ID: 1089739336

View in Genome Browser
Species Human (GRCh38)
Location 11:120571634-120571656
Sequence TGAGGGGTGGTGAGAGCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 501}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089739336_1089739341 -9 Left 1089739336 11:120571634-120571656 CCCCTGGCTCTCACCACCCCTCA 0: 1
1: 0
2: 3
3: 54
4: 501
Right 1089739341 11:120571648-120571670 CACCCCTCATCCACCTGGCCTGG 0: 1
1: 0
2: 0
3: 31
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089739336 Original CRISPR TGAGGGGTGGTGAGAGCCAG GGG (reversed) Intronic
900032112 1:379745-379767 TGAGGGGTGGGGAGAGGGGGTGG - Intergenic
900052661 1:607931-607953 TGAGGGGTGGGGAGAGGGGGTGG - Intergenic
900483595 1:2910958-2910980 TGAGGGGTGGTGGGGTGCAGTGG + Intergenic
900600123 1:3499277-3499299 AGAGGGCTGGTCAGAGCCAGGGG + Intronic
900818808 1:4870629-4870651 TGAGGGCTGGAGAGGGCCATCGG + Intergenic
901022419 1:6261856-6261878 TGAGGAGTGGTGATAGCATGAGG - Intergenic
901221378 1:7585849-7585871 AGAGGGGAGGTGGGAGGCAGGGG - Intronic
902132904 1:14279280-14279302 TTAGGGGTGGAGAGAGGCTGGGG + Intergenic
902210525 1:14901369-14901391 GTAGGGGTGGTGGGAGGCAGGGG + Intronic
902770602 1:18643360-18643382 GGAGGGGTGGGGAGAGGCAGCGG + Intronic
903004276 1:20288434-20288456 TGAGAGGTGGCGGGAGACAGAGG - Intergenic
903217769 1:21852630-21852652 TCCGGGGTGGTGAGATCCAAGGG - Intronic
903357064 1:22754794-22754816 ACAGGGGAGGTGAGAGGCAGGGG + Intronic
903695246 1:25201489-25201511 TGGGGGCTGTTGAGAACCAGGGG + Intergenic
903819998 1:26094808-26094830 TAGTGGGTGGTGAGAGCCAGAGG + Intergenic
904090550 1:27941935-27941957 AGAATGGTGGAGAGAGCCAGAGG - Intronic
904597456 1:31655815-31655837 TGAGGTCTGGTGGGAGGCAGAGG - Intronic
905630044 1:39513545-39513567 TGATGTGTGGTTGGAGCCAGTGG + Intronic
905667715 1:39772645-39772667 TGATGTGTGGTTGGAGCCAGTGG - Intronic
905760138 1:40549324-40549346 TGAAGGGGGATGAGAGGCAGGGG - Intergenic
905873254 1:41416744-41416766 TAAGGGATGGAGAGAGCCAGGGG - Intergenic
906083116 1:43107473-43107495 AGAGGGGTGGTGAGGGGCGGGGG + Intergenic
906287567 1:44597603-44597625 TGAGGGGAGATGAGAGAAAGGGG - Intronic
907334219 1:53689852-53689874 TGAAGGCTGGTGAGGGCCAGGGG - Intronic
910292510 1:85613193-85613215 TGAGAGTTGGTTAGAGCCCGAGG + Intergenic
910331959 1:86083677-86083699 TGATAGGTGGTTGGAGCCAGAGG + Intronic
911234053 1:95391010-95391032 GGAAGGTAGGTGAGAGCCAGTGG + Intergenic
911457688 1:98147597-98147619 GGAGGGGTAGTGAGAGAAAGAGG - Intergenic
912119570 1:106453914-106453936 TGGCGTGTGGTGAGAGACAGAGG - Intergenic
912323359 1:108735256-108735278 GGAGAGGTGGTGAGGGCCTGAGG - Intronic
912429503 1:109621429-109621451 TGAGGGGTGGTGGGGGGCGGGGG + Intronic
913166530 1:116192223-116192245 TGTGGAGTGGTGAAAGTCAGGGG + Intergenic
915312043 1:155009778-155009800 TGAGGGGTGGAGAGCCGCAGAGG - Intronic
915897868 1:159825391-159825413 TGAGGAAAGGAGAGAGCCAGAGG - Intergenic
916096018 1:161350947-161350969 TGAGTGGTGGTGACAGTAAGAGG + Intronic
916277432 1:163009812-163009834 TGAGGGGATGTGAGAGGGAGGGG + Intergenic
916528232 1:165631401-165631423 TGGGGGGAGGTTAGAGACAGCGG - Intronic
917059715 1:171023900-171023922 TGAAGGGTGGTGGGAGGCACTGG - Intronic
917335737 1:173922713-173922735 TGAGGGGTGGCTAGAGACAAGGG + Intergenic
918095426 1:181330277-181330299 GGGGTGGTGGTGAAAGCCAGAGG - Intergenic
918204951 1:182300114-182300136 AGAAGGATGGTTAGAGCCAGAGG - Intergenic
919645263 1:200088590-200088612 TGTGGACTGATGAGAGCCAGTGG - Intronic
920284326 1:204868761-204868783 GGAGGGGTGGGCAGACCCAGAGG - Intronic
920366890 1:205452788-205452810 TGTGGGGTGGTAAAAGCAAGTGG - Intronic
921918399 1:220639693-220639715 TTAGGTGAGGTGAGTGCCAGTGG - Intronic
922753891 1:228083383-228083405 TCAGGGGTGGTGAGAGCGGGCGG + Intronic
922790230 1:228307184-228307206 TGAGGGGCTGTGGGAGGCAGGGG - Intronic
922881784 1:228986465-228986487 TGAGGGGTGGAAAGAGGAAGAGG + Intergenic
924424232 1:243935943-243935965 TGGGGAGTGTTGAGACCCAGAGG + Intergenic
924947782 1:248857793-248857815 TGGCAGGGGGTGAGAGCCAGAGG - Intronic
1063446641 10:6122219-6122241 TGGGTGGTGGTGAGTGCCTGTGG - Intergenic
1065760815 10:28981776-28981798 TGAGGGGTGGATAGAGCAACTGG - Intergenic
1067324442 10:45253590-45253612 TGAGGTGGGCTCAGAGCCAGTGG + Intergenic
1068006860 10:51401488-51401510 AGAGGGGTGGTGAAATGCAGAGG - Intronic
1068466403 10:57398720-57398742 TGAGTGGTGGTGTGGGCCTGTGG + Intergenic
1068904453 10:62307490-62307512 TGAGGGGTGGGGTGAGCCATGGG + Intergenic
1069874485 10:71553312-71553334 TGAGGGGTGGTGAGGGCCGGGGG - Intronic
1070219440 10:74424571-74424593 TCTGGGGTGGAGAGAGGCAGGGG - Intronic
1070839674 10:79475411-79475433 TGAGGGGTGGGCAGAGGGAGAGG + Intergenic
1070973930 10:80589861-80589883 TGTGGGGTGGTGAGAGTTTGGGG + Intronic
1072037307 10:91575233-91575255 TGAGGGGTGGTGAGTTGCAGTGG + Intergenic
1073103634 10:101020066-101020088 GGAGTGGTGGTGAGGGCCTGTGG - Intronic
1073444057 10:103570555-103570577 TGGTAGGTGGTGAGAGGCAGAGG + Intronic
