ID: 1089742105

View in Genome Browser
Species Human (GRCh38)
Location 11:120591566-120591588
Sequence CAGAGGAGGCAGAAGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 987
Summary {0: 1, 1: 0, 2: 15, 3: 117, 4: 854}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089742105 Original CRISPR CAGAGGAGGCAGAAGGCAGC TGG (reversed) Intronic
900371462 1:2334039-2334061 CAGAGCAGACAGAAGGCATGGGG + Intronic
900409830 1:2507512-2507534 CAGAGGAGCCCGGGGGCAGCTGG - Intergenic
900422223 1:2560582-2560604 CAGAGGGGGCTGAGGGCACCAGG - Intronic
900557852 1:3289096-3289118 CACAGGAGGGAAAAGGCAGTGGG - Intronic
900667969 1:3828356-3828378 CACAGGAGGCGGAAGGAGGCAGG - Intronic
900830795 1:4963781-4963803 TAGAGGACCCAGAGGGCAGCTGG + Intergenic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
901880216 1:12189342-12189364 CAGTGGAGGCAACAGGAAGCAGG - Intronic
901974357 1:12932518-12932540 CAGAGGAGAGAGATGGCAGCAGG - Intronic
902010817 1:13269250-13269272 CAGAGGAGAGAGATGGCAGCAGG + Intergenic
902219884 1:14958097-14958119 CAGGGGAGGGAGCAGGCAGAGGG - Intronic
902377993 1:16039208-16039230 AAGAGAAGCCAGCAGGCAGCGGG - Intergenic
902383082 1:16061704-16061726 AAGAGAAGCCAGCAGGCAGCGGG - Intronic
902655776 1:17867039-17867061 CACAGGAGGCAGAAGAAGGCTGG - Intergenic
902763723 1:18600975-18600997 CAGACGAGGCAGGAGTCAGATGG + Intergenic
902800455 1:18826371-18826393 CTAAGGAGTGAGAAGGCAGCTGG + Intergenic
902955815 1:19923480-19923502 CAGATGGGGCAGAAGGCTGAAGG + Intronic
903657242 1:24956868-24956890 CAGAGGAAACAGAGGGCATCTGG - Intronic
904193392 1:28765107-28765129 CTGGGGAGGCTGAAGGCAGGAGG - Intronic
904208760 1:28872037-28872059 CTGAGGAGGCAGAAGTCTCCTGG - Intergenic
904426040 1:30423779-30423801 CAGAGGATGAGGAAGGCAGTGGG + Intergenic
904455320 1:30644281-30644303 CAGAGGAGGCTCAAGGGAGCAGG - Intergenic
904480023 1:30787789-30787811 CAGAGGAGCCAGGAAGCAGGAGG - Intergenic
904584034 1:31569234-31569256 CAGAGGGGCCAGAAGACACCTGG - Intergenic
904587108 1:31586675-31586697 CAGAGGAGGGGGAAGGGAGCTGG - Intronic
904983821 1:34528147-34528169 CAGAGGAGGAAGTAGGCTGGAGG + Intergenic
905118970 1:35667100-35667122 CAGAGGAGGCAAGAGGAAGAAGG - Intergenic
905243314 1:36595505-36595527 CAGAGGAGGAGGAAGCCGGCGGG - Intergenic
905249534 1:36639002-36639024 AAGAGGAGCCAGAAGCAAGCTGG - Intergenic
905473233 1:38208271-38208293 CCCAGGAGGCAGGAGGCAGGAGG + Intergenic
905489366 1:38331680-38331702 CTGAGGAGGAGGAAGGCAGGTGG - Intergenic
905516266 1:38564292-38564314 CAGAGGAGGAAGCAGGCTGGGGG - Intergenic
905542094 1:38767939-38767961 CAAGGGAGGCAGAGGGAAGCTGG - Intergenic
905781035 1:40709506-40709528 CGGAGGAAACAAAAGGCAGCAGG - Intronic
905888467 1:41504605-41504627 CTGAGCAGACAGAGGGCAGCCGG + Intergenic
905891362 1:41520511-41520533 AAGAGGTGGGAAAAGGCAGCTGG + Intronic
906257956 1:44365179-44365201 CTGGGGAGGCAGAACACAGCCGG + Intergenic
906519192 1:46457291-46457313 CAGAGGTGGTGGTAGGCAGCTGG - Intergenic
906792833 1:48673927-48673949 CAGGGGAGGAAGGAAGCAGCAGG - Intronic
907223960 1:52927640-52927662 AGGAGGAAGCAGAAGGCCGCAGG - Intronic
907328920 1:53658857-53658879 CAGAGTAGGCACAAAGAAGCTGG + Intronic
907418899 1:54333267-54333289 CAGAGGAGGCGGGAGGATGCAGG - Intronic
908114935 1:60931397-60931419 CAGAGGAGGAAGCAAGGAGCGGG - Intronic
910283659 1:85529669-85529691 CACAGGAGGCAGAAGTCAGCAGG - Intronic
910369300 1:86498902-86498924 CTTAGGGGGCAGAAGGCAGGAGG + Intronic
910555278 1:88524957-88524979 CAGGGGAGGCAGGAGGCAAGTGG + Intergenic
911082659 1:93949212-93949234 CAGAGGAGGGAGAGGGCAAGGGG + Intergenic
911586111 1:99692784-99692806 AACAGAAGGCAGAAGGCAGAAGG - Intronic
912197752 1:107419222-107419244 GAGAGGAGGGAGGAGGTAGCGGG - Intronic
912387555 1:109279674-109279696 GAGAGGTGGCAGCAGGCACCTGG - Exonic
912948816 1:114106582-114106604 CAGAGAAGGGAGAGAGCAGCAGG - Intronic
912959282 1:114181000-114181022 CAGACCAGGCAAAAGGGAGCAGG + Intergenic
913120651 1:115737580-115737602 AAGAGCAGGCAGAAGGGACCAGG - Intronic
914206356 1:145533321-145533343 CACAGGAGGCAGAAGTCAGCAGG + Intergenic
914905697 1:151741760-151741782 CAGGGGAAGAAGCAGGCAGCTGG - Intergenic
914920953 1:151847205-151847227 CAGGGGAGGCAGGAGGCAGGAGG + Intergenic
914920962 1:151847232-151847254 CAGGGGAGGCAGGAGGCAGGAGG + Intergenic
914920978 1:151847279-151847301 CAGGGGAGGCAGGAGGCAGGAGG + Exonic
914920987 1:151847306-151847328 CAGGGGAGGCAGGAGGCAGGAGG + Exonic
914936885 1:151989425-151989447 CAGAGGAGGGAGTAGCCAGGAGG + Intronic
915484798 1:156212856-156212878 CATCGGAGGCTGAGGGCAGCGGG - Intergenic
915647201 1:157281402-157281424 TAGAGCAGGGAGAAGGGAGCAGG + Intergenic
915737402 1:158093786-158093808 CAGAGGGTGGAGAAGGCAGGAGG - Intronic
916648891 1:166816779-166816801 AAGAGGTGGCACCAGGCAGCAGG + Intergenic
916896450 1:169168305-169168327 CTGAGGAAGCATAAGGCAGAAGG - Intronic
917338001 1:173945231-173945253 CTCAGGAGGCTGAAGGCAGGAGG - Intronic
919862944 1:201754328-201754350 CAGAGGAGGAAGAAGGAATCTGG + Intronic
920261982 1:204694548-204694570 GAGAGCAGGAAGTAGGCAGCAGG - Intergenic
920335437 1:205242016-205242038 CTGAGGAGGCCGAAGGCATCGGG + Exonic
921365247 1:214367628-214367650 CAGAGCAGGCACAAGGCTACAGG + Intronic
921422066 1:214959677-214959699 AAGTGGAGGCAGAAGGGAGAGGG + Intergenic
921428721 1:215037964-215037986 CTTAGGTGGTAGAAGGCAGCTGG + Intronic
921564985 1:216706033-216706055 ACGAGGAGGAAGAGGGCAGCTGG - Intronic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
922408115 1:225339895-225339917 CAGAGGAGGAAGAGGGAAGCTGG - Intronic
922860736 1:228814192-228814214 CACAGGATGCAGAAGGCATTTGG - Intergenic
923073896 1:230592091-230592113 CTGAGCTGGCAGAAAGCAGCAGG + Intergenic
923116011 1:230938525-230938547 CAGAGGAGGTAGAGGGAAACAGG - Intronic
923232460 1:231999734-231999756 CTGAAGGGGCAGAAGGCAGAAGG - Intronic
923238506 1:232058180-232058202 CAGAGAGGGCAGAGGGCAGGAGG - Intergenic
923292552 1:232560598-232560620 CAGAGGAGGCAGGTGAGAGCTGG - Intronic
923358353 1:233182804-233182826 CAGAGGAGGCAGCACTGAGCAGG - Intronic
923724738 1:236496250-236496272 CACTTGAGGCAGACGGCAGCAGG - Intergenic
924893367 1:248308639-248308661 GACAGGAGGCAGAGGGCAGGCGG - Intergenic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1062964750 10:1598678-1598700 CAGAAGATGCAGAAGGCCCCAGG + Intronic
1063014482 10:2062308-2062330 AAGAGGAGGCACCATGCAGCTGG + Intergenic
1063247020 10:4231690-4231712 CAGGGGTGGCAGAAGGGTGCTGG + Intergenic
1063451762 10:6154787-6154809 CAGATCAGACAGAAGGCAGCTGG - Intronic
1064428873 10:15254350-15254372 GGGACGAGGCAGAGGGCAGCTGG + Intronic
1064720474 10:18224290-18224312 AAGAGGAGGGAGAAGGCACACGG - Intronic
1066198794 10:33126951-33126973 CAGAGGAGGCGGGCAGCAGCAGG + Intergenic
1066227064 10:33393718-33393740 GAGAGGAGACAGAAAGCTGCAGG + Intergenic
1066671434 10:37844592-37844614 CAACGTAGGGAGAAGGCAGCTGG + Intronic
1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG + Intergenic
1067370609 10:45678608-45678630 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067389172 10:45847548-45847570 CAGGGGAGGCAGCAGGGTGCGGG - Intronic
1067402846 10:45993326-45993348 CTCAGGAGGCAGGAGGCAGAGGG - Intronic
1067416898 10:46109410-46109432 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067445085 10:46337001-46337023 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067502300 10:46816293-46816315 CAGGGGAGGCAGCAGGGTGCGGG + Intergenic
1067516081 10:46945946-46945968 TAGAGGAGGCAGAAGGAATCTGG + Intronic
1067545235 10:47188119-47188141 CAAAGGAGGCAAAAGCCTGCAGG + Intergenic
1067592287 10:47523727-47523749 CAGGGGAGGCAGCAGGGTGCGGG - Intronic
1067639403 10:48031800-48031822 CAGGGGAGGCAGCAGGGTGCGGG - Intergenic
1067646167 10:48105864-48105886 TAGAGGAGGCAGAAGGAATCTGG - Intergenic
1067874091 10:49988505-49988527 CAGGGGAGGCAGCAGGGTGCGGG + Intronic
1068199974 10:53771390-53771412 AAGAGAAGGCAGAAGACAGGTGG + Intergenic
1068329686 10:55546885-55546907 GAAAGGAAGCAGGAGGCAGCAGG + Intronic
1068375260 10:56170067-56170089 GAAAGCAGGCACAAGGCAGCAGG + Intergenic
1069991544 10:72319629-72319651 CAGCCGGGGCAGAAGGCAGCCGG + Intergenic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070650203 10:78229843-78229865 CAGAGGGGGAAGAAGATAGCAGG - Intergenic
1070732762 10:78842649-78842671 CAGAGGAGGCATAAAGTAACTGG - Intergenic
1070791010 10:79189360-79189382 CATCAGAGGCAGAAGGAAGCTGG - Intronic
1070827977 10:79402127-79402149 CAGAGGAGGCAGAAGGTCCCTGG + Intronic
1070961856 10:80505156-80505178 AAGAGCAGGCAGCAGGGAGCGGG + Intronic
1071405925 10:85332414-85332436 CAGAAAAGGAAGAAGGCAGAGGG - Intergenic
1071602356 10:86964557-86964579 CTGAGGAGGCAGAACGGAGCAGG + Intronic
