAAGACTAATACTACCTAAAGG + Intergenic
1011988787 6:93485583-93485605 GGACTACTAATGCACATTGATGG + Intergenic
1012143619 6:95653858-95653880 GGAATACTAATCAACTATAAAGG + Intergenic
1014533950 6:122594808-122594830 GTAATACTGAGTCACCCTAATGG + Intronic
1015074383 6:129137349-129137371 GGAATATTAAGGCACCTGAAGGG + Intronic
1016405226 6:143722964-143722986 GGAATATTATTCCACCATAATGG - Intronic
1020813822 7:12879700-12879722 GAAACTCTAAAGCACCCTAATGG + Intergenic
1021384344 7:20009514-20009536 GGAATATTTTTGCACCATAAGGG + Intergenic
1022430553 7:30315535-30315557 AGAATGCAAATGCACTCTAAGGG - Intronic
1029945248 7:104526141-104526163 GGAATTTTCATGCACCATAAGGG - Intronic
1031720486 7:125169327-125169349 TGAACACTAAAGCACCCTGAAGG + Intergenic
1038079505 8:24117941-24117963 AGATTACTAATGCACTCTGAAGG - Intergenic
1045418342 8:101989363-101989385 GCACTACTAATTCATCCTAAAGG + Intronic
1052105887 9:24515384-24515406 GGAGTACTAATTCACTCAAAGGG - Intergenic
1056400781 9:86225244-86225266 GCAATACTAATTACCCCTAAGGG + Intronic
1058491228 9:105501872-105501894 GGAAAACTAAAGGAACCTAAAGG - Intronic
1058919827 9:109603049-109603071 GGAATAGAAATGCATCCGAAAGG - Intergenic
1060173551 9:121480701-121480723 GGAAGACTTCTGGACCCTAAAGG - Intergenic
1193824965 X:86213430-86213452 TGAAAAATAATCCACCCTAAAGG - Intronic
1194108582 X:89802641-89802663 GTAACACTAAGACACCCTAAGGG + Intergenic
1197656212 X:129118927-129118949 GAAATACAAATGCATCCAAAGGG + Intergenic