1074047202 10:109849946-109849968 AGAGAGGGGGTGAGAGGCAGTGG + Intergenic
1074115900 10:110457436-110457458 TGAGGGGTGAGGAGAGGCTGAGG + Intergenic
1074505042 10:114062398-114062420 TGAGGGGTGTTGAAAGTCATAGG - Intergenic
1074714078 10:116202253-116202275 TGAGGGGTGGGGTGAGTCAGAGG + Intronic
1075088643 10:119430575-119430597 TGAGGGTGGGAGAGAGTCAGTGG + Intronic
1075157466 10:119989993-119990015 GGGGGGGTGGTGAGAGTGAGGGG + Intergenic
1075656416 10:124164560-124164582 TGAGGGGTAGAGAGGGACAGTGG - Intergenic
1075872791 10:125782883-125782905 TGGGGGGTGACGGGAGCCAGGGG - Intergenic
1076032221 10:127169316-127169338 TGAGGGGATGTGAGAGTCAAAGG - Intronic
1076325100 10:129615050-129615072 TGAGGGGTGGGGAGGTGCAGTGG + Intronic
1076328169 10:129644562-129644584 TGAGGCCTGGTGAGAGCCCGTGG + Intronic
1076366805 10:129926567-129926589 TGGGGGGTGGAGACAGCCTGTGG + Intronic
1076575327 10:131462475-131462497 TGAGAGATGGGGAGAGACAGAGG - Intergenic
1076806885 10:132863218-132863240 TGGGAGGTGGTGAGAGCCCTGGG - Intronic
1077094884 11:795087-795109 TGAGGGAGGGTGGGACCCAGGGG + Exonic
1077562219 11:3271126-3271148 TGGGTGGTGGTGGGAGGCAGGGG + Intergenic
1077568113 11:3316946-3316968 TGGGTGGTGGTGGGAGGCAGGGG + Intergenic
1077576375 11:3386968-3386990 TGGGGGGTCCTAAGAGCCAGGGG + Intergenic
1077576433 11:3387130-3387152 TGGGGGGTCCTAAGAGCCAGGGG + Intergenic
1079313892 11:19391180-19391202 TGAGTGGTAGTGAAGGCCAGAGG - Intronic
1079801029 11:24869088-24869110 TCAGGAGTTTTGAGAGCCAGTGG + Intronic
1082079093 11:47997962-47997984 TGAAGGGTGATGCCAGCCAGGGG + Intronic
1083328551 11:61886098-61886120 TGAGGGGTGCTGGGGGACAGGGG - Intronic
1083341305 11:61960040-61960062 TCAGGTGTGGCCAGAGCCAGGGG + Exonic
1083727837 11:64637570-64637592 TGGGGGGTGGGGCGGGCCAGGGG + Intronic
1086150943 11:83610019-83610041 TGAGGAGTGTTGAGACCCTGGGG - Intronic
1087936458 11:104038807-104038829 TGAGAGGTGGGGACAGGCAGTGG + Exonic
1088104556 11:106191693-106191715 TCAGGTGTAGTGAGAGCTAGAGG + Intergenic
1088357528 11:108959542-108959564 AGAGGGGTGGTGGGAGACAAGGG - Intergenic
1088688062 11:112301308-112301330 TAAGGGGACGTGAGAGCCAAAGG - Intergenic
1089273499 11:117316822-117316844 TGCGGGCAGGTAAGAGCCAGTGG + Intronic
1089739336 11:120571634-120571656 TGAGGGGTGGTGAGAGCCAGGGG - Intronic
1091135883 11:133189014-133189036 TGAGGAGTGGGGAGTGGCAGGGG - Intronic
1091269155 11:134293442-134293464 CGAGGGGTGGTGGGAATCAGAGG + Intronic
1091357078 11:134945309-134945331 TTTGGGGTGGTGAAAGCCATGGG - Intergenic
1091658545 12:2363593-2363615 GGAAGGGTGGGGAGAGGCAGAGG - Intronic
1091970979 12:4786810-4786832 TGAGGGGTTGAGAGAGCCACAGG - Intronic
1092119119 12:6031616-6031638 TCTGGTCTGGTGAGAGCCAGTGG - Intronic
1092127171 12:6083091-6083113 TGATGGGTTGCGAGAGGCAGAGG - Intronic
1093103334 12:15054633-15054655 TGAGGGGAGCTGAGAGCATGTGG + Intergenic
1093155359 12:15677765-15677787 TGTGGTGTGTTGAGAGACAGTGG - Intronic
1093239579 12:16653432-16653454 TGAAGGGTGGGAAGAGGCAGAGG - Intergenic
1093268459 12:17028051-17028073 TGGGGGGTGGTGCGGGCCATGGG - Intergenic
1094474010 12:30827554-30827576 TGAGGGGCCGTTAGGGCCAGGGG + Intergenic
1094843106 12:34350133-34350155 GGCGGTGTGGTGGGAGCCAGGGG + Intergenic
1098864059 12:75741959-75741981 TGAGTGGATGTGAGAGACAGAGG - Intergenic
1099070179 12:78036408-78036430 TAAGGGCTGGTGAAAGGCAGGGG + Intronic
1102448171 12:113019786-113019808 GGTGGGGTGGTCAAAGCCAGAGG - Intergenic
1102539805 12:113610556-113610578 TGTGGGGTGGAGAGAGGGAGGGG - Intergenic
1102554549 12:113718354-113718376 TGGGGGTGGGTGAGAGGCAGGGG + Intergenic
1102640334 12:114361427-114361449 CGAGTGGGGGTGAGAGTCAGGGG + Intronic
1103511957 12:121481195-121481217 TGTTGGGTGGTGTGAGCCACCGG + Intronic
1103557853 12:121776578-121776600 TGAGGCGGGGTCAGAGCCACTGG + Exonic
1103930481 12:124448244-124448266 GGAGGGGTGCTGAAAGCAAGGGG - Intronic
1104088004 12:125493519-125493541 TGAGTGGAAGTGAGGGCCAGTGG - Intronic
1104259564 12:127170478-127170500 TGAGGGGCAGTGCCAGCCAGTGG - Intergenic
1105468448 13:20669208-20669230 AGAAGAGTGATGAGAGCCAGAGG + Intronic
1105571448 13:21606866-21606888 TGAGGCAGGGTGAGAGCCTGGGG + Intergenic
1105715180 13:23056055-23056077 GGAGTGGTGGTGAGCGCCTGTGG - Intergenic
1107175647 13:37395275-37395297 TGATGGGTGGTGGGGGACAGGGG - Intergenic
1108207101 13:48101429-48101451 TGAGGGGTGGAGAGAGGCAATGG - Intergenic
1109846938 13:68005505-68005527 TCAGGGATGGTGAGAGGCAGTGG + Intergenic
1112237492 13:97649433-97649455 AGAGGATTGGTGAGACCCAGTGG + Intergenic
1112345093 13:98582798-98582820 TGAGAAGAGGTGAGAGGCAGAGG - Intergenic
1112394360 13:99014881-99014903 TGAAGGGTCTTGAGAGCGAGAGG - Intronic
1112698264 13:101974978-101975000 TGAGGGGCTGGGAGAGGCAGGGG + Intronic
1112957941 13:105084726-105084748 TGAGGGGTGGTGATAGAGACGGG - Intergenic
1113072435 13:106434556-106434578 TGAGGGGTGGTGGTAGCGATGGG - Intergenic
1113961474 13:114128619-114128641 TGTGGGGCAGTGAGGGCCAGGGG - Intronic
1114290645 14:21285668-21285690 TGAGGAGTGTTGTGAGCTAGAGG + Intergenic