1071780719 10:88841308-88841330 CAGAGAAGAGAGAAGGCAGTAGG + Intronic
1072227667 10:93385212-93385234 CAGAGGTTCCAGAAGCCAGCGGG + Intronic
1072423770 10:95311636-95311658 AGGAGGCGGCAGAAGGCAGATGG + Intergenic
1072526902 10:96279953-96279975 CATGGGAGGCAGAAGGGAGCTGG + Intergenic
1073096311 10:100982210-100982232 CAGAGGGAGCAGCAGGCAGAGGG + Intronic
1073444851 10:103574551-103574573 CAGAGGAGGCTGAGGTCAGTGGG + Intronic
1073482032 10:103791992-103792014 CAGGAGAGGCAGGAGGAAGCTGG + Intronic
1073633017 10:105167581-105167603 CAGATAAGGCAGAAGACAGCAGG + Intronic
1073718943 10:106143036-106143058 CAGAAGATGCTGAAGGCAGCTGG - Intergenic
1074104786 10:110381242-110381264 CAGAGCATGCAGTAGGCACCTGG + Intergenic
1074148895 10:110740848-110740870 AAGAGGATGCAGAAGTTAGCTGG + Intronic
1074153042 10:110775574-110775596 GAGAGGAGGCAGCAGGCATGGGG - Intronic
1074435714 10:113432468-113432490 CAGTTGAAGCACAAGGCAGCAGG - Intergenic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075222974 10:120600648-120600670 CAGAGGAAGCAGAAGCAAGCCGG - Intergenic
1075651540 10:124130739-124130761 CAGAAGAGGAAGGAGACAGCAGG - Intergenic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1075705226 10:124496641-124496663 CAGGGGACCCAGAAGGCAGACGG - Intronic
1076029068 10:127142355-127142377 CTCAGGAGGCAGGAGGCTGCAGG + Intronic
1076170839 10:128318618-128318640 CGAAGGAGGCAGGAGGCAGCCGG + Intergenic
1076314242 10:129529499-129529521 CAGAGGAGGAGGTAAGCAGCGGG - Intronic
1076525829 10:131112022-131112044 CAGGGGAGGCAGAAAGAAACAGG - Intronic
1076631397 10:131854300-131854322 GAGAGAAGGGAGAAGGCAGAAGG - Intergenic
1076736191 10:132460203-132460225 CTGAGGAGGCCGCAGGCACCGGG - Intergenic
1076788513 10:132764086-132764108 CTTAGGAGGCAGGAGGCAGTGGG + Intronic
1076798559 10:132810364-132810386 CAGAGGGTGCTGAAGGCCGCGGG + Intronic
1077186610 11:1238330-1238352 CAGAGGAGGCAGAAAGGCGGTGG + Intronic
1077363770 11:2153100-2153122 CAGAGAAGGCAGAAATTAGCAGG - Intronic
1077364036 11:2154385-2154407 CAGAGGAGGCAGGAGCCAGCAGG - Intronic
1077449861 11:2634025-2634047 CTGAGCAGGCAGAATGAAGCTGG - Intronic
1077607610 11:3622677-3622699 GATAGGAGGCAGAGTGCAGCAGG - Intergenic
1078280987 11:9900965-9900987 AGGTGGAGGCAGAAGGAAGCAGG - Intronic
1078512782 11:11997901-11997923 CTGAGGATGCAGAAGCCATCTGG + Intronic
1078524158 11:12087835-12087857 AAGAGGAGGAAGAAGTTAGCTGG - Intergenic
1078559840 11:12361850-12361872 CAGAGGTGGCAGGGGGCAGCCGG + Intergenic
1078626355 11:12962379-12962401 AAGAGAAGACAGAAGGCAGGAGG + Intergenic
1079121494 11:17688296-17688318 CAGAGGAGGGAAAGGGCAGGGGG + Intergenic
1079141350 11:17812070-17812092 CAGAAGGGGCAGGAGGCAGCTGG + Intronic
1079250448 11:18783175-18783197 CAGAGGCAGCAGATGGCAGTGGG + Intronic
1079259359 11:18863600-18863622 CTGAGGTGGAAGAAGGCAGATGG - Intergenic
1079366470 11:19814372-19814394 CAGGGGAGGGAGAGGGCAGTGGG - Intronic
1079399002 11:20090738-20090760 CACAGGAAGCACCAGGCAGCTGG + Intronic
1081737499 11:45414119-45414141 CTGAGGAGGTAGGAGGCTGCAGG + Intergenic
1082809210 11:57468423-57468445 CAGAAGAGGCAGAAGACAGATGG - Intronic
1083228498 11:61300068-61300090 GAGAGGAGGGGGAGGGCAGCAGG + Exonic
1083237569 11:61361530-61361552 CAGAGGACGCAGAAAGCACCTGG - Intronic
1083257818 11:61507496-61507518 AAGAGAAGGCAGGAGGCAGGAGG + Intergenic
1083617257 11:64032445-64032467 CAGAGAGGGTAGATGGCAGCTGG + Intronic
1083712785 11:64559342-64559364 CAGAGGAGGCAGGAGGGAGACGG - Intronic
1083731522 11:64654943-64654965 CTGAGCAGGAAGTAGGCAGCAGG + Intronic
1083815730 11:65131381-65131403 GAGGGGATGCAGAAAGCAGCAGG + Intronic
1083885202 11:65570121-65570143 CAGGGGAGGCGGAGGCCAGCGGG + Intergenic
1083894744 11:65614222-65614244 GGGAGGAGGAAGAAGGGAGCGGG - Exonic
1084009983 11:66342285-66342307 CAGAGGGGGAAAGAGGCAGCAGG + Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084491258 11:69479856-69479878 CAGAGGAGGCGGCAGGAAGGTGG - Intergenic
1084717434 11:70882905-70882927 CAGGGCAGGCAGGAGGCAGGTGG + Intronic
1084740294 11:71135051-71135073 CAGAGAAGGCTGAGGGCTGCGGG - Intronic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1084953202 11:72678014-72678036 CAGGGGAGGGGGAAGGAAGCAGG - Intergenic
1085297751 11:75440441-75440463 CTGAGCATGCAGAAGGCAGGTGG - Intronic
1085707734 11:78801695-78801717 CCTAGGAGGCAGCAGGCAGCAGG + Intronic
1085745632 11:79112037-79112059 AAGAGGCTGCAGAAGTCAGCTGG + Intronic
1085964037 11:81498912-81498934 CTGAGGAGGCATAAGACAGAAGG - Intergenic
1087625594 11:100592518-100592540 AAGAACATGCAGAAGGCAGCCGG + Intergenic
1087737064 11:101846140-101846162 GAGAAGAGACAGAAGGCAGAGGG - Intronic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1088756528 11:112889834-112889856 CAGAGGATGGGGAGGGCAGCAGG - Intergenic
1088814110 11:113409983-113410005 CAGGGCCGTCAGAAGGCAGCAGG + Exonic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089403650 11:118180217-118180239 CAGAGTTGCCAGAAGGCAGAAGG + Intergenic
1089583440 11:119495669-119495691 GAGAGGAGGCAGGAGTCAGGGGG - Intergenic
1089742105 11:120591566-120591588 CAGAGGAGGCAGAAGGCAGCTGG - Intronic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1090661277 11:128883588-128883610 CAAAGGGAGCAGAAGGCACCAGG + Intergenic
1091166459 11:133480396-133480418 CAGAAAAAGCAGAAGGCAGTGGG - Intronic
1091391527 12:129110-129132 CAGAGGAGGCAACAGGCAATGGG - Intronic
1091618305 12:2066712-2066734 CAGATGGGGAAGAAGGCAGTAGG + Intronic
1091621272 12:2091148-2091170 CAGCAGAGGCATAGGGCAGCAGG + Intronic
1092111906 12:5970178-5970200 CAGAGGAGGGAGAAGTCTGGAGG - Intronic
1092377346 12:7966921-7966943 GAGAGGTGGCAGAGGGCAGGGGG + Intergenic
1092857307 12:12686216-12686238 AAGAGGTGGCACAAGGAAGCTGG + Intronic
1092998247 12:13971481-13971503 CAGAGGAGGAAGAGGGTAGGAGG - Intronic
1094383046 12:29864560-29864582 AATAGGAGGCAGAAGACAGTTGG + Intergenic
1094622463 12:32093215-32093237 CAGAAGAGGCTTAAGGCAGCAGG + Intergenic
1095044283 12:37483105-37483127 CAGAGGAAGCAGAAGGCAATGGG + Intergenic
1095178271 12:39118017-39118039 TAGAGGAGGCAGAAGGCAGAAGG - Intergenic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096516199 12:52156932-52156954 CAGATGAGGCAGTGGTCAGCAGG + Intergenic
1096581606 12:52589259-52589281 CAGAGGAGGATGGTGGCAGCTGG - Intronic
1096747632 12:53738893-53738915 GAGAGCAGGCAGAGGGCAGGAGG + Intergenic
1096764081 12:53868774-53868796 CAGTGGTGGGAGATGGCAGCAGG + Intergenic
1096816509 12:54205176-54205198 TAGTGGAGGCAGAAGGCTGGCGG - Intergenic
1096836069 12:54352121-54352143 CTGAGGCGGGAGCAGGCAGCTGG - Intergenic
1096975613 12:55697860-55697882 CAGGGGAGGCAGAGGCCTGCGGG - Intronic
1097152767 12:56991707-56991729 AATAGGTGGGAGAAGGCAGCAGG + Intergenic
1098007544 12:66014387-66014409 TAGATGAGGCAGAAGGTATCAGG - Intergenic
1101340888 12:103841158-103841180 CGGTGGCGGCAGCAGGCAGCAGG - Exonic
1101645855 12:106630372-106630394 CAGAGGAGGCGAGAGGAAGCAGG + Intronic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1101996365 12:109528021-109528043 CAGAGGAGGTAGGTGGGAGCAGG + Intronic
1102142617 12:110628022-110628044 CAGAAGAGAGAGAAGGAAGCAGG - Intronic
1102540601 12:113616499-113616521 GGGAGGAGCCAGAAGGCTGCTGG + Intergenic
1102587199 12:113931714-113931736 CAGAACAGGCAGAGGCCAGCAGG - Intronic
1102645826 12:114403265-114403287 CGGAGGAGGCAGGAGGAGGCAGG + Intronic
1102959635 12:117084444-117084466 AAGAGGAGGCAGAAATCCGCTGG + Intronic
1102974765 12:117198640-117198662 CTGAGAAGGCACAAGGCAGAAGG - Intergenic
1103601994 12:122060181-122060203 CGGGGGAGGCAAAGGGCAGCAGG - Exonic
1103833867 12:123803314-123803336 CAGAGGAGGCTGCGGGCAGGTGG + Intronic
1103965393 12:124635880-124635902 CACAGAAGGCAGAAAGCAGCAGG - Intergenic
1104521507 12:129480138-129480160 CAGAGGAGGGTCCAGGCAGCGGG + Intronic
1104700331 12:130898243-130898265 CACAGGAGAAAGAAGGAAGCCGG + Intergenic
1104717018 12:131022624-131022646 CAAAGGAGGCAGAAACCAACTGG - Intronic
1104942817 12:132402899-132402921 CCGTGGAGGCAGGAGGGAGCAGG + Intergenic
1105356635 13:19665006-19665028 CACAGCAGGCAGAAGGCAGGCGG + Intronic
1105472631 13:20706061-20706083 CAGAGTAGCCAGGAGGCAGGAGG - Intronic
1105680832 13:22725681-22725703 CCAAGCAGGCAGCAGGCAGCAGG - Intergenic
1105806050 13:23952103-23952125 CAGAAGTGGCAGGAGGCAGCAGG - Intergenic
1105872205 13:24515461-24515483 CATGGGAGCCAGAAGGCAGTGGG + Intergenic
1106036845 13:26051519-26051541 CAGAGGAGGCTGAGCGCGGCCGG - Intergenic
1106389193 13:29318991-29319013 CCGGGAAGGAAGAAGGCAGCAGG - Intronic
1106512601 13:30424183-30424205 CAGAGGTGGGGGAAGACAGCTGG - Intergenic
1106901332 13:34357517-34357539 CCGAGCTGGCAGAAGACAGCCGG - Intergenic
1107005490 13:35604911-35604933 CAGCTGAGGAAGAAGGGAGCAGG - Intronic
