ID: 1089744210

View in Genome Browser
Species Human (GRCh38)
Location 11:120605732-120605754
Sequence GCCACGCTGGGCACAGAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089744202_1089744210 -9 Left 1089744202 11:120605718-120605740 CCCCCTGCCCTTCAGCCACGCTG 0: 1
1: 0
2: 5
3: 35
4: 397
Right 1089744210 11:120605732-120605754 GCCACGCTGGGCACAGAGCGTGG 0: 1
1: 0
2: 0
3: 18
4: 237
1089744203_1089744210 -10 Left 1089744203 11:120605719-120605741 CCCCTGCCCTTCAGCCACGCTGG 0: 1
1: 1
2: 4
3: 86
4: 1025
Right 1089744210 11:120605732-120605754 GCCACGCTGGGCACAGAGCGTGG 0: 1
1: 0
2: 0
3: 18
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089744210 Original CRISPR GCCACGCTGGGCACAGAGCG TGG Intronic
900150702 1:1178136-1178158 TCCAGGCTGGGCACAGAGCTCGG - Intronic
900604123 1:3516263-3516285 GCCAGGCTGGGCACCCAGGGTGG + Intronic
900621292 1:3588660-3588682 GGCAGGCTGGGCACAGAGAAGGG + Intronic
900933335 1:5750446-5750468 GGCCCTCTAGGCACAGAGCGGGG - Intergenic
901669441 1:10847047-10847069 TCCACTCTGGCCACAGAGAGAGG + Intergenic
902078757 1:13806733-13806755 GCTGTGCTGGGCACAGACCGTGG - Intronic
902281801 1:15380143-15380165 GCCATGCTGGGCACAAGGAGGGG + Intronic
903540532 1:24093832-24093854 GCCTCCCTGGGCTCAGAGCTGGG + Intronic
904571733 1:31471121-31471143 GCAACTCTGTGCACAGACCGAGG - Intergenic
904812227 1:33170897-33170919 GCCTCACAGGGCACAGAGCCTGG + Intronic
905242105 1:36588126-36588148 GCCACGCCTGGCACAGGGTGAGG + Intergenic
905748838 1:40443332-40443354 GCTAGGCTGGGCACAGTGAGTGG - Intergenic
909204618 1:72739550-72739572 GCCTCCCTGGCCACAGAGCAAGG - Intergenic
911174771 1:94807754-94807776 TCCAACCTGGGGACAGAGCGAGG + Intergenic
911188788 1:94927510-94927532 GGCGCGCTGGGCCCAGAGCCCGG - Intergenic
912496658 1:110096164-110096186 CCCACCCTTGGCACAGAGCAGGG + Intergenic
912775573 1:112504520-112504542 GCCAGGCTGTGTACAAAGCGTGG + Intronic
915333893 1:155129608-155129630 GCCAAGCTGGGCCCAGCGTGGGG + Intronic
916061068 1:161098857-161098879 ACCGCACTGGACACAGAGCGCGG + Exonic
916276583 1:163000904-163000926 GCCTCCCAGGGCACAGAGCAAGG - Intergenic
918495451 1:185130822-185130844 GCCACACTGGGGACAGAGACTGG - Intronic
921245270 1:213232171-213232193 ACCATGTTGGGCACACAGCGGGG - Exonic
922467315 1:225853192-225853214 GCCATGGTGGGCACTGTGCGAGG - Intronic
922648603 1:227318077-227318099 GCCGCGCCGGGCAGAGAGCCCGG + Exonic
923572107 1:235125778-235125800 TCCAGCCTGGGGACAGAGCGGGG - Intronic
1063007503 10:1987574-1987596 GCCATGCGGCACACAGAGCGAGG + Intergenic
1067295818 10:44974734-44974756 GTGACGCTGGCCCCAGAGCGTGG - Intronic
1070698034 10:78577542-78577564 GCCTCCCTGGGCACTGAGGGTGG + Intergenic