1114534959 14:23417019-23417041 TGAGGGCTGCTGAGGTCCAGTGG + Intronic
1115282468 14:31678825-31678847 TGAGCTGTGCTCAGAGCCAGTGG - Intronic
1117999643 14:61511017-61511039 TTAGGGGTGGTGAGAGACTTAGG + Intronic
1118180653 14:63489285-63489307 TGAGGGTATGTGAGAGGCAGTGG - Intronic
1119484215 14:74977709-74977731 TGCGGGGAGGTGGGAGCCAGGGG + Intergenic
1120291648 14:82580943-82580965 TGTGTGGTGGTGAGGGCCAGGGG + Intergenic
1121112329 14:91320925-91320947 TGAGGACTGGGGAGAGCCAGAGG - Intronic
1121406073 14:93720139-93720161 GGGGTGGTGGGGAGAGCCAGGGG + Exonic
1121424719 14:93841671-93841693 TGGGGGGGGGTGAGAGGGAGGGG - Intergenic
1121463436 14:94099279-94099301 GCAGGGGTGGTGAGTGGCAGGGG + Intronic
1122073893 14:99223394-99223416 GGTAGGGTGGTGGGAGCCAGGGG + Intronic
1122769784 14:104092845-104092867 TGAGGGGATGTTAGAGACAGGGG - Intronic
1124002119 15:25768236-25768258 TGTGGGCTGGTGAGCGGCAGGGG + Intronic
1124191472 15:27580826-27580848 TCAGGGGTGCTGAGGGCCAAAGG + Intergenic
1124338133 15:28872592-28872614 TGAGGGGTGGTGGCTGACAGGGG + Intergenic
1125421854 15:39511974-39511996 TGATGGGTGCTGAGAGGCAAAGG - Intergenic
1125481704 15:40085562-40085584 TGAGAGGTGGGGAGAGCGGGAGG - Intergenic
1125694012 15:41620722-41620744 GTAGGGGTGGTAAGAGCAAGAGG - Intergenic
1125722302 15:41851152-41851174 TGAGGAGAGATGAGAGGCAGGGG + Intronic
1126506208 15:49406867-49406889 TGACTGGTGGAGAGCGCCAGTGG - Intronic
1128229931 15:66027382-66027404 TGAGGGATGGTGACTGCCAGTGG - Intronic
1128650710 15:69410781-69410803 TGATGGGTGATGAGCCCCAGAGG + Intergenic
1128706824 15:69842771-69842793 AGAGGGGAGGTGACATCCAGGGG - Intergenic
1129247303 15:74287323-74287345 TGAGGGATGGTGTGAGATAGTGG - Intronic
1129616106 15:77099689-77099711 TGAGGGGTAGAAAGAACCAGGGG - Intergenic
1129632552 15:77277298-77277320 TGAGGGATGGTGAAAGGGAGTGG + Intronic
1129894025 15:79090607-79090629 TGGGGGGAGGGGAGAGCTAGAGG - Exonic
1129975100 15:79815447-79815469 TGAGGGGTGGAGAGGCCTAGAGG - Intergenic
1130151528 15:81315202-81315224 TGAGAGGTGATGCGGGCCAGAGG - Intronic
1130333435 15:82938915-82938937 TGAGAGGTGATGAGACTCAGAGG - Intronic
1130930945 15:88427437-88427459 TGTGGGGTGGTGGGGGGCAGCGG + Intergenic
1132282926 15:100635677-100635699 TAAGGTGTGGGGAGGGCCAGTGG + Intronic
1132648250 16:1008925-1008947 TCAGGGGTGGTGAGAGGCTGAGG + Intergenic
1133014554 16:2933471-2933493 CGAGGCCTGGTGAGAGTCAGGGG - Exonic
1133392389 16:5420902-5420924 GGAGGGGTGGAGGGAGGCAGAGG - Intergenic
1133456339 16:5945723-5945745 TCAGGGGTGGTGATGGACAGTGG - Intergenic
1133702764 16:8324646-8324668 TGAGGGGTGGCTAGAGACAGTGG + Intergenic
1134316828 16:13126624-13126646 AGAGGGGTGGGGAGAGAGAGAGG + Intronic
1136385504 16:29923362-29923384 AGTGGGGTGGGGAGAGGCAGGGG + Intronic
1136428590 16:30184593-30184615 TGAGCGGAGGCGAGAGGCAGAGG + Intronic
1137569514 16:49556280-49556302 TGAAGAGTGATGAGAGCCACAGG - Intronic
1138339428 16:56279064-56279086 TGAGTGGTGGTGGGTGGCAGAGG - Intronic
1138441299 16:57036582-57036604 TGAGGGGTGGTGAGATGGAAAGG + Intronic
1138558216 16:57785301-57785323 GGTAGGGTGGTGAGAGTCAGAGG - Intronic
1138655001 16:58486299-58486321 GGTGTGGTGGTGAGAGCCTGTGG - Intronic
1139008486 16:62603348-62603370 TGAGGAGTGTTGAGAGCTACAGG + Intergenic
1139312576 16:66040003-66040025 TGAGGTCTGGGGTGAGCCAGTGG - Intergenic
1139370903 16:66468926-66468948 TGTGGTGTGGTGGGAGCAAGGGG - Intronic
1140535573 16:75706026-75706048 TGGGGGCTGCTGAGGGCCAGGGG - Intronic
1140744255 16:77967201-77967223 TGAAAGGTGGTGAGAACCATGGG - Intronic
1141048631 16:80740011-80740033 TGGAGGGTGGTGGGTGCCAGAGG + Intronic
1141402624 16:83763850-83763872 TGAGGTGTGATCAGAGCCATTGG + Intronic
1141499862 16:84436488-84436510 GCAGGTGTGGTGAGAGACAGTGG + Intronic
1141764068 16:86047105-86047127 TGAGGGGTGGGGAGGACCTGGGG + Intergenic
1141772125 16:86095927-86095949 TGAGGAGTGGTGGGAGGCACTGG - Intergenic
1141953805 16:87356495-87356517 TGAGTGGAGGCCAGAGCCAGGGG - Intronic
1142257496 16:89021579-89021601 TAAGGTGTGGTGAGGGCCAACGG + Intergenic
1142303631 16:89273817-89273839 TGCTGTGTGGTGACAGCCAGGGG - Intronic
1142899251 17:3002305-3002327 AGAGGGGTGATGAGAAGCAGGGG + Intronic
1143214845 17:5217071-5217093 AGAGGGATGGTGAGAGCCGCCGG - Intronic
1144033436 17:11342331-11342353 TGAGGGGAGGTGGCAGGCAGAGG + Intronic
1144648353 17:16990627-16990649 GCTGGGGTGGAGAGAGCCAGGGG - Intergenic
1144770283 17:17755774-17755796 TGAGGGATGCTGGGTGCCAGGGG - Intronic
1146760259 17:35470804-35470826 TGTGGGGTGGGGAGAGTGAGGGG - Intronic
1147175379 17:38652817-38652839 AGAGGGGTGGGGACAGACAGAGG + Intergenic
1147906923 17:43829594-43829616 TGGGTGGGGGTGAGAGGCAGGGG + Intronic
1148171072 17:45520301-45520323 TGGGTGGTGGTGAGGGTCAGAGG + Intergenic
1148273331 17:46281217-46281239 TGAGGGGTGGGGGGAGCAAGGGG - Intronic
1148278609 17:46329504-46329526 TGGGTGGTGGTGAGGGTCAGAGG - Intronic
1148300819 17:46547366-46547388 TGGGTGGTGGTGAGGGTCAGAGG - Intronic
1148364950 17:47048251-47048273 TGGGTGGTGGTGAGGGTCAGAGG - Intergenic