1107058099 13:36128531-36128553 CAGAGGAAGCAGTGGTCAGCAGG + Intronic
1107095077 13:36527287-36527309 CAGAGGAGGGAGAAGGGAGGTGG + Intergenic
1107104353 13:36627199-36627221 CAGAGAAGCCAAAGGGCAGCAGG + Intergenic
1107882283 13:44843245-44843267 CAGAGCAGGAAGGAGCCAGCGGG + Intergenic
1107994633 13:45848172-45848194 ATGAGGAAGCAGAGGGCAGCTGG + Intronic
1108261278 13:48659113-48659135 CAGAGGAGACACTGGGCAGCAGG + Intronic
1108722035 13:53142041-53142063 TACAAGAGGAAGAAGGCAGCAGG - Intergenic
1108888775 13:55226517-55226539 CAGAGGAGTTAGAAAGGAGCAGG + Intergenic
1109784958 13:67161452-67161474 CAGAGGAGGCTGAAATCAGAGGG - Intronic
1109918825 13:69028228-69028250 CAGAAGAGGCAAAAGGAAGGGGG + Intergenic
1110035888 13:70682977-70682999 CAGAGGAGGCATAAGGCCCAAGG - Intergenic
1110774560 13:79393437-79393459 CCGAGGAGACATAAGGCAGAAGG - Intronic
1111442917 13:88304301-88304323 CTGAGGATGCACAGGGCAGCAGG - Intergenic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113350260 13:109522537-109522559 CACAGTAGGCAGAAGTGAGCTGG - Intergenic
1113466854 13:110519002-110519024 CAGAGGAGGCTGAGTGCAGGCGG + Intergenic
1114349959 14:21838850-21838872 CATAGAAGCCAGAAGGCAGTGGG + Intergenic
1114402456 14:22422490-22422512 CAGAGGAGGGACCAGGCAGAAGG + Intergenic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1115498293 14:34027463-34027485 GAGAGGAGGAAGAAGGGAGGGGG + Intronic
1115520832 14:34231536-34231558 CACAGGAGGAAGCAGGCAGCGGG + Intronic
1115641651 14:35339106-35339128 CCTAGGAGACAGAAGGCTGCGGG + Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1117155443 14:52935503-52935525 AAGAAGAGACAGAAGACAGCTGG + Intronic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117460354 14:55939102-55939124 CAGAGTGGGGAGAAGGCAGTAGG + Intergenic
1117805825 14:59489827-59489849 GAGAGGAGGCAGGAGGCAAAGGG + Intronic
1117983372 14:61363738-61363760 CTGAGGATGAAGAAGGCAACGGG + Intronic
1118319786 14:64746494-64746516 CAGAGGAGGATGAAGCCAGCGGG - Exonic
1118327008 14:64788126-64788148 GAGAGGAGGATTAAGGCAGCTGG + Intronic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119444617 14:74652816-74652838 CTCAGGAGGCACCAGGCAGCAGG + Intergenic
1119613644 14:76084043-76084065 CAGCGGAGGGAGGAGGCGGCGGG + Intronic
1119760317 14:77146246-77146268 CAGAGCACGCAGGAGGCAGAGGG + Intronic
1120945105 14:89987526-89987548 CAGAGGAGGAAGCAAGCAGGTGG + Intronic
1120971733 14:90213593-90213615 CAGGGCAGCCACAAGGCAGCCGG - Intergenic
1121148986 14:91613536-91613558 TAGAGTAGGCAGAAGTGAGCAGG + Intronic
1121342360 14:93113135-93113157 CAAAGAAGGCAGAAGTCATCAGG - Intronic
1121436708 14:93925437-93925459 CACAGTAGGCAGCAGGGAGCTGG + Intronic
1122207217 14:100153799-100153821 CAGGTGAGGCACAAGGCATCTGG + Intronic
1122755247 14:103973543-103973565 GAGAAGAGGCAGAGGGCTGCCGG + Intronic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1122874231 14:104656150-104656172 GAGACGTGGCTGAAGGCAGCAGG + Intergenic
1122987017 14:105217188-105217210 CAGAGCAGGCACAGGGCGGCAGG + Intronic
1123037797 14:105478515-105478537 CAGGGCAGGCCGAGGGCAGCCGG - Intronic
1123223451 14:106878032-106878054 CTGAGCACACAGAAGGCAGCAGG + Intergenic
1123438383 15:20272436-20272458 CAAAGGAGGCGCAGGGCAGCAGG - Intergenic
1123467754 15:20529019-20529041 CAGGAGGGGCAGCAGGCAGCAGG + Intergenic
1123650359 15:22472023-22472045 CAGGAGGGGCAGCAGGCAGCAGG - Intergenic
1123728067 15:23124228-23124250 CAGGAGGGGCAGCAGGCAGCAGG + Intergenic
1123740767 15:23280865-23280887 CAGGAGGGGCAGCAGGCAGCAGG - Intergenic
1123746231 15:23321693-23321715 CAGGAGGGGCAGCAGGCAGCAGG + Intergenic
1123813709 15:23955173-23955195 GAGAGAAGGCAGAGGGCAGAGGG + Intergenic
1124278498 15:28345010-28345032 CAGGAGGGGCAGCAGGCAGCAGG + Intergenic
1124304202 15:28566598-28566620 CAGGAGGGGCAGCAGGCAGCAGG - Intergenic
1125339198 15:38657884-38657906 CAGATGAGGAAGCAGGCTGCAGG + Intergenic
1125520039 15:40343452-40343474 GGGAGGAGAAAGAAGGCAGCGGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126290630 15:47072985-47073007 CAGAGGGAGCAGAAGGCAATGGG - Intergenic
1126702060 15:51377405-51377427 CAGAGCAGACAGTGGGCAGCAGG - Intronic
1127054463 15:55117248-55117270 CAGAGGAGGAAGAAAGGAACAGG - Intergenic
1127489021 15:59444587-59444609 CAGAGGAGGCAGGTGGCTCCAGG - Intronic
1127530506 15:59839049-59839071 CAGAGGCTGCAGATGGGAGCTGG + Intergenic
1127583951 15:60364098-60364120 GAGAGGAGGCAGAGCGCAGATGG - Intronic
1127801078 15:62477913-62477935 CAGCGGGGGCAGAGGGGAGCGGG + Intronic
1128083466 15:64870467-64870489 CAGAGGAGGAGGAAGGGAGCTGG - Intronic
1128113993 15:65094224-65094246 GACAGGAGGCAGAGAGCAGCAGG - Intronic
1128119254 15:65133602-65133624 CAGCGGAGGCTGAAGGAAGGGGG + Exonic
1128342273 15:66830878-66830900 CAGAGGAGGCTCCAGGCAGATGG - Intergenic
1128386669 15:67154047-67154069 CAGAGGTTGCAGAAGGCTCCTGG - Intronic
1128506168 15:68274378-68274400 CAGAGGAGGCAGAGGCCAGTGGG + Intergenic
1128871843 15:71165101-71165123 CAGAAGAGGAAGAAGGCCGAAGG + Intronic
1128984839 15:72211982-72212004 CACAGGAGGCTGGAGGGAGCTGG + Intronic
1128997821 15:72309722-72309744 CAGAGGAGGGACATGGCAGTGGG + Intronic
1129161083 15:73748304-73748326 CAGAGGAGGAAGATGGCTGAGGG + Intronic
1129542785 15:76364560-76364582 CATAGGAAGCAGACAGCAGCTGG - Intronic
1129587646 15:76884993-76885015 CAGAGGTTGCTGAAGGCTGCGGG + Intronic
1129599606 15:76990925-76990947 CAGGGGAGGCAGTTGGAAGCAGG - Intergenic
1130011769 15:80157881-80157903 CAGAGATGGCACAAGGGAGCTGG + Intronic
1130610253 15:85354741-85354763 CAGAAGAAGCAGAAGTCACCGGG + Intergenic
1130672037 15:85921149-85921171 CAGGGGAGTTAGCAGGCAGCGGG + Intergenic
1130888700 15:88115276-88115298 CAAAGCAGGCACAAAGCAGCGGG + Intronic
1130970199 15:88726377-88726399 CAGAGGAGGGTGAGGGCAGCGGG + Intergenic
1131021395 15:89102246-89102268 CAAAGGAGGCAGAAAGAAGAAGG - Intronic
1131116821 15:89801135-89801157 CAGAGATGGCAGACAGCAGCAGG - Exonic
1131506936 15:93027683-93027705 CAGAGGAGCCGGAAGACCGCTGG - Exonic
1131602711 15:93865759-93865781 TGGAGGAGGCAGAAGGAAGTGGG + Intergenic
1132023706 15:98386500-98386522 CAGAGGAGGAAGGATACAGCAGG - Intergenic
1132394995 15:101465889-101465911 CAGAGAAGGCAGAAAGGAGTGGG + Intronic
1132588632 16:716836-716858 CACAAGCGGCAGGAGGCAGCAGG - Intronic
1132597431 16:759720-759742 GGGAGGGGACAGAAGGCAGCCGG - Intronic
1133125462 16:3643132-3643154 CAGAGGAGCCAGAGAGCTGCAGG + Intronic
1133235748 16:4386630-4386652 CAGAGCAGGCAGGAGGCTGAGGG + Intronic
1133378051 16:5305946-5305968 CTCAGGAGGCCGGAGGCAGCAGG + Intergenic
1133616402 16:7480810-7480832 TGGAGGAAGCAGAAAGCAGCTGG + Intronic
1133926937 16:10200875-10200897 CAGAGGAGGGAGAAGCCTGATGG + Intergenic
1134175543 16:12003135-12003157 GAAAGGCGGCAGAAGGCGGCTGG + Intronic
1134395220 16:13856270-13856292 GAGAGGAGGCTGAAAGAAGCTGG - Intergenic
1134445507 16:14328132-14328154 CAGAGGATGCTGGAAGCAGCTGG + Intergenic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1135114112 16:19711321-19711343 CAAGGGTGGCAGGAGGCAGCGGG + Intronic
1135914018 16:26587417-26587439 CAGAGGGGGCAGTAGGAATCAGG + Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136687955 16:32006927-32006949 CAGTGGAGGCAGAAACCAGATGG + Intergenic
1136788556 16:32950481-32950503 CAGTGGAGGCAGAAACCAGATGG + Intergenic
1136881256 16:33903453-33903475 CAGTGGAGGCAGAAACCAGATGG - Intergenic
1136938796 16:34500664-34500686 CAGTGGGGGCAAAAAGCAGCGGG + Intergenic
1136961024 16:34847892-34847914 CAGTGGGGGCAAAAAGCAGCGGG - Intergenic
1136986596 16:35112254-35112276 CAGGGGATGCAGAAGCCTGCAGG + Intergenic
1137073741 16:35935252-35935274 TTGAGCAGGCTGAAGGCAGCCGG - Intergenic
1137765120 16:50972087-50972109 AAGGGGAGGCAGATGGGAGCTGG + Intergenic
1138008442 16:53357705-53357727 CAGGAGGGGCAGCAGGCAGCAGG + Intergenic
1138197244 16:55060694-55060716 CAAAGCAGGCACAGGGCAGCAGG - Intergenic
1138233335 16:55357498-55357520 GAGAGTTGGCAGAAGGCAGAAGG + Intergenic
1138294786 16:55876861-55876883 TAGAGGAGGAGGAAGGCAGGGGG + Intronic
1138348029 16:56331807-56331829 CTGAGTAGGCAGAAGTCAGGAGG - Intronic
1138619114 16:58197813-58197835 CGGAGGAGGCAGCGGGCCGCCGG + Exonic
1138858455 16:60724529-60724551 TAGAGGCAGCAGAAGGCATCTGG + Intergenic
1138970573 16:62138156-62138178 CAGAGGAGGCTAAGGGAAGCTGG - Intergenic
1139645532 16:68326888-68326910 CTGATGAGTCAGAAGGCAGCAGG + Intronic
1139671836 16:68497491-68497513 CAGAGCAGAAAGGAGGCAGCAGG - Intergenic
1139684632 16:68593408-68593430 CAGAGAGGGCAGAAGGCTGGCGG + Intergenic
1139775032 16:69311556-69311578 CTTCGGAGGCCGAAGGCAGCGGG + Intronic
1140134928 16:72197601-72197623 CAGTGGAGGAGGAGGGCAGCCGG - Intergenic