1075681641 10:124337673-124337695 GCCAGGCAGGGCAGAAAGCGTGG - Intergenic
1077921008 11:6641655-6641677 GTCAAGCTGGGCCCAGAGCCTGG - Exonic
1078399447 11:11011096-11011118 TCCAGGCTGGGCACAGAGTCTGG - Intergenic
1079693988 11:23455799-23455821 GCCACACTGAGCAAAGAGAGTGG + Intergenic
1081211215 11:40336740-40336762 GCCAAGATGGGCAGATAGCGAGG + Intronic
1081585324 11:44380160-44380182 GCCACCCAGGGCACAGATCAGGG + Intergenic
1083336405 11:61924191-61924213 AGCATGCTGGGTACAGAGCGGGG + Intergenic
1084396362 11:68913378-68913400 GCGATGCTGGGCATAGAGAGTGG + Intronic
1084479412 11:69410038-69410060 GCCAGGCAGGGGACAGAGCTGGG - Intergenic
1084799152 11:71530443-71530465 GCCACGCAGAGCACAGAATGGGG + Intronic
1084809421 11:71603369-71603391 GCCACGAGGGGCACCGGGCGTGG - Intergenic
1084971811 11:72776205-72776227 GCCCTGCTGGACACAGAGTGAGG - Intronic
1085716993 11:78881283-78881305 GCCTCCCAGGGCACAGAGCAGGG - Intronic
1085996748 11:81926308-81926330 GCCATGCTGGACACAGGGAGGGG + Intergenic
1086208940 11:84294769-84294791 GCCACACTGGGCTCTGAGCTTGG + Intronic
1087162235 11:94959963-94959985 ACCAAGCTGGGCACACAGCAAGG - Intergenic
1089174598 11:116539403-116539425 GCCACTCGGGGCTCAGAGCCAGG - Intergenic
1089744210 11:120605732-120605754 GCCACGCTGGGCACAGAGCGTGG + Intronic
1090387658 11:126366025-126366047 GCCTGGCTGGGCAGAGGGCGAGG + Intronic
1090390223 11:126383223-126383245 GCCTGGCTGGGCAGAGGGCGAGG + Intronic
1093716559 12:22389827-22389849 TCCAGCCTGGGCACAGAGCGAGG + Intronic
1094807850 12:34108617-34108639 ACCTCGCTGTGCACAGAGCAGGG - Intergenic
1096732499 12:53625921-53625943 GCCCCGGGGGGCACAGGGCGTGG - Intronic
1101348001 12:103904159-103904181 GCCACACTGGGAACTGAGCAGGG - Intergenic
1101721363 12:107353235-107353257 ACCATGCTGGGCTCAGAGCCAGG - Intronic
1101882012 12:108632101-108632123 GCTAGGCTGGGCCCAGAGTGGGG - Intronic
1101961774 12:109256198-109256220 GGCACCCTGGGCGCAGACCGTGG + Exonic
1102519344 12:113469058-113469080 GCCAGGCTGGGCACGGTGGGAGG + Intronic
1102688868 12:114744868-114744890 GGCAGGCTGGGCGCAGAGCCGGG - Intergenic
1102864298 12:116361706-116361728 CCCACCCTGGGCACACAGCATGG - Intergenic
1104062319 12:125279040-125279062 GCCATGCTGGGTACAGACAGGGG + Intronic
1104874749 12:132026222-132026244 GCCAAGGCAGGCACAGAGCGGGG - Intronic
1104989704 12:132618745-132618767 GCCCCGCTGCGCACCGAGAGCGG - Intergenic
1106308328 13:28532618-28532640 CCCGCGCAGGGCACAGATCGGGG - Intergenic
1112357439 13:98685751-98685773 GCCAAGGTGGGCAGATAGCGAGG + Intronic
1112576643 13:100642224-100642246 GCCATGCTGTGCAAAGAGCAAGG - Exonic