1148547987 17:48531366-48531388 TGAGGGGTGGGAAGAGTGAGGGG - Intergenic
1148820141 17:50355350-50355372 TCTGGGGTGGTGAGCACCAGAGG - Intronic
1149727280 17:58909242-58909264 GGCGGGGTGGTGAGCGGCAGTGG - Intronic
1150249814 17:63699404-63699426 TGGGGGGTGTTGACAGGCAGGGG + Intronic
1150401684 17:64861897-64861919 TGGGTGGTGGTGAGGGTCAGAGG + Intronic
1150409725 17:64933344-64933366 TGAGGGGTGGGGGGAGCAAGGGG + Intergenic
1150411034 17:64940757-64940779 TCAGGGCTGGTGAGGGACAGAGG + Intergenic
1150437252 17:65163732-65163754 AGAGGTGTGGTGAGAGGAAGGGG + Intronic
1150719657 17:67603493-67603515 TGAGGCTTAGTGAGAGCCAGCGG + Intronic
1150762678 17:67976872-67976894 TGAGGGGTGGGTGGAGCAAGGGG + Intronic
1151441048 17:74129345-74129367 TGAGGGGGAGGGAGAGACAGAGG + Intergenic
1151531937 17:74712253-74712275 TGAGATGTGGGCAGAGCCAGAGG - Intronic
1151819675 17:76490749-76490771 TGAGAGGAGGTGAGAGCTTGGGG - Intronic
1152126855 17:78452126-78452148 TGAGGGGTGAAGCTAGCCAGAGG - Intronic
1152285447 17:79410064-79410086 TGAAGGGTGGAGAGTGGCAGTGG - Intronic
1152452835 17:80393848-80393870 AGAGGGGTGGGCAGTGCCAGAGG - Exonic
1152740743 17:82017254-82017276 GGCCGGGTGGTGAGAGCCCGGGG + Intronic
1153911322 18:9708536-9708558 AGAGGGGTGCGGAGAGCGAGGGG - Intronic
1153956003 18:10096939-10096961 TGAGATGTGATGAGAGACAGAGG + Intergenic
1154133359 18:11755187-11755209 GAAGGGGTGGGGTGAGCCAGGGG - Intronic
1154497599 18:14973992-14974014 TTTGGGGTGGTGAAAGCCATGGG + Intergenic
1155096198 18:22559124-22559146 TGAGTCTTGGAGAGAGCCAGGGG + Intergenic
1155354325 18:24936859-24936881 TGAGCAATGGTGTGAGCCAGTGG + Intergenic
1155514859 18:26614438-26614460 AAAGGGGTGGGGAGAGGCAGGGG + Intronic
1155737409 18:29240762-29240784 ACAGATGTGGTGAGAGCCAGTGG + Intergenic
1156539723 18:37897753-37897775 TGGGGAGGGGTGAGAGCCATGGG - Intergenic
1156673883 18:39504399-39504421 TGAAGGTTGTTGAGAGGCAGAGG + Intergenic
1157643410 18:49242060-49242082 TGGGGTGGGGTGAGAGCAAGTGG - Intronic
1157813997 18:50717883-50717905 TGAGCAGCTGTGAGAGCCAGGGG - Intronic
1158042307 18:53110124-53110146 TCAGGGATAGTGAGAGCAAGTGG - Intronic
1158637840 18:59177099-59177121 AGGGGGGTGGTGTCAGCCAGAGG + Intergenic
1158691996 18:59669226-59669248 TGAGGGGTTATGGGAGCTAGAGG - Intronic
1158693421 18:59681995-59682017 TGAGGTTCGGCGAGAGCCAGAGG + Intronic
1158772441 18:60535844-60535866 TCAGGGGTGTTGATAGCCACAGG + Intergenic
1158976364 18:62715243-62715265 GGAGGAGTGGGGAGAGCCAGGGG - Intergenic
1159956571 18:74522610-74522632 AGAGGGGTAGAGAGAGCAAGAGG - Exonic
1160289249 18:77575388-77575410 AGAGGGGTGGAGAGACCCAGAGG + Intergenic
1160754559 19:750832-750854 TGAGCGGTGCTGAGAGGCGGTGG + Intergenic
1160827939 19:1089425-1089447 TGAGGTGGGGTCAGAGGCAGGGG - Intronic
1160989288 19:1853988-1854010 GGTGGGGTGGGGAGAGGCAGGGG + Exonic
1161155831 19:2731581-2731603 TGGGAGGTGGGGACAGCCAGAGG + Intronic
1161501008 19:4615722-4615744 TGGAGGGAGGTGGGAGCCAGAGG - Intergenic
1161507018 19:4649575-4649597 TCAAGGGCGTTGAGAGCCAGTGG + Intronic
1161646641 19:5456960-5456982 CGAGGGGTGGTGAGGGCTGGGGG + Intergenic
1162158661 19:8696550-8696572 TTTGGGGTGCTGAGAACCAGGGG + Intergenic
1162323790 19:9986513-9986535 TGAGGGGTGGTGTGGGTCTGGGG - Intronic
1162853876 19:13453127-13453149 TGAGGGGTGGTGAGTGCAGGAGG - Intronic
1163609535 19:18293713-18293735 TGTGGGGTGGGGGGGGCCAGAGG + Intergenic
1165305102 19:34998906-34998928 GGATGGGGGGTGTGAGCCAGGGG + Intronic
1165490375 19:36119948-36119970 GGTGGGGTGGAGCGAGCCAGAGG - Intronic
1165553119 19:36605339-36605361 TGAGGCTTGGTGGGTGCCAGGGG + Exonic
1166329551 19:42070119-42070141 TGAGCGGTGGCGGCAGCCAGCGG - Intronic
1167686407 19:50959629-50959651 AGAGGTGTGGAGAGAGGCAGAGG + Intronic
1168096942 19:54121383-54121405 TGAGGTGTGGTGAGAGGATGGGG + Intronic
925304178 2:2837269-2837291 TGAGTGGGGGTGTGAGCCTGGGG - Intergenic
925304204 2:2837353-2837375 TGAGGGAGGGTGTGAGCCTGGGG - Intergenic
925304243 2:2837522-2837544 TGAGGGAGGGTGTGAGCCTGGGG - Intergenic
925615838 2:5743932-5743954 TGTGGGCTTGTGAGAGGCAGAGG + Intergenic
925621014 2:5793002-5793024 GGAGGGGTGGTCAGAGAAAGTGG - Intergenic
926737365 2:16083619-16083641 AGTGGGGGTGTGAGAGCCAGAGG + Intergenic
927652084 2:24919312-24919334 TGGGCGGTGGTGTGAGCCGGGGG - Exonic
927934683 2:27069721-27069743 TGAGGGGTGGTGTGAGGGACTGG - Intronic
928116351 2:28547660-28547682 GAAGGGGAGGTGAGGGCCAGAGG + Intronic
928593311 2:32838634-32838656 TCCGGGCTGGTGTGAGCCAGCGG - Intergenic
929814356 2:45219566-45219588 GCAGGGGTGGTGAGTGGCAGGGG - Intergenic
931716670 2:65034268-65034290 TGAGAGGTAGGAAGAGCCAGAGG + Intergenic
932334546 2:70922614-70922636 TGAGAAGGGGTGAGAGGCAGAGG + Intronic
932396493 2:71452517-71452539 TGGGGGGTGGGGAGAGGAAGAGG - Intergenic
932429848 2:71667702-71667724 TGAGGGATGGAGGCAGCCAGAGG - Intronic
932492849 2:72132642-72132664 GAGTGGGTGGTGAGAGCCAGAGG + Intronic
932568857 2:72926468-72926490 TGAGGGGAGGTTTGAGCCTGGGG + Intronic