1141592286 16:85077074-85077096 CCAGGGAGGCAGAAGCCAGCTGG - Intronic
1141955292 16:87366749-87366771 GAGGGGAGGCAGAGGGCAGACGG + Intronic
1142376284 16:89708646-89708668 CAGAGGCACCGGAAGGCAGCTGG + Intronic
1203090754 16_KI270728v1_random:1211972-1211994 CAGTGGAGGCAGAAACCAGATGG + Intergenic
1142941748 17:3385881-3385903 GAGGGGAGGGAGGAGGCAGCCGG - Intergenic
1143098555 17:4491753-4491775 CAAAGCTGGCAGCAGGCAGCTGG + Intergenic
1143730854 17:8881922-8881944 AAGAGAAGGCAGCAGGCACCGGG - Intronic
1143794696 17:9327240-9327262 CAGAGGAGGAAGGAGGAAGGAGG + Intronic
1144210678 17:13012517-13012539 GACTGAAGGCAGAAGGCAGCAGG - Intronic
1144257761 17:13486464-13486486 CAGAGGCAGGAGAAGGCAGGAGG + Intergenic
1144273600 17:13643645-13643667 CAGAGGATCCTGAAGGCACCGGG + Intergenic
1144453742 17:15402510-15402532 CAGAGGAGGCAGCAAGAGGCCGG + Intergenic
1144575764 17:16428442-16428464 CAGTTGTGGCAGAAGGCACCAGG + Intronic
1144849075 17:18235032-18235054 CATAGGTGGCAGAGGGCACCAGG - Intronic
1145255146 17:21318263-21318285 CAGCGCAGGCAGCAGGCAGCAGG + Intergenic
1145302729 17:21652596-21652618 CAGAGGAGACAGAGGGCAGGAGG - Intergenic
1145321460 17:21769692-21769714 CAGCGCAGGCAGCAGGCAGCAGG - Intergenic
1145327582 17:21843895-21843917 CAGCGGGGGCAAAAAGCAGCGGG - Intergenic
1145347574 17:22050592-22050614 CAGAGGAGACAGAGGGCAGGAGG + Intergenic
1145416012 17:22714736-22714758 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1145969767 17:28950068-28950090 CACTGGAGGTGGAAGGCAGCCGG + Exonic
1146147516 17:30433901-30433923 TCGAGGAGGCAGAATGCAGTGGG - Intronic
1146371626 17:32268127-32268149 CAGAGTAGGGAGGAGGCAGGAGG - Intronic
1146891746 17:36510819-36510841 CAGGGCAGGCAGACAGCAGCAGG - Exonic
1146906619 17:36622186-36622208 AGGAGGGGGCAGGAGGCAGCAGG - Intergenic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1147148941 17:38502602-38502624 CAGTGGAGGCAGAAACCAGATGG + Intronic
1147606452 17:41776418-41776440 CAGAGGAGGCGGAAGCCAGCTGG + Intronic
1147632265 17:41939739-41939761 AAGAGGAGGCTGAAGGAAGTGGG + Intronic
1147684343 17:42277613-42277635 CAGAGAAGGAAGCAGGAAGCAGG + Intergenic
1147774396 17:42890405-42890427 CAGAGGAGGCTGAAGTCCCCAGG + Intergenic
1147971673 17:44221555-44221577 AGCAGGAGGCAGGAGGCAGCGGG - Exonic
1147987427 17:44314693-44314715 CAGAGGATGCAGCAGGCCCCTGG - Intronic
1148051020 17:44769953-44769975 CAGAGGGGGCAGCAGGAAGGGGG - Intronic
1148063281 17:44851070-44851092 CAGAGGCCACAGAAGGAAGCAGG + Exonic
1148132440 17:45270339-45270361 CAGAGGAGGCAGGTGGGCGCAGG - Intronic
1148171833 17:45527378-45527400 CAGAGGGAGCAGAATGGAGCTGG + Intergenic
1148277541 17:46319011-46319033 CAGAGGGAGCAGAATGGAGCTGG - Intronic
1148299748 17:46536876-46536898 CAGAGGGAGCAGAATGGAGCTGG - Intronic
1148335837 17:46840946-46840968 AAGTGGAGGCAGAAAGCAGCCGG + Intronic
1148364188 17:47041186-47041208 CAGAGGGAGCAGAATGGAGCTGG - Intronic
1148680917 17:49473036-49473058 CAGTGGCGGCTGAAGGCAGTTGG - Intronic
1149132174 17:53316122-53316144 CAGGGGAGTCAGAAGGGAGATGG + Intergenic
1149222348 17:54429552-54429574 TTGAGAAGGCAGAAGGCAGATGG + Intergenic
1150130060 17:62664333-62664355 CAGATGAGGCAGAGGCCTGCAGG - Intronic
1150215193 17:63463953-63463975 GAGAGGAGGCTGGAAGCAGCAGG + Intergenic
1150375355 17:64676813-64676835 CTGAGAAGGCAGAAGGCAACTGG + Intergenic
1150435010 17:65146983-65147005 CTGAGGAGGCAACAGGCTGCAGG - Intronic
1150627232 17:66849344-66849366 CAGAGGAGGAGGAGGCCAGCAGG + Intronic
1151270674 17:72993177-72993199 CAGAAGGGGCAGCAGGCACCAGG + Intronic
1151397262 17:73831747-73831769 CAGAGGCTGTAGAAGGCAGACGG - Intergenic
1151584758 17:75002278-75002300 AAGGAGAGGCAGCAGGCAGCAGG + Intronic
1151621790 17:75250133-75250155 CTGGGGAGGCAGTAGGCAGATGG - Intronic
1152026177 17:77810862-77810884 CAGATGAGACAGAAGGCTCCAGG + Intergenic
1152070283 17:78130866-78130888 CAGTGGAGGGAGAATGCAGAGGG + Intronic
1152158099 17:78648104-78648126 CTGTGGAGTCAGAAGGAAGCCGG + Intergenic
1152295769 17:79466192-79466214 TAGAGGAGGGAGGAGGCCGCTGG - Intronic
1152337590 17:79707230-79707252 CAGGGGAGGAAGAAGGGAGGAGG - Intergenic
1152421552 17:80195969-80195991 CAGTGGTTTCAGAAGGCAGCAGG + Intronic
1152446855 17:80349925-80349947 CTGGGGAGGGAGAGGGCAGCAGG - Intronic
1152494611 17:80662217-80662239 GATAGGAGGCAGAAGGCGGCTGG - Intronic
1152598345 17:81249179-81249201 AAGAGGAGACAGAAGGGAGGAGG + Intronic
1152613946 17:81329472-81329494 CAGAGGAGGGAGGAGGGAGGAGG + Intronic
1152629116 17:81401872-81401894 CAGAAGGGGGAGAATGCAGCTGG - Intronic
1152755928 17:82087014-82087036 CAGAGGTGTCCGAAGCCAGCAGG + Intronic
1152805113 17:82352059-82352081 CAGAGCAGCCCGGAGGCAGCAGG - Intergenic
1153250720 18:3118960-3118982 CAGAGGAAGCAAGAGGCACCAGG + Intronic
1154199612 18:12290183-12290205 AAGAGAAGGCAGAAGTCACCAGG + Intergenic
1154269121 18:12904233-12904255 CAGAGGAGCCTGAGGGCTGCTGG - Intronic
1154356118 18:13624354-13624376 CAGAGGAGGCAGGAGTCACTGGG - Intronic
1154503188 18:15006586-15006608 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1155100727 18:22607622-22607644 CAGGGGAGGCAGAGATCAGCAGG - Intergenic
1155308922 18:24505512-24505534 CAGTGGTGGCAAAAGTCAGCAGG + Intergenic
1155315836 18:24569172-24569194 CAGAAGAGGCAGAAGCCAGTAGG - Intergenic
1155345188 18:24850667-24850689 CACAGGAGACAGAAGGGAGGGGG - Intergenic
1155442010 18:25871880-25871902 AAGAGAAGGAAGAAGGAAGCGGG + Intergenic
1156482411 18:37444670-37444692 CAGAGGAGGAAGGAGGGAGGTGG + Intronic
1156518732 18:37703339-37703361 GAGAGGTGGCAGCAGGGAGCAGG - Intergenic
1156664023 18:39383495-39383517 CAGAGGAGGGAGAGCCCAGCGGG - Intergenic
1156746009 18:40392167-40392189 CAGATCAGGCAGAAGGGAGAGGG - Intergenic
1157289231 18:46398310-46398332 CAGGGCAGGAAGAAGGAAGCAGG + Intronic
1157289335 18:46398824-46398846 GAGAGAGGGCAGAAGCCAGCAGG - Intronic
1157665950 18:49487089-49487111 CCGAGGAGGGAGGAGGCAGGAGG + Intronic
1157811925 18:50703411-50703433 CAGAAGATGCTGAAGGCAGGTGG - Intronic
1160398039 18:78586304-78586326 CAGAGGAGCCTGCAGGCACCAGG + Intergenic
1160495453 18:79371738-79371760 CAGGGGACACAGAAGACAGCAGG - Intronic
1160773902 19:846127-846149 CAGCTGGGGCAGAAGGCAGGCGG - Exonic
1161316597 19:3620280-3620302 CACAGGAGGCTGAGGGCAGCGGG + Intronic
1161393822 19:4034453-4034475 CAGAGGAGGCAACCAGCAGCTGG + Intronic
1161608052 19:5225609-5225631 CAGAGGGTGCACCAGGCAGCTGG - Intronic
1162178481 19:8849115-8849137 CAGAGGAAGCATAAGGCCTCTGG - Intronic
1162498680 19:11038436-11038458 CACAGCAGGCAGGAGGCACCAGG - Intronic
1162534766 19:11256325-11256347 CAGAGGAGGGAGAGGGGAGGAGG + Intronic
1163406478 19:17126188-17126210 CAGAGGGGGCGGAGGCCAGCAGG - Intronic
1163461724 19:17442364-17442386 CTCAGGAGGCTGAAGGCAGGAGG - Intronic
1163618008 19:18341011-18341033 CAGAGGAGGCAGGTGCCAGGAGG - Intronic
1163663857 19:18594163-18594185 CAGGGGAGGGGGAAGACAGCAGG - Intronic
1164064760 19:21706389-21706411 AGGAGGAGGCAGCAGGAAGCTGG - Intergenic
1164169164 19:22709286-22709308 CCGAGGTGGCAGCAGGAAGCTGG - Intergenic
1164250068 19:23468367-23468389 GAGAGGAGGGAGAAGGGAGGAGG - Intergenic
1165245026 19:34493811-34493833 GAGAAGAGGCAAAAGACAGCTGG - Intronic
1165298567 19:34950234-34950256 GACAGAAGGCAGAAGGCAGTGGG + Intergenic
1165730618 19:38142539-38142561 CAGGGGAGGAAGGAGGCAGAGGG - Intronic
1165731856 19:38151036-38151058 GAGAGGAGGCAGAAGGAATCTGG - Intronic
1165944403 19:39433058-39433080 GAGTGGAAGCAGAAGGCAGGGGG - Intergenic
1166224864 19:41388598-41388620 TAGAGGAGGAAAAAGGAAGCAGG - Intronic
1166316500 19:41992543-41992565 AAGAGGAGGCAGAGGGCAAAGGG - Intronic
1166344195 19:42155182-42155204 CAGAGAAAGATGAAGGCAGCCGG - Intronic
1166349727 19:42190542-42190564 CAAATGAGGCAGAAGGCTGGGGG + Intronic
1166356166 19:42228895-42228917 CAGGGCAGGCAGAATGCAGTTGG + Intergenic
1166754338 19:45181094-45181116 GGGAGGAGGCAGGAGGCAGATGG - Exonic
1167456308 19:49597967-49597989 CTGAGGAGGCAGGGGGCACCCGG + Exonic
1167605158 19:50477903-50477925 CAGAGGACACAGAAGGCCCCAGG - Intronic
1168258332 19:55179308-55179330 AGGACGAGGCAGAAGTCAGCGGG - Intronic
1168323091 19:55521845-55521867 CAGAGCTGGCAGAAGGTGGCAGG - Intergenic
1168629228 19:57944180-57944202 CAGAGGAGAAAGCAGTCAGCTGG + Intronic
1168654424 19:58117393-58117415 CAGTGGAGTCAGAACCCAGCAGG + Intronic
925033612 2:670764-670786 CAGAGCTGGCAGGAGGCCGCAGG + Intronic
925059902 2:883014-883036 CAGGGAAGGCTGAAGGCAGAAGG + Intergenic
925474706 2:4200172-4200194 TAGAGCAGGCAGAGGACAGCAGG + Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
926210008 2:10862629-10862651 CAGAGGAGGCAAGAAGCAGGTGG + Intergenic
926768987 2:16351349-16351371 CAGAGGCTGCACAGGGCAGCAGG - Intergenic