1118773875 14:68961539-68961561 GCCACACGGGGCACAGGGCGCGG + Intronic
1118849120 14:69571401-69571423 ACCGCGCTGCGCACCGAGCGGGG + Exonic
1119543414 14:75455467-75455489 GCCACCTGGGGCACAGAGCAGGG - Intronic
1119703924 14:76772525-76772547 CCCAGGCTGGGGACAGAGGGAGG + Intronic
1121009463 14:90511541-90511563 GCCAGGCTGGGCAGAGATCAGGG + Intergenic
1121690931 14:95876718-95876740 GCCCCGCTGGGCGCGCAGCGCGG + Intergenic
1122127014 14:99584755-99584777 GCCCCACTGCCCACAGAGCGGGG + Intronic
1122652492 14:103233063-103233085 GGCAGGCTGGGCACAGGGCCAGG - Intergenic
1122693645 14:103542781-103542803 CCCAGGCGGGGCACAGAGCGGGG - Intergenic
1122789955 14:104179952-104179974 GCCACGCGGTGGACAGAGCGAGG + Intronic
1122843760 14:104479439-104479461 CTCACGCTGGGCACCGAGGGAGG - Intronic
1122891293 14:104733422-104733444 GCAACCCTGGGGACAGAGGGGGG - Intronic
1123099229 14:105784468-105784490 GCCACCTTGGGCCCAGAGTGTGG - Intergenic
1125401641 15:39310701-39310723 GCCAGTCTGTGCACAGAGCATGG - Intergenic
1128977962 15:72167165-72167187 GCCATGCTGGGCTCACAGCTGGG - Intronic
1132686534 16:1164592-1164614 GCCACGCTCGGCACCGCCCGGGG - Intronic
1132704591 16:1237590-1237612 GCCAGGCTGGCCACGGAGCGTGG - Intergenic
1132706922 16:1248835-1248857 GCCAGGCTGGCCACGGAGCGTGG + Intergenic
1133247284 16:4457469-4457491 GCCACGCCAGGCATAGAGCGTGG - Intergenic
1135539487 16:23319069-23319091 TCCAGCCTGGGCACAGAGTGAGG - Intronic
1135956571 16:26961038-26961060 ACCATGCCTGGCACAGAGCGGGG - Intergenic
1136500307 16:30666828-30666850 GCGAGGCTGGGCCCAGAGCCAGG + Intronic
1137272593 16:46912118-46912140 GCCACCCTGGTCACAGTGTGTGG - Intronic
1138094189 16:54199446-54199468 GCCAGGCTGGGCACGGGGCCTGG + Intergenic
1138196908 16:55058729-55058751 GCCTCCCTGGGCACAGAGCAAGG - Intergenic
1138537524 16:57667831-57667853 AACAAGCTGGGCACAGAGCCTGG - Intergenic
1139509011 16:67415954-67415976 CCCACGCCTGGCACAGAGCCTGG + Intronic
1142136427 16:88453805-88453827 GGCGCGCTTGGCACAGCGCGGGG - Intronic
1142206609 16:88785763-88785785 GCCACGCCGGCCACCGCGCGCGG + Intergenic
1142974637 17:3636270-3636292 GCCCCCCTGGGCGAAGAGCGCGG - Exonic
1147258613 17:39196347-39196369 GCCAGGCTGGGCAAAGGGAGTGG + Intronic
1147327315 17:39675640-39675662 GCCAGGCAGGGGACAGAGGGAGG + Intronic
1147647536 17:42042871-42042893 GCACTGCTGGGCACAGAGCATGG - Intronic
1148821680 17:50363680-50363702 GCCAGGCAGGACACAGAGTGGGG + Intergenic
1149144913 17:53478792-53478814 GCCACTCAGGGCACAGAGCAGGG + Intergenic
1150011225 17:61506042-61506064 GCCACGCTGGCCTCAGGGAGGGG - Intergenic
1150317471 17:64181443-64181465 TCCACCCTGGCCACAGAGCAAGG + Intronic