933565386 2:83944132-83944154 TGAGGAATGGTGAGAGACCGTGG - Intergenic
933646648 2:84818548-84818570 TAAGGGGTGGTTAGATCTAGAGG - Intronic
933882242 2:86681195-86681217 TGTGGGGTGGAGTGGGCCAGGGG + Intronic
934034624 2:88078560-88078582 TGAGGGGAGATGGGAACCAGAGG + Intronic
934658903 2:96132723-96132745 TGCAGGGTGATGAGAGCAAGTGG + Intronic
935201400 2:100859678-100859700 TGAGGGGTGGTTAGAGGTATAGG + Intronic
935236168 2:101139853-101139875 TCAATGGTGGTGAGTGCCAGGGG - Intronic
935763950 2:106345841-106345863 TGAGAGGGGGTCAGAGCCAGGGG - Intergenic
935805912 2:106747565-106747587 TGAGGGGTGGCTAGAGATAGGGG - Intergenic
936520351 2:113208188-113208210 TTAGGGGTGGGAAGAGCAAGAGG - Intronic
937207847 2:120248049-120248071 TGAGGGGTGGTGAAACGCAGAGG + Intronic
937414000 2:121699857-121699879 AGAGAGGAGGTGAGAGTCAGAGG + Intergenic
937869782 2:126778695-126778717 CAAGGCGTGGGGAGAGCCAGAGG + Intergenic
938106310 2:128532954-128532976 TGGGAGGGGGTGAGAGCCAGGGG + Intergenic
938162103 2:128995266-128995288 TGATGGATGGTGAGAGACACAGG + Intergenic
938689680 2:133776174-133776196 GGAGGGCAGCTGAGAGCCAGCGG + Intergenic
941607146 2:167612077-167612099 AGAGGGTTGGTGATAGCCTGTGG + Intergenic
942817624 2:180070882-180070904 TGGGGGCTGTTTAGAGCCAGAGG + Intergenic
944277607 2:197856982-197857004 TGAGGGGTGGGAAGAGGGAGAGG + Intronic
945246000 2:207717667-207717689 GGATGGTTGGTGAGAGCCAGGGG + Intronic
945563083 2:211362467-211362489 TGAGGGTTGGTAAGAGGAAGAGG - Intergenic
945658828 2:212659347-212659369 TGTGGGGTGGTGGGGGCCATTGG + Intergenic
945728484 2:213503460-213503482 TGAGGGGTGGTGAGGAGCAATGG - Intronic
946212762 2:218160868-218160890 CAAGGGGTGGTGAGAGGCTGTGG + Intergenic
946302175 2:218830706-218830728 TCTGGGGAGGTGGGAGCCAGGGG - Intronic
947416243 2:229899491-229899513 TGAGGTGTGCAGATAGCCAGCGG + Intronic
947618923 2:231576320-231576342 TGTGGAGTCGTGAGAGCAAGGGG - Intergenic
947909051 2:233789764-233789786 GGAGGGGTGGAGAGAGCCTGGGG + Intronic
948142618 2:235685028-235685050 CCAGGGGTTGTGAGAGTCAGGGG + Intronic
948887574 2:240891849-240891871 TGAGAGGTGATGAGGGGCAGGGG - Intronic
1168834849 20:871298-871320 TCAGGGCTGGGGCGAGCCAGGGG + Exonic
1170144067 20:13153725-13153747 AGAGGGCTGGTGGGAGGCAGGGG - Intronic
1170438614 20:16355192-16355214 TCAGGGGTGGGGACAGGCAGGGG + Intronic
1170600283 20:17836406-17836428 AGAGGGGTGGAGACAGCCATGGG - Intergenic
1170884568 20:20329132-20329154 TGAGGGGTGGTGGGATCAGGGGG - Intronic
1171767430 20:29297802-29297824 GGAAGGCTGGGGAGAGCCAGCGG + Intergenic
1172303911 20:33868277-33868299 TGAGGGGTGGTGAGGACCCAAGG - Intergenic
1172315430 20:33950389-33950411 TGAGAGGTGGTGAGGGTTAGTGG + Intergenic
1172570730 20:35968312-35968334 TGAGGGATGGGGACAGCTAGGGG + Intronic
1172884808 20:38223712-38223734 AGAGGGGAGGTGGGAGGCAGTGG + Intronic
1173077086 20:39829429-39829451 TGGGTCGTGGTGGGAGCCAGAGG + Intergenic
1173824245 20:46037174-46037196 TGAGGGGTGTTCAGTGACAGAGG - Intronic
1173987630 20:47274754-47274776 GGAGGGGTAGAGAGAGCCTGTGG - Intronic
1174328517 20:49798890-49798912 TGAGAGATGGAGAGAGGCAGAGG + Intergenic
1174388460 20:50201004-50201026 TGTGGGGTGGTGAGGGACAAAGG + Intergenic
1176305359 21:5120353-5120375 TGAGGGGTGGGTGGGGCCAGTGG + Intronic
1179367986 21:40776526-40776548 GCAGGGGTTGTGAGGGCCAGAGG + Intronic
1179851696 21:44141678-44141700 TGAGGGGTGGGTGGGGCCAGTGG - Intronic
1180699897 22:17775553-17775575 TGAGGCCTGGTGAAAGCCAGAGG - Intergenic
1181166629 22:20987470-20987492 ACAGGGGTGGTGAGAGTCAGCGG - Intronic
1181593110 22:23896598-23896620 TGAGGCGGGGTGGGAGCCAGGGG - Intronic
1181829225 22:25546098-25546120 TGAGGGGTGGCCAGACACAGAGG - Intergenic
1182521116 22:30884977-30884999 TGAGGAGTGGTGGGAGTTAGTGG + Intronic
1182550274 22:31097174-31097196 GGAGGGGTGGTGATAGCCGCAGG - Intronic
1182648830 22:31834023-31834045 TGTGGGGTGGTCAGAGCATGAGG + Intronic
1183293521 22:37017256-37017278 TGAGGGTTGGGGAGAGCCTCAGG - Intronic
1183335432 22:37243534-37243556 TGAGGGGAGGGGAGAGAAAGTGG + Intronic
1183541968 22:38434649-38434671 GGAGGGATGGGGAGAGCCTGGGG - Intronic
1183700803 22:39449950-39449972 TGAGGGCTGGTGAGAGCCCAGGG - Intergenic
1183986911 22:41575145-41575167 GGAGGGGAGGAGAGAGGCAGTGG - Exonic
1184101634 22:42344105-42344127 CGTGGGGTGGGGAGAGCCGGTGG - Intergenic
1184109689 22:42387558-42387580 TGGGGGTTGGGGAGAGCTAGAGG - Intronic
1184459894 22:44631131-44631153 GGAGAGGTGGTGACAGCCAGGGG - Intergenic
1184488089 22:44793331-44793353 TGGAGGGTGGTGAGTGGCAGGGG + Intronic
1184533349 22:45070746-45070768 GCAGGGGTGGGGAGAGCCTGGGG - Intergenic
1185049238 22:48545169-48545191 TGAGGGGAGGGCAGAGCAAGAGG - Intronic
950160405 3:10756471-10756493 TGAGGGGTTCTGAGAGTCAGGGG + Intergenic
950295360 3:11824975-11824997 GGAGGGGAGGTGTGACCCAGTGG + Intronic
950461173 3:13122984-13123006 TGAGGTGTGCTGAGTGCCACAGG + Intergenic
950809232 3:15635596-15635618 TGGCGGCTGATGAGAGCCAGAGG - Exonic
951272760 3:20647312-20647334 AGAGGGGGAGTGAGAGCAAGAGG - Intergenic