926802011 2:16666764-16666786 CAGAGGAGGCGGGAAGCATCAGG + Intergenic
927256894 2:21047536-21047558 GAGAGAAGCCAGAAGTCAGCAGG + Intergenic
927259864 2:21077426-21077448 CAAAGGAGTCAGAAGGGAGTGGG + Intergenic
927266537 2:21159190-21159212 GGGAGCAGGAAGAAGGCAGCAGG + Intergenic
927377616 2:22436600-22436622 CTGAGGGGGCAGAAGGGAGGTGG - Intergenic
927640314 2:24841615-24841637 CACTGCAGGCAGAAGACAGCTGG + Exonic
927654335 2:24932782-24932804 CAGAGGTGGCAGATGGAAGGAGG + Intergenic
927725554 2:25419702-25419724 CAGAGGACGAAGCAAGCAGCAGG + Intronic
927843981 2:26461997-26462019 GAGAGGAGGCAGAGGGAAGGTGG - Intronic
927951757 2:27175023-27175045 CTGAGGATGCAGAAGGCAGAGGG - Intergenic
927996934 2:27493479-27493501 CTGAGAAGGGAGAAGGCAGAAGG + Intronic
928021363 2:27707666-27707688 CAGAGGAGGCAGAATGGTCCAGG + Exonic
928131476 2:28654759-28654781 AAGAAGAGGGAGAAAGCAGCCGG + Intergenic
929474081 2:42227685-42227707 CAGAGGAGGAGGAAGGGGGCGGG - Intronic
929545235 2:42851268-42851290 TGGCGGAGGCAGAGGGCAGCTGG + Intergenic
929578037 2:43064895-43064917 CAGAGCAGGAATAAAGCAGCAGG - Intergenic
929817796 2:45249407-45249429 CAGAGGAGGCGGAAGTGAGATGG + Intergenic
929818703 2:45256880-45256902 CAGTGGGGGCAGGACGCAGCAGG + Intergenic
930068665 2:47347703-47347725 GAGAGGAGGTACAAGGAAGCTGG - Intronic
930701144 2:54457894-54457916 CAGTGCAGGCAGAGGGGAGCCGG + Intronic
930763645 2:55062153-55062175 TGGAGGAGCCAGAAGGCAGATGG - Intronic
931784998 2:65610615-65610637 CACAGGAGTCAGAAGGCAGGAGG + Intergenic
932104286 2:68928512-68928534 CAGAGTGGTCAGTAGGCAGCAGG - Intergenic
932649158 2:73536977-73536999 CAGAGGATGCAAAATGGAGCTGG + Intronic
932720823 2:74138062-74138084 GAGAGCAGGGAGAAGGCATCAGG - Intronic
933648478 2:84830837-84830859 CTGAGGAGAAAGAGGGCAGCTGG + Intronic
933805440 2:85995631-85995653 CAGAAGAGGCAGGAGTCAGCTGG + Intergenic
933837415 2:86257004-86257026 CACCAGAGGCAGAAGGCAGGGGG - Intronic
933851668 2:86372348-86372370 CTGTGGGGGCAGAAGACAGCTGG + Intergenic
934695857 2:96399772-96399794 CAGTGGAGGATGGAGGCAGCAGG - Intergenic
934977817 2:98817592-98817614 CAGAGAAGGCAGGTGGTAGCTGG - Intronic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
936141636 2:109946925-109946947 CAGAGGAGGGAGAAGCCTGGCGG - Intergenic
936178324 2:110244873-110244895 CAGAGGAGGGAGAAGCCTGGCGG - Intergenic
936765948 2:115848661-115848683 CTGAGGAGGCAGAAGGCAGAAGG - Intergenic
937098144 2:119248931-119248953 CAGTGGAGGCTGGAGGCAGTGGG + Intronic
937141909 2:119609252-119609274 CAGAGGAGACAGGAGTCTGCTGG + Intronic
937477771 2:122230189-122230211 CAGTGGAGGCAGAGGCCTGCAGG - Intergenic
937856911 2:126678848-126678870 CAGGGGCGGCAGGAGGCAGGAGG - Intronic
937921071 2:127131296-127131318 CACAGATGGCAGAAGGCAGAAGG - Intergenic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
938502369 2:131836756-131836778 CAGAGGAGGCAGAGGGCAGGAGG - Intergenic
938518363 2:132038568-132038590 GAGAGGGGGCAAAAAGCAGCGGG + Intergenic
938622275 2:133068460-133068482 CAAAGGAAGCAGAAGGCAATGGG + Intronic
938924194 2:136024305-136024327 AAGAGATGGCAGAAGGCTGCAGG + Intergenic
939119775 2:138102308-138102330 CTGTGGAGGCAGAAGGTAACAGG - Intergenic
939257785 2:139766696-139766718 CAGTGCAGGCAGAAGGAAGTGGG + Intergenic
939373847 2:141338305-141338327 AAGAGGAAGCAGAAGAAAGCAGG + Intronic
940751074 2:157628326-157628348 CGGAAGAGGGAAAAGGCAGCAGG - Intronic
940860677 2:158767654-158767676 GATATGAGACAGAAGGCAGCAGG + Intergenic
941276672 2:163498469-163498491 CAGAGGAAGGAACAGGCAGCAGG + Intergenic
941490112 2:166133209-166133231 CAGGGAAGGCAGAGGGCAACTGG - Intergenic
941751461 2:169139265-169139287 CAGAGCAGGCAAAAGGGAGCCGG + Exonic
942495320 2:176534044-176534066 CAGAGGAAGCAGAAGGGATCAGG + Intergenic
944408526 2:199413471-199413493 CAGAGAAGGCAGAGAGCAGAGGG - Intronic
945111242 2:206361862-206361884 CAGAGGATGCAGAAGGTAGTGGG - Intergenic
946177128 2:217928757-217928779 AAGAGGAAGCAGTGGGCAGCTGG - Intronic
946340132 2:219061108-219061130 CAGGGGGCGCAGAGGGCAGCGGG - Intergenic
946408738 2:219506204-219506226 GGGAAGAGGCAGGAGGCAGCAGG - Intronic
946519043 2:220446536-220446558 CAGAGGAGGAAGGGGGCAGGGGG - Intergenic
946668768 2:222079598-222079620 TAGAGGAGGGAGAAGGAAGAAGG - Intergenic
946762362 2:223007219-223007241 AAAAGGAGGCAGAAGGGTGCTGG - Intergenic
947207513 2:227675353-227675375 TATAGGAGGCTGAAGGCAGTTGG + Intergenic
947316352 2:228863546-228863568 CAGAGAAGGCTGAAGGGAACAGG - Intronic
947408924 2:229813197-229813219 TGGAGGAGGCAGATGGGAGCAGG - Intronic
947462841 2:230318034-230318056 CAGAGCAGGAAGGAGGCAGAGGG + Intergenic
947597908 2:231425634-231425656 CAGAGGTTGCAGAAAGCAACAGG + Intergenic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
947922666 2:233891692-233891714 CAGGGGAGGTAGAGGGCAGAAGG + Intergenic
948200609 2:236127435-236127457 GAAAGGAGGGAGAAGGCAGCGGG + Exonic
948204407 2:236155544-236155566 CAGAGGAGACTGGAGTCAGCAGG - Intergenic
948259301 2:236591035-236591057 AGCAGGAGGCAGGAGGCAGCAGG - Intergenic
948498906 2:238376438-238376460 AAGAAGAGGCATAAGGCGGCAGG - Intronic
948588263 2:239034818-239034840 CAGAGGAGGCAGGAGGCTGGGGG - Intergenic
948595496 2:239076885-239076907 TAGAGGAGGCTGAAGGGTGCTGG - Intronic
948607853 2:239147221-239147243 CCTAGGGGGCAGAAGGCAGCCGG + Intronic
948757945 2:240170026-240170048 CAGAGGTGGGAGAAGGGAGCGGG - Intergenic
948837251 2:240631713-240631735 CAGGAGAGGCAGAAACCAGCAGG - Intergenic
948914415 2:241025095-241025117 CACAGCAGGCAGCAAGCAGCAGG + Intronic
949045943 2:241872700-241872722 CTGAGGTGGCTGAAGGCAACGGG + Exonic
1168821155 20:774639-774661 GCCAGGAGGCAGGAGGCAGCTGG + Intergenic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1169376285 20:5068986-5069008 CATAGGGGGTAGAGGGCAGCTGG + Intronic
1169751641 20:9000604-9000626 CTGAGGAGGTATAAGGCAGAAGG - Intergenic
1169837666 20:9898560-9898582 CAATGGAGGCAGGAGGCAGTGGG + Intergenic
1170747683 20:19115320-19115342 AACAGGAGGCAGAAGGTAGAAGG - Intergenic
1170778637 20:19403617-19403639 CAGACATAGCAGAAGGCAGCAGG + Intronic
1170823238 20:19771865-19771887 AAGAGGAGGCAGGAGGAGGCAGG - Intergenic
1171519319 20:25764127-25764149 CAGAGGAGACAGAGGGCAGGAGG - Intronic
1171538827 20:25926730-25926752 CAGAGGGAGCAGAAGGCAATGGG + Intergenic
1171557605 20:26092364-26092386 CAGAGGAGGCAGAGGGCAGGAGG + Intergenic
1171841765 20:30222056-30222078 CAGAGGGAGCAGAAGGCAATGGG + Intergenic
1171964087 20:31516211-31516233 CAGAGGAGGCGAAGGACAGCTGG + Intronic
1172221619 20:33278057-33278079 CAGAGGTGGATGCAGGCAGCCGG - Intronic
1172292131 20:33784114-33784136 AAGAGGAGGGAGAAGGGTGCTGG - Intronic
1172447807 20:35002281-35002303 CAGGGAAGGCTGAAGGCAGCAGG - Exonic
1172778214 20:37420346-37420368 CAGAGGGGGAAGAAGGCATGGGG - Intergenic
1172782854 20:37447538-37447560 CATAGGAGGAAGAAGGGAACAGG - Intergenic
1172837974 20:37885159-37885181 CAGAAGAGGCAGAACCTAGCAGG - Intergenic
1172842660 20:37911445-37911467 CAGAGCAGCCAGAACACAGCGGG + Intronic
1173579592 20:44137589-44137611 CAGGGGAGGAAGAAGCCACCAGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173997925 20:47353698-47353720 CTGAGGAGGCAGAAGGAAAAAGG + Intronic
1174291841 20:49514361-49514383 AGCAGGAGCCAGAAGGCAGCGGG + Exonic
1174330013 20:49810612-49810634 CAGAGGAGGCCAAGGGCAGTAGG + Intergenic
1174417098 20:50374732-50374754 GAGAGCAGGGAGGAGGCAGCAGG - Intergenic
1174507024 20:51023396-51023418 CAGACGGGGAAGAAGGCAACGGG - Intergenic
1174518299 20:51110239-51110261 CAGAGAAGGAAAAAGGCAACAGG - Intergenic
1175208707 20:57332677-57332699 TAAAGGTGGCAGAAGGCACCAGG - Intronic
1175269525 20:57723999-57724021 CAGAGGAGCCAGCAGCCACCAGG - Intergenic
1175312926 20:58024364-58024386 CAGAGGGGGCTGAGGGCAGCAGG + Intergenic
1175547162 20:59785839-59785861 CAGGGGATGCAGAGGGCTGCTGG - Intronic
1175547180 20:59785925-59785947 CAGGGGAGGCAGAGGGCCGTTGG - Intronic
1175909364 20:62397308-62397330 AAGGGGAGGCAGACGGCAGGTGG - Intronic
1175911760 20:62408404-62408426 CACAGGAGGGAGCAGGCAGGCGG - Intergenic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1176243307 20:64084911-64084933 CAGAGAAGGCAGCAAGCAGGGGG - Intronic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1178457218 21:32766614-32766636 GAGAGGAAGTAGAGGGCAGCAGG - Intronic
1178724122 21:35036074-35036096 CAGAAGAGGGAGCAGGGAGCAGG + Intronic
1178991224 21:37358336-37358358 CAGCAGGGGCAGAAGGGAGCTGG - Intergenic
1179499756 21:41800781-41800803 CACAGGTGGCAGCAGGCAGCAGG - Intronic
1180060483 21:45382526-45382548 CTGAGGAGGAAGAAGGAAACAGG + Intergenic
1180079494 21:45480308-45480330 CAGAGAAGCCTGAAGGCAGGTGG - Intronic
1181179374 22:21056041-21056063 CAGAAGAGGGAGGAGTCAGCAGG - Intronic