1152085359 17:78214528-78214550 GCCTCGCTGGGGACAGGACGGGG - Intronic
1152139870 17:78529995-78530017 GCCATGATGGGCACAGTGCCAGG - Intronic
1152458787 17:80430720-80430742 CCCCCGCCGGGCACAGAGCCTGG - Intronic
1152539504 17:80967833-80967855 GCCCCGCTGCGCACACAGAGGGG + Intergenic
1152631770 17:81413723-81413745 TCCAGGCTGGGCTCAGGGCGCGG + Intronic
1154220750 18:12451622-12451644 GCCTCGCTGTCCACAGAGCCAGG + Intronic
1156898669 18:42275315-42275337 GCCAGGCTGGGCACAGCAGGAGG + Intergenic
1159543039 18:69803826-69803848 TCCAGCCTGGGCACAGAGCAAGG + Intronic
1160005273 18:75064331-75064353 GCCACGCTAGGCACAGAGGCCGG + Exonic
1160130619 18:76222012-76222034 TCCACTCTGCCCACAGAGCGAGG + Intergenic
1160378191 18:78429727-78429749 GGGCCGCTGAGCACAGAGCGTGG + Intergenic
1160730176 19:638535-638557 AGCACGCTGGGCAGAGGGCGCGG - Intergenic
1160959500 19:1713045-1713067 GCCTCCCTGGGCACAGAGCAGGG + Intergenic
1161133837 19:2608140-2608162 GCCACTCATGACACAGAGCGTGG + Intronic
1161200955 19:3014521-3014543 CCGACTCTGGGCACAGAGCAAGG - Intronic
1161869157 19:6857140-6857162 CCCACGCCGGGCTCAGAGCCTGG - Intronic
1162821992 19:13228842-13228864 GGCTCCCTGGGCACACAGCGAGG + Intronic
1163462621 19:17448175-17448197 GCCCAGGTGGCCACAGAGCGCGG + Exonic
1168160630 19:54508271-54508293 GCAACGGTGGCCACAGAGAGAGG - Intronic
1168230540 19:55027825-55027847 GCCGGGCTGGGCTGAGAGCGAGG + Exonic
926147349 2:10404810-10404832 GCCCAGCTGGGCAGAGAGCCTGG - Intronic
926229664 2:10992879-10992901 GCCAAGCAGGGCACAGGGGGTGG + Intergenic
926541184 2:14182889-14182911 GACAGGCTGGGCACAGGGCCCGG + Intergenic
926690571 2:15730638-15730660 TGCAGGCTGGGCACAGAGCCAGG + Intronic
926892479 2:17650166-17650188 GGCATGCTGGGCAGAGAGAGAGG - Intronic
927504254 2:23603025-23603047 ATCAGGCTGGGCACAGAGGGTGG - Intronic
932435163 2:71699074-71699096 CCCAGGCTGGGCACACAGCGGGG + Intergenic
932573172 2:72948876-72948898 CCCAGGCTGGGCACACAGAGGGG + Intronic
933969961 2:87462353-87462375 GGCATGCTGGGCACAGTGCATGG - Intergenic
934646747 2:96063405-96063427 GGCATGCAGGGCACAGAGCTGGG - Intergenic
934840150 2:97619487-97619509 GGCATGCAGGGCACAGAGCTGGG - Intergenic
936323820 2:111488143-111488165 GGCATGCTGGGCACAGTGCATGG + Intergenic
937980157 2:127609960-127609982 GACACGCTGGGCAGGGAGCACGG + Exonic
938073911 2:128322164-128322186 CCCACGCGGGGCAGAGAGAGGGG + Intergenic
947711186 2:232317049-232317071 GCCTCCCAGGGCACACAGCGAGG - Intronic
948438141 2:237967448-237967470 GCCACGCTCGGCCCAGGGCCTGG - Intronic
948519430 2:238526226-238526248 TCCACGCGGGGGACTGAGCGTGG - Intergenic
948568198 2:238899611-238899633 GCCGGGATGGGCACAGAGAGGGG - Intronic