951685081 3:25334988-25335010 TTAGGGATGGGGAGAGACAGAGG + Intronic
952132436 3:30381600-30381622 TGAGGGGTGGGAAGAGAGAGAGG - Intergenic
952156037 3:30644528-30644550 TGAGGGGTGGTGAGGGGTTGGGG - Intronic
952648011 3:35685373-35685395 TGAGGAGTGGTGGGAGCAGGGGG + Intronic
953238688 3:41128312-41128334 TCTGGAGTGGTGAGGGCCAGGGG + Intergenic
953951354 3:47192860-47192882 TGATGAGTGGTGAGGGGCAGAGG - Intergenic
954105142 3:48405832-48405854 CGAGGGGTGCAGAGAGCCACAGG + Intronic
954269328 3:49495188-49495210 TGAGGGGATGGGATAGCCAGGGG + Intronic
954439366 3:50513286-50513308 TGAGGGGTGAGCAGAGCCTGGGG - Intergenic
955146437 3:56324791-56324813 TGAATGAAGGTGAGAGCCAGAGG - Intronic
955409946 3:58648994-58649016 TGTGGGGTTGTCAGAGACAGGGG + Intronic
955506136 3:59635037-59635059 TGGGGGCAGGTGAGAGCAAGGGG - Intergenic
955987143 3:64585361-64585383 TGAGGGGTGATGAGAGGAAGAGG + Intronic
956728637 3:72177149-72177171 TCAGGCGTGGGGAGAGACAGGGG + Intergenic
956832212 3:73062503-73062525 TGAGTGTTGGTGTGAGCAAGAGG + Exonic
956990248 3:74754527-74754549 TCAGGAGTGGTTAGAGCAAGTGG - Intergenic
959000690 3:100960868-100960890 TGGGGTGTTGTGAGGGCCAGAGG - Intronic
960478958 3:118164250-118164272 TGTGGGGTGGTGGGGGGCAGGGG + Intergenic
961649505 3:128410389-128410411 TGAGGGGTGATGTGACCCAGTGG + Intergenic
963605942 3:147411697-147411719 TGAGGGGTGGAGAAAGTCCGAGG + Intronic
965080358 3:164024676-164024698 TGAGAGGTGGCCAGAGCCAAAGG - Intergenic
966629603 3:182057862-182057884 TAAGTGGTGGTGAGAGGCTGAGG - Intergenic
966642207 3:182203907-182203929 TGAGGGGAGGTGAGATGGAGAGG - Intergenic
966825735 3:183963544-183963566 TGAGCGGTGGGCAGCGCCAGAGG - Exonic
967371118 3:188747311-188747333 TGAGAAGTAATGAGAGCCAGTGG + Intronic
967567506 3:190989192-190989214 TGAGGTTTGGAGGGAGCCAGGGG + Intergenic
968590871 4:1459067-1459089 TGGGGGGTGGTGAGTGACTGGGG + Intergenic
968956614 4:3722717-3722739 TGCAGGGTGGGCAGAGCCAGGGG + Intergenic
969307812 4:6335735-6335757 TGAGGGGAGGTGAGAGGAGGGGG + Intronic
969531402 4:7733027-7733049 AGAGGGGTGGGGAGAGGGAGGGG - Intronic
969639402 4:8388025-8388047 TGACGGGAGGTGAGCGCAAGAGG - Intronic
970355739 4:15250359-15250381 TCAGGGGTGCTGAGAGACTGTGG + Intergenic
971181967 4:24337212-24337234 GGTGGGGCGGTGAGAGTCAGAGG - Intergenic
971290799 4:25337316-25337338 TGAGAGGTGGAGAGAGAAAGAGG - Intronic
972701054 4:41493781-41493803 ACAGGGCTGCTGAGAGCCAGAGG + Intronic
972817210 4:42657221-42657243 TGAGGGGCGGGGAGAGCCAGGGG + Intergenic
973712242 4:53641521-53641543 TGTGGGGTGGGGAGAAACAGAGG - Intronic
974437378 4:61873815-61873837 TGAGAGGTGGTGAGTGCTACTGG + Intronic
978827957 4:113047555-113047577 TGAGGGGTTGGGAGAGCAGGTGG + Intronic
979334570 4:119449287-119449309 AGAAGGGTGGTGAGAGGCAGGGG - Intergenic
980400640 4:132280201-132280223 TGAGGGGGGGTGAGAGAGAGAGG - Intergenic
981713965 4:147734188-147734210 AGAGGTGTGGAGAGAGGCAGAGG + Intronic
981890221 4:149727665-149727687 GAAGGGGGGATGAGAGCCAGTGG - Intergenic
983558475 4:169078720-169078742 TGCGTGGTGGTGAGCGCCTGTGG + Intergenic
985937265 5:3106617-3106639 TGAGGGGAGGGGAGAGGAAGGGG - Intergenic
985962898 5:3316284-3316306 TGAGGAGTGGCAGGAGCCAGAGG - Intergenic
986366866 5:7041357-7041379 TGAGGGGTGATGAGAGAGAAGGG + Intergenic
988144723 5:27291482-27291504 TCTGGGGTGATGAGAGACAGTGG - Intergenic
988721900 5:33887455-33887477 TGTGGGGTTGGGAGGGCCAGAGG + Intronic
989180217 5:38568947-38568969 TGAGCTGTGGTGAGAGGTAGGGG + Intronic
991023171 5:62002211-62002233 AGGGGGGTGGTGAGAAACAGGGG - Intergenic
991297111 5:65093194-65093216 TGAGCTGGGTTGAGAGCCAGTGG + Intergenic
991714448 5:69438228-69438250 TAAGGAGTGGTGAGGACCAGAGG - Intronic
991983880 5:72262634-72262656 AGAGGGGTGATGAAAGCAAGTGG + Intronic
992477472 5:77117696-77117718 AAAGGGGTGGACAGAGCCAGAGG + Intergenic
993292748 5:86096025-86096047 TGAAGGGTGGGGACAGTCAGAGG + Intergenic
997196424 5:131983292-131983314 TGGGAGGTGGTGAGAGCTTGTGG - Intronic
997477535 5:134153609-134153631 TAAAGGGTGCTGAGAGCAAGAGG + Exonic
997710584 5:136000823-136000845 AGAGGGATGGTGACTGCCAGGGG + Intergenic
998151804 5:139761826-139761848 TGAGGGCTGCAGACAGCCAGGGG - Intergenic
998747116 5:145273417-145273439 TGATGGATTGTCAGAGCCAGAGG + Intergenic
999936012 5:156486502-156486524 GCAGGGGTGGTGATAGGCAGAGG - Intronic
1001197016 5:169682435-169682457 TGAGGTGTGGTGAACACCAGGGG + Intronic
1001740207 5:174046896-174046918 TGGGGGCTGATGAGAGCAAGAGG - Intronic
1001959352 5:175871167-175871189 TGAGGAGTGGTGGGGGCAAGGGG - Intronic
1002194444 5:177494620-177494642 TGAGGGGTGTTCAGAGCGTGGGG + Intronic
1002549994 5:179980989-179981011 GGAGGGGTGGGGCGAGGCAGGGG + Intronic
1002741708 5:181439123-181439145 TGAGGGGTGGGGAGAGGGGGTGG + Intergenic
1002913674 6:1510935-1510957 TCAGGGGTGGTAGGACCCAGTGG + Intergenic
1004458799 6:15816719-15816741 TGAGGGGTGGAGGGAGGGAGGGG + Intergenic
1004728071 6:18330317-18330339 TGAGTAGTGGCGAGAGCCAGGGG + Intergenic
1004757770 6:18631616-18631638 TAAGGGGTGGGGAAAGACAGGGG - Intergenic