1181293806 22:21818929-21818951 GAGGGGAGGCTGAAGGCTGCAGG + Intronic
1181513253 22:23398163-23398185 CAGAGGACGGAGGAGGCAACAGG + Intergenic
1181747744 22:24967600-24967622 AAGAGGAGGCAGAGAGCAGCAGG + Intronic
1182473755 22:30564596-30564618 CAGTGCAGGCAGCTGGCAGCAGG + Intronic
1182517830 22:30869080-30869102 CAGGTGGGGCAGGAGGCAGCTGG - Intronic
1182711994 22:32328982-32329004 AAGAGGAAGCAGGAGGCAGAGGG - Intergenic
1182771794 22:32801704-32801726 CAGAGCGGGCAGCAGGCAGGCGG + Exonic
1182913195 22:34004790-34004812 CCCAGGAGTCAGAAGGCAGTAGG + Intergenic
1183111609 22:35653599-35653621 GACAGAAGGCAGAAGGCAGAAGG + Intronic
1183217759 22:36492161-36492183 CAGATGAGGAAGAGGACAGCGGG + Intronic
1183316343 22:37139052-37139074 CAGAGGAGGTGGAAGGAAGGAGG + Intronic
1183390182 22:37541273-37541295 CAGAAGTGGCAGAAGGAGGCCGG + Intergenic
1183494877 22:38137369-38137391 CAGAGACGGCATCAGGCAGCTGG - Intronic
1184358249 22:43996765-43996787 CAGAGGAGGCCCACGGCAGCGGG + Intronic
1184362664 22:44027496-44027518 CAGAGACAGCTGAAGGCAGCGGG + Intronic
1184399538 22:44265866-44265888 AAGAGGAAGCAGGAGGCAGAGGG - Intronic
1184461687 22:44641318-44641340 CAGCGGAGGCAGCAGACAGCAGG + Intergenic
1184606968 22:45579805-45579827 AAGAGGAGGGAGAAGGAAGTAGG - Intronic
1184695236 22:46135295-46135317 CTCAGGAGGCAGGGGGCAGCTGG + Intergenic
1184704624 22:46202145-46202167 CAGAGGAGGCAGGAGGGGGCTGG - Intronic
1184799087 22:46749170-46749192 CAGAGAAAGCAGCAGGCAGTCGG - Intergenic
1184949815 22:47833284-47833306 CAGAGGAGGATGGAGCCAGCTGG + Intergenic
1185127726 22:49021177-49021199 CAGAGGGGGCAGAGAGCAGCGGG - Intergenic
1185173221 22:49305348-49305370 CAGAGGCGGCAGCAGCCACCAGG - Intergenic
1185223348 22:49640036-49640058 GGGAGGAGGCAGAGGCCAGCCGG + Intronic
1185399060 22:50606687-50606709 CACAGGAGGCAGGAGGGCGCAGG - Exonic
1185416337 22:50712396-50712418 CAGAGGAGGCTGCCGGAAGCCGG - Intergenic
949243424 3:1897001-1897023 CAGAGGAAACAGAAGGCATAAGG - Intergenic
950438179 3:12993092-12993114 CATAGGGGGCAGGTGGCAGCAGG - Intronic
950546040 3:13638636-13638658 CAGAGGAGGGAGGAGGGAGGAGG - Intergenic
950649111 3:14396298-14396320 CAGGGCAGGCAGGAGGCAGCCGG + Intergenic
950663711 3:14482401-14482423 GAGAGGAGGCTGAAGGTAGGTGG - Intronic
950853769 3:16086841-16086863 CCGAGGAGCCAGGAGGCAGGAGG + Intergenic
951412534 3:22382113-22382135 CAGAAGAGGAAGAAGGCCGAAGG - Intergenic
951701295 3:25499414-25499436 CAGAAGAGAGAAAAGGCAGCAGG + Intronic
951827176 3:26881603-26881625 AAGGGGTGGCAGAAGGCACCTGG + Intergenic
953381520 3:42476236-42476258 CAGAGGATGGAGAAGTCAGGAGG + Intergenic
953648165 3:44774292-44774314 CTGAGGAGGCTGAATGTAGCAGG + Intronic
953660915 3:44890968-44890990 TGGTGGAGGCAGAAGCCAGCTGG - Intronic
954431143 3:50471441-50471463 CAGAAGAGGAAGAAGGAAGCTGG - Intronic
954433602 3:50484389-50484411 CAGAGGAGGGACATGACAGCAGG - Intronic
954456249 3:50601280-50601302 CAGAGGAGGCCGCAGGCGGGAGG - Intergenic
954596471 3:51829698-51829720 CAGAGGCGGCAGAAGGTAGGTGG + Exonic
954935751 3:54325003-54325025 GAGGGGAGGGAGAAGGCAGAAGG + Intronic
956741566 3:72279927-72279949 AGGAGGAGGGAGAGGGCAGCAGG + Intergenic
956855482 3:73270762-73270784 TTGAAGAGGCAGAAGGAAGCAGG - Intergenic
956907636 3:73783041-73783063 CAGAGGAGGCAAGAGGGACCAGG + Intergenic
957170885 3:76735435-76735457 TAGAGGGGGAGGAAGGCAGCGGG + Intronic
957274103 3:78068170-78068192 AAGAGAAGGCAGAAGGCAGAAGG + Intergenic
959498286 3:107076306-107076328 AAGATGAGGCACAAGGCAGGAGG + Intergenic
959559902 3:107767776-107767798 CACATGGGGCAGAAGGCAGTGGG - Intronic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
960176683 3:114525556-114525578 TAGAGGAGGGAGAAATCAGCAGG - Intronic
961361979 3:126373803-126373825 CAGGGGAGGCAGAAACCAGAGGG - Intergenic
961502048 3:127343113-127343135 CAGAGGAGACCTAAGGCAACAGG - Intergenic
961505574 3:127368751-127368773 GAGAAGAGGAAGAAGGCAGTGGG + Intergenic
961511574 3:127406950-127406972 CCACGGAGGCAGAATGCAGCTGG + Intergenic
961567546 3:127774351-127774373 CAGGGGAGGCAAGAGGCAGGAGG - Intronic
961822285 3:129581161-129581183 AACAGCAGGCAGCAGGCAGCGGG - Intronic
962059800 3:131913693-131913715 CCAAGGAGGCATAAGGCAGAAGG - Intronic
962253596 3:133855055-133855077 CATAAGTGGCAGAAAGCAGCTGG + Intronic
963104352 3:141633254-141633276 GATAGGAGGCAGGAGGGAGCTGG + Intergenic
963437894 3:145294939-145294961 CAGCAGAGGCAGAAGGCACTAGG + Intergenic
963511916 3:146257133-146257155 CAGAGGTTGCACAGGGCAGCAGG + Intergenic
963606372 3:147414594-147414616 CAGAAGAGGCAGCAGGTTGCTGG - Exonic
963765796 3:149334845-149334867 CAGAGGTGGTAAAAGGAAGCTGG + Intergenic
964560997 3:157996520-157996542 AAGTGGAAGCAGAAGGCAGAAGG + Intergenic
965055325 3:163705659-163705681 CAAAGGAGGGAGAAGGCTGATGG + Intergenic
965542315 3:169882404-169882426 CAGAGGATACAGTAAGCAGCCGG - Intergenic
966869422 3:184280464-184280486 CAGAGAGGTCAGCAGGCAGCTGG + Intronic
967091375 3:186137549-186137571 CTGACGCGGCAGAAGGGAGCCGG + Intronic
967871316 3:194232114-194232136 CAAAGGTGGCATGAGGCAGCTGG + Intergenic
968472823 4:789856-789878 CAGAGGAGGCTGGAGGCAGCAGG + Intronic
968489989 4:884791-884813 CAGAGCAGGCCGGAGGCTGCGGG + Intronic
968584703 4:1410757-1410779 CAGGGGAGGAAGAGGGCGGCAGG + Intergenic
968767770 4:2482868-2482890 CAGAGGAGGTTGAAGAAAGCCGG - Intronic
968963925 4:3759932-3759954 CAAAGGAGGCAGAATTGAGCTGG + Intergenic
969070130 4:4529625-4529647 CTGGGGAGGCAGCAGGCAACCGG + Intronic
969114545 4:4862973-4862995 AAGGAGAGGCCGAAGGCAGCCGG - Exonic
969311385 4:6354674-6354696 AACAGGGTGCAGAAGGCAGCTGG + Intronic
969566521 4:7982004-7982026 CAGAGAGGGGAGAAGGCACCAGG - Intronic
970444904 4:16115424-16115446 CAGAGGGGTCAGAAAGCAGGAGG - Intergenic
971149323 4:24014322-24014344 CTAAGGAGGCAGGCGGCAGCAGG + Intergenic
972349721 4:38225531-38225553 CAGGGGACCCAGAAGGCAGAAGG - Intergenic
972836429 4:42876127-42876149 CAGAGAAGGAAGAGGGTAGCAGG + Intergenic
974016533 4:56654115-56654137 GACAGCAGCCAGAAGGCAGCAGG - Intronic
975652881 4:76612038-76612060 GAGAGGAGGCAGAGGCAAGCAGG - Intronic
975707126 4:77122305-77122327 TAGAGAAGGAAGAAGCCAGCAGG + Intergenic
976274027 4:83258055-83258077 AAGAAGAGCCAGAAGGCAGCAGG + Intergenic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
978772489 4:112471414-112471436 CTCAGAAGGCAGAAGGCAGGGGG + Intergenic
979145826 4:117246575-117246597 CAGAGGAGGCAGAGGGAACAGGG + Intergenic
979147792 4:117267209-117267231 AAGAGAAGGGACAAGGCAGCAGG + Intergenic
979448273 4:120839887-120839909 GAGCTGAGGCAGCAGGCAGCTGG + Intronic
979646999 4:123081254-123081276 CAGAGGAGGCAGAAATGAACAGG - Intronic
981082123 4:140645823-140645845 CAGAGGGGGCAGCCAGCAGCCGG - Intronic
981093498 4:140756387-140756409 AAGAGGAGGAGGAAGGGAGCGGG + Intergenic
982868459 4:160546694-160546716 GAGAGGAGGAGGAAGGCAGATGG - Intergenic
983301067 4:165926530-165926552 CTCAGGAAGCAGAAGGCAGAGGG + Intronic
984273932 4:177584622-177584644 CAGAAGAAGTAGAAGCCAGCAGG + Intergenic
985087630 4:186329611-186329633 AAGAGGAGGCAGGCGGCTGCGGG + Intergenic
985566476 5:620870-620892 CCGGGGAGGCAGGAGGCAGATGG - Intronic
985625067 5:981607-981629 CAGAGTGGGAAGAAGGCAGCTGG + Intergenic
985784425 5:1886584-1886606 GAGAGGAGGGAGAGGGCCGCGGG - Intronic
985980829 5:3461722-3461744 CAGAGGTGGCCAAAGACAGCTGG + Intergenic
986178584 5:5372867-5372889 CTGAGGAGGCAGAAGGCAGAAGG + Intergenic
986236412 5:5914635-5914657 CAGAGCAGGTAGAAGGCATCCGG - Intergenic
986361668 5:6984268-6984290 CAGAGGAAGCAGGAGGCATCTGG + Intergenic
986408689 5:7453526-7453548 CTTAGGAGGCAGAAGGCAGAAGG + Intronic
986856640 5:11876197-11876219 GAGAGGAGGGAGGAGGCAGGAGG + Intronic
986856647 5:11876218-11876240 GGGAGGAGGCGGGAGGCAGCAGG + Intronic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987488054 5:18544783-18544805 TCGAGGAGGCAGAAAGCAGAAGG - Intergenic
987740800 5:21906782-21906804 GAGTAAAGGCAGAAGGCAGCTGG - Intronic
988454316 5:31373641-31373663 AGGAGGAGGCAGGATGCAGCTGG - Intergenic
988525994 5:31987890-31987912 CAGACATGGCAGAAGGCAGTGGG - Intronic
989476721 5:41882866-41882888 CCGAGGAGGCATAAGGCAGAAGG + Intergenic
990154236 5:52856606-52856628 CAGAGGAGGTAGAAGGGTGGTGG - Intronic
990384497 5:55246393-55246415 CAGAGGAAGGAGAAGCCAACAGG + Intergenic
990510669 5:56486631-56486653 CAGAGGTGGTAGAAGCCAGAAGG + Intergenic
990723215 5:58722356-58722378 CAGAGAAGGCAGCAGGCATGGGG + Intronic
990943456 5:61227043-61227065 GAGAGGAGGCAGGAGAGAGCTGG - Intergenic
992307767 5:75461197-75461219 CACAGCAGGCAGTAAGCAGCAGG + Intronic
993090512 5:83420644-83420666 CAGAGGAAGCAGAGGGCTGTGGG + Intergenic
993501119 5:88667880-88667902 CGGAGGAGGTAAAAGGCCGCGGG - Intergenic