1004886258 6:20054072-20054094 GGGTGGGTGGTGAGAGCCAGGGG + Intergenic
1005395913 6:25381911-25381933 TGAGGGCTGGTGGTTGCCAGGGG - Intronic
1005399325 6:25415452-25415474 TGGGGGGTGGGGAGAGGAAGAGG - Intronic
1005402413 6:25448462-25448484 TGAGAGGAGGTGTGAGCTAGGGG - Intronic
1006375296 6:33668493-33668515 CCTGGGGTGGTGACAGCCAGCGG - Exonic
1006464258 6:34182049-34182071 TGAGGGGGAGTCAGAGGCAGAGG + Intergenic
1006472800 6:34237716-34237738 TGAGGGGCGGGGAGAGACACGGG + Intronic
1006524272 6:34590442-34590464 TGAGAGGGGGTCAGAGCCAGGGG + Exonic
1007840502 6:44712298-44712320 TGATGGGTGGTGAGGGGCGGGGG + Intergenic
1007901966 6:45421660-45421682 CTAGGGGTGGGGAGAGCAAGAGG + Intronic
1010009757 6:71036452-71036474 TGTGGAGTGAAGAGAGCCAGAGG - Intergenic
1011277020 6:85642195-85642217 TGGGGGGCGGGGAGAGCCTGTGG - Intronic
1011386369 6:86802450-86802472 TGAGTGGGGATCAGAGCCAGTGG - Intergenic
1012950761 6:105515416-105515438 TCAGGCGCTGTGAGAGCCAGAGG - Intergenic
1013301198 6:108806222-108806244 AGAGGATTGGTGAGAGCCAGTGG - Intergenic
1013624104 6:111920066-111920088 TGAGGGCTGGTGAGGGCCGATGG + Intergenic
1013758676 6:113490471-113490493 TGAGGGATGCTGAGGGGCAGTGG - Intergenic
1014214278 6:118737648-118737670 AGAGGGGTGGAGAGAGAAAGAGG + Intergenic
1014272897 6:119353276-119353298 TGAGGGGGCGTGGGTGCCAGGGG + Intergenic
1016422614 6:143900791-143900813 ATATGGGTGGTGAGAGGCAGTGG + Intronic
1017074670 6:150606798-150606820 TGAGTGCTGCTGAGTGCCAGGGG - Intronic
1017161698 6:151371569-151371591 TGAGGGGTGGTGTGTCCCAGAGG + Intronic
1017559140 6:155607869-155607891 TGGGGGGTGGTTTTAGCCAGTGG + Intergenic
1017891157 6:158640494-158640516 GGAGCGGTGCTGAGAGCTAGGGG - Intronic
1018869222 6:167768772-167768794 TCAGGGGAGGTGGGAACCAGAGG + Intergenic
1019246848 6:170714887-170714909 TGAGGGGTGGGGAGAGGGGGTGG + Intergenic
1019646905 7:2135692-2135714 TGAGAGGTGGCGAGAGCTGGTGG - Intronic
1021785456 7:24146990-24147012 CTAGGGGTGGTGGGAGACAGTGG + Intergenic
1022388583 7:29924396-29924418 TGAGGAGTGGGGAGATGCAGGGG - Intronic
1022517787 7:30986972-30986994 TCAGGGGTGCTGAGAGGGAGCGG + Intronic
1022924796 7:35046222-35046244 TGAGGAATGGTGAGAGGCACTGG - Intergenic
1023983693 7:45083343-45083365 TGAGGGGTGGCCACAGCCAGAGG + Exonic
1024069487 7:45774392-45774414 AGAAGGGTGGTGAGAGGCAGGGG + Intergenic
1024999869 7:55306956-55306978 AGAGGGGAGGTGAGGCCCAGAGG + Intergenic
1026052404 7:66958405-66958427 TGTGGGGTCCTGAGGGCCAGTGG + Exonic
1026085639 7:67260797-67260819 TGTGGAGTGGTGAAAGACAGGGG + Intergenic
1026691526 7:72554086-72554108 TGTGGAGTGGTGAAAGACAGGGG - Intergenic
1026887392 7:73960496-73960518 TCAGTGGTGGTGAGAGACTGTGG + Intergenic
1026901661 7:74040687-74040709 TGTGGGGAGGAGAGAGCCAGAGG + Intronic
1026906481 7:74065820-74065842 TCAGGGGTAGGGGGAGCCAGAGG - Intronic
1027341627 7:77214604-77214626 TTATATGTGGTGAGAGCCAGGGG + Intronic
1027817501 7:82995263-82995285 TGAGGGGTAGGCAAAGCCAGAGG + Intronic
1029131693 7:98336141-98336163 TGAGGGGGGGTGGGAGAGAGGGG + Intronic
1029547032 7:101216075-101216097 TGAGGGCTGGAGACAGCCTGGGG - Intronic
1029578718 7:101420780-101420802 TCAGGGCTGGTGAGAGGGAGGGG - Intronic
1029794062 7:102875397-102875419 GGAGGGGAGGGGAGAGCCAGAGG + Intronic
1029822805 7:103160928-103160950 TGAGGAATGGTGAGAGGCACTGG - Intergenic
1031628848 7:124021904-124021926 CCAGGGGTGGTGAGAGAAAGAGG - Intergenic
1032046878 7:128618696-128618718 AGAAGTGTGGTGAGAGGCAGGGG + Intergenic
1032744464 7:134771723-134771745 TGGGGAGGAGTGAGAGCCAGTGG - Intronic
1033605655 7:142926492-142926514 GGAGGGGAGGAGAGAGACAGTGG + Intronic
1034266569 7:149783840-149783862 GAGGGGGTGGAGAGAGCCAGTGG + Intergenic
1034338620 7:150338774-150338796 GGAGGGGTGGGCAGTGCCAGTGG + Intronic
1034458928 7:151187417-151187439 TGGGGGTTGCTGAGAACCAGGGG - Intronic
1034514525 7:151564575-151564597 TAAAGGGTGGTGAGTGCCACAGG + Intronic
1034682580 7:152940327-152940349 TGAGAGGTGGTGGCAGCCAAGGG + Intergenic
1034770465 7:153769918-153769940 TGTGGGTTGGTGAGGGACAGTGG + Intergenic
1035182291 7:157098070-157098092 GGTGTGGTGGTGTGAGCCAGTGG - Intergenic
1035266963 7:157694407-157694429 GGAGGGGTGGTGGGAGGAAGGGG - Intronic
1035453151 7:158992083-158992105 TGAGGGGTGTTGGGAGTGAGTGG + Intergenic
1035501293 8:93073-93095 TGAGGGGTGGGGAGAGGGGGTGG - Intergenic
1036643061 8:10596023-10596045 TCAGGCGTGGTGGCAGCCAGGGG - Intergenic
1037823626 8:22147829-22147851 TGCGGGGTGCTGGGAGCGAGGGG - Exonic
1038394374 8:27236392-27236414 AGAGGGGTTGTGAGTACCAGTGG - Exonic
1039473814 8:37829036-37829058 TGTGGGGGGGTGAGAGGAAGGGG - Intronic
1041733182 8:61083463-61083485 TGAGGGGGTTTGGGAGCCAGAGG + Intronic
1044257557 8:90082965-90082987 AGAAGGCTGGTGAGAGCAAGAGG - Intronic
1044726570 8:95199395-95199417 TGAGGGGTGGTGGGAGTGGGAGG + Intergenic
1045037184 8:98184752-98184774 TTGGGGGTGGTGAGAGCCCAGGG + Intergenic
1045570379 8:103362866-103362888 TCAGGAGTGGAGAAAGCCAGAGG + Intergenic
1045601410 8:103721962-103721984 TTTGGGGTGGTGAGGGTCAGAGG + Intronic
1047317023 8:123744338-123744360 TGAGAGATGGAGAGAGACAGTGG - Intergenic
1047588800 8:126303964-126303986 TGAATGCAGGTGAGAGCCAGGGG + Intergenic
1047709446 8:127536825-127536847 TTAGGGTTGATGAGAGACAGGGG - Intergenic
1047739500 8:127795127-127795149 TGAGGGGGTGTGAGAGGAAGCGG - Intergenic
1047762607 8:127965367-127965389 TGAGGGGTAGGGGGAGCCTGAGG - Intergenic
1048006180 8:130421125-130421147 GGAGGGGAGGAGAGAGGCAGAGG - Intronic
1048180973 8:132193870-132193892 TGAGGTGTGGTCAGAGCCAGAGG + Intronic
1048194626 8:132322109-132322131 TGACGGGTAGTGGGAGCAAGGGG + Intronic
1048507876 8:135036790-135036812 TGAGGCGTGGTCAGAGGAAGGGG + Intergenic
1049213689 8:141398167-141398189 TGAGGGGTGGAGTGGGCCAGTGG + Intronic
1049423439 8:142526800-142526822 TGAGGCACGGTGAGAGGCAGGGG - Intronic
1049695414 8:143982070-143982092 TGAGGTCTGGGGACAGCCAGAGG + Intronic
1049721119 8:144116008-144116030 TGAGGGGTGAGTGGAGCCAGGGG + Exonic
1049912697 9:284946-284968 TGAAGGGTGGTAAGAGGGAGAGG + Intronic
1051153578 9:14114295-14114317 TGAGGTGTGGTGAATTCCAGAGG - Intronic
1051856314 9:21570654-21570676 TGAGAGGTGGTCAGGACCAGAGG + Intergenic
1053191891 9:36078534-36078556 TGAGGGGTGGGGAGTGCTACTGG - Intronic
1054812785 9:69447905-69447927 TGAGGGGCTGTGGGACCCAGGGG - Intronic
1055273926 9:74592894-74592916 TCAGGGGTGAGGAGAGCTAGGGG + Intronic
1056699698 9:88892023-88892045 GGAGGGGTGGTGACAGCCACTGG + Intergenic
1057828179 9:98387071-98387093 TCAGGGGAGGGGAGAGCCTGGGG + Intronic
1058052268 9:100418909-100418931 TTAGAGTTGGTGAGAGACAGAGG - Intergenic
1058644629 9:107119115-107119137 TGTGGGGTGGTAAGAGCAACAGG + Intergenic
1058687435 9:107490391-107490413 TGAGGGGTGGGGGGCGCTAGGGG + Intronic
1058996694 9:110306004-110306026 GGAGTGGTGGTGGGAGGCAGAGG - Intronic
1059603752 9:115810610-115810632 TGAGGGGTTGTCAGAGGCTGGGG + Intergenic
1060003248 9:119977461-119977483 TGAGGGGAGGTGAGGACCTGTGG - Intergenic
1060093008 9:120761321-120761343 TGTGGTGTGGTGGAAGCCAGCGG - Exonic
1060113815 9:120925857-120925879 TGATGGGAGGTGAGGGGCAGAGG - Intronic
1060315671 9:122508119-122508141 TGAGGGGGGGAGAGAGAGAGAGG + Intergenic
1060399440 9:123339683-123339705 CGGGGAGTGGAGAGAGCCAGTGG - Intergenic
1060552218 9:124491038-124491060 AGAGAGGTGGAGACAGCCAGAGG - Intronic
1061040828 9:128139599-128139621 TGGGGGATCGTAAGAGCCAGGGG + Intergenic
1061856174 9:133443106-133443128 TCAGGTGTGGTGACAGCCAGGGG - Intronic
1062014419 9:134284055-134284077 TTGGGGGTGGTGGGAGGCAGAGG - Intergenic
1062101186 9:134729287-134729309 TGAGCGGCAGTGAGAGCCGGAGG + Intronic
1062102922 9:134737845-134737867 TGTGGTGAGGTGAGGGCCAGAGG + Intronic
1062412180 9:136431173-136431195 TGAGGAGAGGTGAGGGCCTGGGG - Intronic
1062412216 9:136431269-136431291 TGAGGAGAGGTGAGGGCCTGGGG - Intronic
1062412231 9:136431310-136431332 TGAGGAGAGGTGAGGGCCTGGGG - Intronic
1062412246 9:136431351-136431373 TGAGGAGAGGTGAGGGCCTGGGG - Intronic
1062412262 9:136431393-136431415 TGAGGAGAGGTGAGGGCCTGGGG - Intronic
1062412278 9:136431435-136431457 TGAGGAGAGGTGAGGGCCTGGGG - Intronic
1062412341 9:136431602-136431624 TGAGGAGAGGTGAGGGCCTGGGG - Intronic
1062412357 9:136431644-136431666 TGAGGAGAGGTGAGGGCCTGGGG - Intronic
1062412387 9:136431726-136431748 TGAGGAGAGGTGAGGGCCTGGGG - Intronic
1062412403 9:136431768-136431790 TGAGGAGAGGTGAGGGCCTGGGG - Intronic
1062636451 9:137494047-137494069 CCAGGGGTGGTGAGAGGCACTGG + Intronic
1203607620 Un_KI270748v1:70339-70361 TGAGGGGTGGGGAGAGGGGGTGG + Intergenic
1186770864 X:12816725-12816747 TGAGATGTGGTGAGGGGCAGGGG - Intronic
1186795755 X:13044841-13044863 TCGGGAGTGGTGAGTGCCAGGGG + Intergenic
1186880251 X:13858250-13858272 AGAGGTGTAGAGAGAGCCAGAGG - Intronic
1189792615 X:44618495-44618517 TGAGGGGTGGTGATTGCCTGAGG - Intergenic
1191901173 X:66041991-66042013 TGAGGGGTTGTAAGAACCAAGGG - Intergenic
1192178695 X:68901979-68902001 TGAGAGGTGCAGAGAGGCAGTGG + Intergenic
1192221989 X:69203589-69203611 GGAGGTATGGGGAGAGCCAGAGG - Intergenic
1192491432 X:71579583-71579605 TGGGGGGAGGTGGGAGCTAGTGG + Intronic
1192855093 X:75000511-75000533 TCAGGGGGGCTCAGAGCCAGTGG - Intergenic
1192934288 X:75843068-75843090 TGTGGTGTGGTGTGAGACAGTGG + Intergenic
1194436529 X:93874145-93874167 TGATGGTTGCTGAGACCCAGAGG - Intergenic
1195853252 X:109305694-109305716 TGAGGGGTGGGGTGGGCCATAGG + Intergenic
1196150149 X:112364561-112364583 TGAGGGGTGGTGATGGTCATGGG + Intergenic
1197264074 X:124347354-124347376 TGGGGGGTGGGGAGGGGCAGGGG + Intronic
1198433289 X:136589389-136589411 TGAGGGGTCGTGAGAGCCCATGG + Intergenic
1199337016 X:146630286-146630308 TGAGGGGTGGGGCGGGCCATGGG - Intergenic
1199474675 X:148232113-148232135 TGTGGTGTGGTGAGAGGCATTGG + Intergenic
1199767957 X:150954169-150954191 TGGGGGGTGGGGAGAGGCATTGG + Intergenic
1200227844 X:154428924-154428946 CGAGGGGTGGTGAGGCCCGGAGG + Intronic
1200919005 Y:8596481-8596503 GGAGGGGTGCTGAGACCCACCGG + Intergenic
1201077664 Y:10199578-10199600 GGAAGGCTGGGGAGAGCCAGTGG - Intergenic