994300596 5:98142528-98142550 GAGAAGAGACTGAAGGCAGCAGG - Intergenic
995256796 5:110056176-110056198 CAGAGAAGGGAGAGAGCAGCTGG + Intergenic
996393313 5:122987105-122987127 CAGAGAATGCAGAAGCCACCTGG - Intronic
996404773 5:123094328-123094350 CAGAGGAGGCGCAGGGCAGAAGG - Intronic
996647228 5:125830653-125830675 CAGAGAAGCCAGAAGTCAGCAGG + Intergenic
996650314 5:125867928-125867950 CAGAAGAGACAGCAGGAAGCTGG + Intergenic
996706073 5:126499962-126499984 CAGAGGAGGCATAATGAGGCTGG + Intergenic
997472227 5:134123468-134123490 CAGAGGAGGGAGAGGCCAGTGGG + Intronic
997524245 5:134542153-134542175 CATAGGCAGCAGAAGACAGCAGG - Intronic
997606576 5:135179313-135179335 CAGAGGAGCCAGGAGGGGGCTGG + Intronic
997609644 5:135206657-135206679 CAGTGGAGGAAGAGAGCAGCAGG - Intronic
997736435 5:136215920-136215942 CAGAGCTGGCAGCAGGCATCAGG - Intronic
997801519 5:136867372-136867394 CGGAGGAGGCTGATGGCTGCTGG + Intergenic
997817951 5:137036039-137036061 CAGGGGAGGCAGGAGAGAGCTGG + Intronic
997887493 5:137643515-137643537 CAGAGGTAGCTCAAGGCAGCAGG + Intronic
998031812 5:138876930-138876952 AAAGGGAGACAGAAGGCAGCAGG + Intronic
998391039 5:141787175-141787197 GAGGGGAGGCAGATGGCAGGAGG - Intergenic
998509328 5:142698195-142698217 AATATGAGGCAGAAGGGAGCGGG + Intergenic
999328774 5:150659200-150659222 CACAGGAGGCAGAAGAATGCAGG - Intronic
999581093 5:153038962-153038984 AGGAGGAGGAAGAAGACAGCTGG + Intergenic
999658768 5:153836301-153836323 CACAAGAGACAGAAGGAAGCTGG - Intergenic
999694679 5:154178624-154178646 CACAGAGGGAAGAAGGCAGCTGG - Intronic
999696370 5:154191101-154191123 CTGAGGAGGCAGACAGCAGAAGG - Intronic
1000600905 5:163273581-163273603 CAGAGCAGCCCGAGGGCAGCTGG + Intergenic
1001315096 5:170636345-170636367 CAGTGGAGGCAGGAGGCAGAAGG + Intronic
1001315098 5:170636352-170636374 GGCAGGAGGCAGAAGGCAGAGGG + Intronic
1001532988 5:172477800-172477822 GAGAGGGAGCAGAAGGCAGCAGG - Intergenic
1001710218 5:173772417-173772439 CAGCCGGGGCAGAAGGCAGGAGG - Intergenic
1001837587 5:174845038-174845060 CAGAGAAGGCAGGAGGCTGACGG - Intergenic
1001840972 5:174876438-174876460 CAGAAGAGGAAGCAGGCAGGTGG + Intergenic
1002607379 5:180391206-180391228 CAGAGGATGCAGATGGCCACTGG - Intergenic
1003084300 6:3049260-3049282 CAAAGTAGGCAGAAGGGAGGGGG - Intergenic
1003163026 6:3652090-3652112 CAGGGGAGGGAGAATGCTGCTGG - Intergenic
1003244171 6:4370183-4370205 CAGAGCAGGCAGAGGGGAGATGG + Intergenic
1003577547 6:7312354-7312376 AAGAAGAGGAAGAAGGCAGAAGG + Intronic
1003916590 6:10792356-10792378 CAGAGGAGGCAGGCTGCTGCTGG - Intronic
1004314595 6:14574921-14574943 AGGAGCAGGCAGCAGGCAGCAGG - Intergenic
1004451829 6:15754643-15754665 CAGCAGAGGCAGAAAACAGCTGG - Intergenic
1004756738 6:18618380-18618402 CTGAGGCTGCACAAGGCAGCAGG + Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083659 6:21981720-21981742 CAGAGTAGGAAGGAGGCGGCAGG - Intergenic
1005997580 6:30940756-30940778 CAGAGGAACCAGAAAGGAGCAGG - Intergenic
1006113417 6:31762508-31762530 CAGAGGATGCTGGTGGCAGCAGG - Exonic
1006273147 6:32979884-32979906 CAGAGGAGGAGGAAGAGAGCAGG + Exonic
1006486538 6:34347487-34347509 CAGAGCAGGCAGAAATCAACAGG + Intronic
1006598212 6:35208951-35208973 CAGTGGAGAGAGAAGGGAGCAGG + Intergenic
1006848121 6:37077512-37077534 GGCAGGAGGCAGCAGGCAGCAGG + Intergenic
1006928276 6:37671515-37671537 CAGCCGAGGCAGAATGCTGCTGG + Intronic
1007257800 6:40540916-40540938 CAGAGGCTGCAGGAGGCTGCTGG + Intronic
1007704418 6:43782228-43782250 CAGAGAAGGCAGCAGTCACCAGG - Intronic
1007736045 6:43982887-43982909 AAGAGGAGGCACACGGAAGCCGG - Intergenic
1007749745 6:44064612-44064634 CAGAGAAGGCAGGAAGCAGAGGG + Intergenic
1007766648 6:44164613-44164635 CAGAGGAGGCAGCATCAAGCAGG + Intronic
1007942637 6:45797075-45797097 CAGAGGAGCCACAAGGGAGGGGG + Intergenic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1008882910 6:56399674-56399696 CTGAACAGGCTGAAGGCAGCTGG + Intergenic
1009870996 6:69451867-69451889 CAGAGGAGGAGGAAGGCCGGGGG - Intergenic
1010351751 6:74883188-74883210 CAGAGGAGGGACAAGGTAGGTGG - Intergenic
1010835610 6:80584390-80584412 AAGAGGAGGGAAAAGGGAGCAGG - Intergenic
1011610481 6:89146112-89146134 GAGAGGGCGCAGAGGGCAGCGGG + Exonic
1011750420 6:90449617-90449639 CAGAGTTGGCAGAAGACAGCAGG + Intergenic
1012103299 6:95119981-95120003 CAGAGGAGACAGAAGGCATATGG - Intergenic
1012497967 6:99855741-99855763 CAGTGGTAGCAGGAGGCAGCGGG - Intergenic
1013040348 6:106426726-106426748 AAGAGGAGGAAGAATGCACCAGG + Intergenic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013161010 6:107544862-107544884 CAGAGCAGGCAGAGGCCAGCAGG - Intronic
1013226839 6:108125290-108125312 CAGCAGAGGCAGAAGGCAGCAGG - Intronic
1013417060 6:109934478-109934500 CAGTGGATGCAGGAGGCACCCGG + Intergenic
1013869688 6:114742217-114742239 GAGAGGAGGCAGAACGCAGGTGG + Intergenic
1015894815 6:138007098-138007120 ACGAGGGGGCAGAAGGAAGCTGG - Intergenic
1016763527 6:147767257-147767279 CTGTGGAGGAAGAAGGAAGCAGG + Intergenic
1016813300 6:148281532-148281554 CACAGGAGGCTGAAGTCATCAGG - Intronic
1017702893 6:157093067-157093089 CAGCGAAGGGAGAAGGCAGCGGG - Intronic
1018210975 6:161481278-161481300 TACAGGGGGCAGAAGGCATCAGG + Intronic
1018246812 6:161831800-161831822 GAGAGGAGGCAGAAGGAAGAGGG + Intronic
1018857682 6:167687126-167687148 CAGGGCAGCCAGCAGGCAGCAGG - Intergenic
1019080603 6:169427029-169427051 CAGATGAGGAAGAAATCAGCAGG + Intergenic
1019318982 7:406343-406365 CAGAGGAGGGAAGAGCCAGCCGG + Intergenic
1019463398 7:1173215-1173237 CAGAGAGGGCAGAATGGAGCTGG + Intergenic
1019521359 7:1461832-1461854 CAGTGAGGCCAGAAGGCAGCGGG - Intergenic
1019785021 7:2971182-2971204 TTGAGGAGTCAGCAGGCAGCGGG + Intronic
1020385549 7:7597786-7597808 CCCAGGAGGCAGGAGGCAGTAGG - Intronic
1020466956 7:8491079-8491101 CTGATGAGGAAGAAGGCAACTGG - Intronic
1020649206 7:10854848-10854870 GAGAGGTGGCTGAAGACAGCTGG + Intergenic
1020727397 7:11832331-11832353 CAGAGGGGGCTGGAGGCAGAGGG + Intergenic
1021125880 7:16850971-16850993 CTGATGAGGCGGGAGGCAGCTGG + Intergenic
1021327393 7:19291315-19291337 GAAAGGAGGCAGAAGCCAGATGG + Intergenic
1022230799 7:28410260-28410282 CAGCGGAGGCAGGAGGCGGCCGG - Intronic
1023352762 7:39336584-39336606 CTGAGGAGGAAGGAAGCAGCAGG - Intronic
1023545406 7:41313091-41313113 CATAGCAGGCAGGAGACAGCAGG - Intergenic
1023842030 7:44103517-44103539 CAGAGGACCCAGAAGGCAGGTGG - Intergenic
1024061556 7:45702584-45702606 CCTAGGAGGCAGAAGCCACCAGG - Intronic
1024308755 7:47949927-47949949 CAGAGGTGGCAGCAGGCCCCAGG - Intronic
1024374124 7:48618574-48618596 GCCAGGAGGCAGAGGGCAGCTGG + Intronic
1025279803 7:57619067-57619089 CAGAGGAGACAGAGAGCAGGAGG - Intergenic
1025290209 7:57712651-57712673 CAGAGGGAGCAGAAGGCAATGGG + Intergenic
1025304929 7:57846434-57846456 CAGAGGAGACAGAGAGCAGGAGG + Intergenic
1025306979 7:57869121-57869143 CGGCGGGGGCAAAAGGCAGCGGG + Intergenic
1025713083 7:63929889-63929911 CAGGGGATGCAGAAGCCTGCAGG + Intergenic
1026403167 7:70036890-70036912 CAAAGGATGCAAAAGGCAACAGG + Intronic
1026960388 7:74404127-74404149 CAGTGGAGGCAGAGGGGATCCGG + Exonic
1026980534 7:74524039-74524061 CACAGGAGGCACAAGTGAGCAGG - Intronic
1029497372 7:100903291-100903313 CTCAGGAGGCTGAAGGCAGGAGG - Intergenic
1029551861 7:101240794-101240816 CAGAGGAGGGTGAAGGGAACGGG + Intronic
1029956193 7:104642772-104642794 CAGATCCGTCAGAAGGCAGCTGG + Intronic
1029978100 7:104852824-104852846 AGGAGGAGGCAGCAGGAAGCTGG - Intronic
1030134770 7:106236225-106236247 CCGAGGAGGCAGAAGGAACTGGG - Intergenic
1030152862 7:106424121-106424143 CAGGTGAGGAAGAAGGTAGCAGG - Intergenic
1030367217 7:108658956-108658978 CAGAGGAGGAAGATGTCATCCGG + Intergenic
1031873015 7:127108112-127108134 CAGAGAAGGCAAAGGGCAGGAGG - Intronic
1031977645 7:128104117-128104139 CACAGGGGGCAGGAGGCTGCGGG - Intergenic
1031989488 7:128188445-128188467 CAGGGGAGAGAGACGGCAGCAGG + Intergenic
1032394874 7:131582040-131582062 CAGAGGAGCCAGGAGGGAGGGGG - Intergenic
1032703998 7:134406390-134406412 ATCAGGAGGCAGGAGGCAGCTGG + Intergenic
1032998351 7:137474791-137474813 CAGAGGCGGCGGAAGGCTGATGG + Intronic
1033278802 7:139991454-139991476 CACAGCAGACAGCAGGCAGCAGG + Intronic
1033592850 7:142828148-142828170 AAGAGGAGGAAAAAGGTAGCTGG - Intergenic
1033707310 7:143902122-143902144 CCCAGGAGGCAAAGGGCAGCGGG + Exonic
1034491903 7:151397274-151397296 CTGTGGAGGCGGGAGGCAGCAGG - Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035214669 7:157356341-157356363 CAGAGCAGGCAACAAGCAGCAGG - Intronic
1035441314 7:158903540-158903562 CAGAGGTGGCAGAACTCAGCTGG + Intronic
1035770679 8:2144482-2144504 CAGAGCAGGCAGAGGACAGCAGG - Intronic
1036159065 8:6369711-6369733 CAGAGCAGCCAGAAGGGATCTGG - Intergenic
1036615875 8:10387097-10387119 CCGTGCAGGCAGCAGGCAGCAGG - Intronic
1036656739 8:10681813-10681835 CAGTGGAGGCACAGGGCAGCCGG + Intronic
1036699985 8:11006825-11006847 GAGAGGAGGCAGCTGGTAGCTGG - Intronic
1036967924 8:13320897-13320919 GAGAGGAAGCAAAAGACAGCTGG - Intronic
1036994021 8:13633302-13633324 CAAAGGAGAAGGAAGGCAGCCGG - Intergenic
1037752553 8:21692364-21692386 AGGAGGAGGGAGAAGACAGCAGG + Exonic
1037817254 8:22118781-22118803 CAGAGAAGGCAGAGGGGACCCGG - Intronic
1037880264 8:22570210-22570232 CAGAGGGGGAAGAAGGTGGCTGG + Intronic
1037992597 8:23331322-23331344 CAGAGGAGGGAGAAGGGCTCTGG - Intronic
1038022216 8:23560350-23560372 CAAGAGAGGCAGAAGGCAGGCGG - Intronic
1038686008 8:29719113-29719135 GAGGGGAAGCGGAAGGCAGCAGG - Intergenic
1038688976 8:29743845-29743867 CAGAGGAGGCAAGAGGCAAAAGG + Intergenic
1038697523 8:29819415-29819437 CAGAGGGGGCAGCAGGCTGATGG - Intergenic
1038758089 8:30360552-30360574 AAGAGTAGGCAGATGTCAGCTGG - Intergenic
1038869799 8:31481575-31481597 CGGAGGAGGCATGAGGCAGAAGG + Intergenic
1038922504 8:32100123-32100145 GAGAGGAGGCAGAGGGAAGGAGG - Intronic
1040627864 8:49172579-49172601 AAAAGGAAGCAGAAGGAAGCTGG - Intergenic
1040716269 8:50256920-50256942 CAGAGGTGGTAGCAGGCAGCTGG - Intronic
1041310717 8:56513730-56513752 GAGAGGAGGCAGGAGGCCACAGG - Intergenic
1041491471 8:58438024-58438046 CAGAGGCTGCACAGGGCAGCTGG - Intronic
1041609911 8:59833505-59833527 AGGAGGAGGCAGAGGGCAGTTGG + Intergenic
1041654438 8:60335062-60335084 CAGAGGATGCAGAGGGAAGGGGG + Intergenic
1042339524 8:67664510-67664532 CAGGTGTGGGAGAAGGCAGCAGG - Intronic
1042711681 8:71724242-71724264 CAGAGCAGGCAGTAGGGAACTGG - Intergenic
1044189454 8:89297611-89297633 CAGTGGTGGCAGAAGGCAAAGGG + Intergenic
1045182220 8:99796707-99796729 CTTAGGAGGCTGAAGTCAGCTGG + Intronic
1045383552 8:101649533-101649555 CAGAGGAGAGAGAACACAGCAGG - Intronic
1045736327 8:105299929-105299951 CACAGGAGACAGAGGGCATCTGG - Intronic
1045815207 8:106270463-106270485 CACAGGGGGCAGAGGCCAGCCGG - Intronic
1046614761 8:116463828-116463850 GACAGGAGGCAGAGAGCAGCTGG - Intergenic
1046624576 8:116563001-116563023 CAGAGGAGGCAGATGTGAGCAGG - Intergenic
1047196683 8:122728092-122728114 CAGAGGAGGCTGTAAGCAGCAGG - Intergenic
1047331678 8:123894781-123894803 GAAAGGAGTCAGAAGCCAGCTGG + Intronic
1047715696 8:127593107-127593129 CAGCAGAGGTAGAAGCCAGCAGG - Intergenic
1047808831 8:128385928-128385950 CAGAGGAGGGAGAAGCCATCTGG - Intergenic
1048028968 8:130613106-130613128 CAGAGGAGCCAAAAGCCATCAGG - Intergenic
1048045647 8:130770304-130770326 CTGGGGAGGGAGAAGGCAGGAGG + Intergenic
1048286397 8:133145173-133145195 CAGAGGAAGAGGAAGGCAGAAGG + Intergenic
1048317811 8:133375137-133375159 CAGAGGAGGCTGACTGCAGCGGG - Intergenic
1048319863 8:133390033-133390055 CACAGCAGGCAGCAGGCAGCAGG + Intergenic
1048672302 8:136736758-136736780 CAGGTGAGTCAGAAGGCAGAGGG + Intergenic
1049023194 8:139971404-139971426 CTGGGCAGGCAGAGGGCAGCTGG - Intronic
1049041589 8:140116047-140116069 CAGAGGGGGCAGCAGGCACCTGG + Intronic
1049239242 8:141528586-141528608 CAGAGGAGGGAGGAGGGAGCAGG + Intergenic
1049273226 8:141707188-141707210 GAGAGGAGGGAGAAGGCAAGTGG - Intergenic
1049286309 8:141777134-141777156 CTGATGAGGCAGTAGCCAGCAGG - Intergenic
1049367589 8:142248138-142248160 CTCAGGTGGCAGAAGGCAGAGGG - Intronic
1049392705 8:142380356-142380378 CAGAGCAGGGAGGACGCAGCTGG + Intronic
1049393278 8:142382888-142382910 GGGTGGAGGCAGCAGGCAGCAGG + Intronic
1049558380 8:143295195-143295217 CAAAGGAGGCTGGAGACAGCTGG - Intronic
1049566202 8:143340407-143340429 GGGAGAAGGCCGAAGGCAGCAGG - Intronic
1049620474 8:143596151-143596173 CAGAGGAGGCGGGAGGCAGCGGG + Intronic
1049682437 8:143925588-143925610 CAGAGGCGGCTGAGCGCAGCCGG - Exonic
1049795357 8:144494844-144494866 CAGAGGAGGCAGACCACACCTGG - Intronic
1052154899 9:25173534-25173556 CAGTGGAGGAAGAAAGCAGTGGG - Intergenic
1053110509 9:35455705-35455727 CAGAGAAGGTAGCAGGTAGCAGG + Intergenic
1053286201 9:36850964-36850986 CTGTGGGGGCAGAAGGCAGGTGG + Intronic
1053361896 9:37493979-37494001 CAGAGGAGGGAGAAGGCCTCAGG + Intronic
1053480877 9:38415396-38415418 GGGAGGAGACAGAAGGCAGGAGG + Intronic
1054166215 9:61732728-61732750 CAGAGGGAGCAGAAGGCAATGGG - Intergenic
1054447587 9:65385130-65385152 CAAAGGAGGCGGGAGGCAGAGGG + Intergenic
1054766176 9:69044456-69044478 AAGAGAAGGCAGAAGGCACAGGG - Intronic
1056196938 9:84238158-84238180 CTCAGGAGGCAGAAGACAGGAGG + Intergenic
1056241751 9:84654741-84654763 AAGAGGAAACAGAAGGCAGGAGG + Intergenic
1056526511 9:87447692-87447714 CAGGGCAGGCCGCAGGCAGCTGG - Intergenic
1056813655 9:89783605-89783627 GAGAGGAGGCTGGAGGCAGAAGG + Intergenic
1057448355 9:95134845-95134867 CAGGGGAGGGTGAAGGCAGGTGG + Intronic
1057834156 9:98430707-98430729 CAAAGGAGGCAGAAGTTTGCAGG - Intronic
1058472947 9:105299746-105299768 CAGCAGACACAGAAGGCAGCAGG - Intronic
1058679770 9:107430746-107430768 CAGAGGAGTGAGAAGGCCACAGG + Intergenic
1059300354 9:113307642-113307664 AAGAGGTGGCAGAGGGCAGAAGG + Intergenic
1059488282 9:114644421-114644443 TAAAGGAGGCAGAGAGCAGCAGG - Intronic
1059528668 9:115016151-115016173 CAGGAGAGGCAGAAGGCAAAAGG - Intergenic
1059695958 9:116730716-116730738 CAGAAGAGGCAGAATGATGCAGG + Intronic
1059901439 9:118930739-118930761 CCTAGGAGGCAGAAGGCAGAAGG - Intergenic
1060172294 9:121471788-121471810 CAGAAAAGGCAGATGGCTGCAGG + Intergenic
1060477838 9:123999328-123999350 GAGGGGAGGTAGAAGGAAGCCGG + Intergenic
1060554235 9:124500163-124500185 CACAGGAGGCCGAAGGCCGCCGG + Exonic
1060586079 9:124786886-124786908 GAGAGATGGCAGAAGCCAGCTGG - Intronic
1060921313 9:127422494-127422516 CTGAGGTGGCAGAAGGAAGATGG - Intergenic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061054573 9:128215575-128215597 CTGGGGAGGCAGCAGGCAGCTGG + Intronic
1061215350 9:129218524-129218546 CAGGGGAGGCTGAAAGCAGGAGG - Intergenic
1061256210 9:129455190-129455212 CAGCTGGGGCCGAAGGCAGCAGG - Intergenic
1061281692 9:129601367-129601389 GAGAGGAGGGAGGAGGCAGAGGG + Intergenic
1061868757 9:133509038-133509060 CAGAAGAGGCAGGAAGCAGATGG - Intergenic
1061950135 9:133931499-133931521 CAGAGGACAGGGAAGGCAGCTGG - Intronic
1062114352 9:134799937-134799959 CCGGGGTGGCAGAAGGCAGCCGG - Intronic
1062126149 9:134864122-134864144 CAGGGGAGGGAGAGGGAAGCAGG - Intergenic
1062137799 9:134938877-134938899 CAGACGAGGCAGCAGGCTCCTGG - Intergenic
1062140533 9:134955424-134955446 CAGAGCAGAGGGAAGGCAGCTGG + Intergenic
1062192823 9:135256479-135256501 GAGAGGAGGCAGAGGGCAGGAGG - Intergenic
1062480592 9:136749111-136749133 GAGGGGAGGCAGGAGGCAGCAGG - Intergenic
1062629587 9:137457875-137457897 CAGAGTAGGCATCAGCCAGCAGG + Exonic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1185484719 X:473668-473690 GAGAGGAGGTTGATGGCAGCCGG - Intergenic
1185489013 X:506474-506496 AAAAGCAGGCAGAACGCAGCAGG + Intergenic
1186374212 X:8981017-8981039 AAGAAGTTGCAGAAGGCAGCAGG - Intergenic
1187372039 X:18717517-18717539 AAGAGGAGGTAGGAGACAGCGGG - Intronic
1189307870 X:40000712-40000734 ATGAGAAGGCAGAAGGGAGCTGG + Intergenic
1190062835 X:47222032-47222054 AAGAGGAAGCAGAAGACGGCTGG + Intronic
1190526020 X:51330804-51330826 CAATGGTGGCAGAAGGCAGAGGG + Intergenic
1190795523 X:53737642-53737664 GAGAGGATGCAGGAGGCAGATGG - Intergenic
1191017132 X:55820741-55820763 CAGAGCAGGAAGAAGAGAGCAGG + Intergenic
1192243904 X:69357860-69357882 AAGAGGAGGAAGGAGGCAGTGGG - Intergenic
1193608193 X:83594146-83594168 TAGAAGAGCCAGAAGGCAGATGG - Intergenic
1195045305 X:101050036-101050058 CAGAGGAGGGACAAGGAAGCTGG + Intronic
1195540060 X:106053296-106053318 CAGAGGCTGCAGAAGGAAGGGGG + Intergenic
1195666634 X:107437342-107437364 CAGAGAAAGCACAAGGCAGGAGG - Intergenic
1196791443 X:119468488-119468510 AAGAGGAGGCAGACTGCTGCAGG - Exonic
1197147781 X:123188168-123188190 CAGAGAAAGCAACAGGCAGCTGG - Intronic
1197398427 X:125957709-125957731 CAGAGTAGGCAGAAGCCATTTGG + Intergenic
1197761099 X:130028910-130028932 CAGAGGAGGCAGGAGGGGGGTGG + Intronic
1198435083 X:136609340-136609362 TAGACGAGGCAGAAGGCAGAAGG + Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1199092568 X:143708872-143708894 CAGAGGCTGCAGAGAGCAGCGGG + Intergenic
1199405373 X:147452268-147452290 CAAAGCAGGAAGAAGGCAGCCGG + Intergenic
1199600256 X:149537434-149537456 GAGAGGAGTGAGAAGGCAGCAGG + Intergenic
1199650328 X:149942506-149942528 GAGAGGAGTGAGAAGGCAGCAGG - Intergenic
1200164257 X:154025337-154025359 GTCAGGAGGCAGAAGGAAGCAGG - Intronic
1201583826 Y:15538583-15538605 CAGAGAAGGCTAGAGGCAGCAGG - Intergenic
1201679584 Y:16629184-16629206 CAGAGGAACCAGAAGACAGGAGG + Intergenic
1201886630 Y:18890994-18891016 CAGAGGGAGCAGAAGGCCACTGG + Intergenic