948601746 2:239111463-239111485 GCCACAGTGGGCACAGCGCGGGG - Intronic
948777602 2:240297741-240297763 CCCAGGCTGGGCACAGAGAAGGG - Intergenic
1168798832 20:630818-630840 GCCATGCTGAGCCCAGAGCCTGG + Intergenic
1169190996 20:3659335-3659357 GCCAGGCAGGGCACAGGGTGGGG + Intronic
1169351963 20:4875510-4875532 GCCACCCTGGTCACAGGGCAAGG + Intronic
1169664550 20:8019609-8019631 GCCATGTTGGGCGCCGAGCGAGG + Exonic
1169914658 20:10673453-10673475 GGCTCGCAGGGCACAGAGCAGGG + Exonic
1172097854 20:32469090-32469112 GTCAGGCTGGGCACACAGCAGGG + Intronic
1172354312 20:34269030-34269052 GCCACGCAGGGCGCAGATAGGGG - Exonic
1173248222 20:41350434-41350456 CCCACCCAGGGGACAGAGCGAGG - Intronic
1176030028 20:63007302-63007324 GACACGCAGGGGCCAGAGCGGGG + Intergenic
1176150074 20:63586185-63586207 GGCACGATGGGGACAGAGCATGG + Intergenic
1180194606 21:46185076-46185098 GCCCCGTCGGGCTCAGAGCGGGG - Intergenic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1181166489 22:20986104-20986126 GCCAAGCTGGGCACACAGGGCGG + Intronic
1181438430 22:22923440-22923462 GCTGAGCTGGGCACAGAGGGAGG - Intergenic
1181462552 22:23094257-23094279 GCCACCCTGGGCTCACAGCCGGG + Intronic
1182120821 22:27785586-27785608 GCCGTGATGGGCACCGAGCGTGG + Intronic
1182226063 22:28800094-28800116 GCCACGCTGGGAACCTAGGGCGG - Intronic
1182356231 22:29723380-29723402 GCCATGGTGGGCACACAGAGGGG - Intronic
1183537621 22:38412529-38412551 GCCACGCTGGGAGCAGCGCAGGG + Intergenic
1183640219 22:39088183-39088205 TCCAGGCTGGGCCCAGAGAGAGG + Intergenic
1183746015 22:39692039-39692061 GCCACGCTGGGCAGTGGGTGAGG - Intergenic
1184223998 22:43118669-43118691 GCCACGCTGGGGTCACAGGGAGG - Intronic
1184296559 22:43528826-43528848 GTCCCGCTGGGCACACAGCAGGG + Exonic
1184403424 22:44286753-44286775 TCCACTCTGGGCACAGGTCGGGG - Intronic
1184890324 22:47375238-47375260 GCCACTCTGGCCCCAGGGCGAGG - Intergenic
1185050826 22:48553220-48553242 GGCAGGAGGGGCACAGAGCGGGG - Intronic
1185343829 22:50302849-50302871 GCAAGGCTGGGCACAGGGCCTGG + Intronic
950053846 3:10010603-10010625 GACACGCTGGCCACTGAGTGGGG - Intronic
950144565 3:10639910-10639932 GCATCCCTGGGCACAGAGCAAGG + Intronic
953606307 3:44415351-44415373 TCCAGGGTGGGCACAGAGGGGGG + Intergenic
953922247 3:46960219-46960241 GCCTCTCTGTGCACAGAGCCTGG - Intronic
955391278 3:58524259-58524281 GCCACCATGGGCAGAGAGAGGGG - Intronic
957079428 3:75623719-75623741 GCCACCAGGGGCACAGGGCGTGG + Intergenic
960304953 3:116050010-116050032 GCCTCCCAGGGCACAGAGCAGGG - Intronic
960974756 3:123163096-123163118 GCACCGCTGGGCACAGGGCTGGG - Intronic
961625299 3:128258199-128258221 GCCAGCCTGGGCACAAAGAGGGG - Intronic
961670305 3:128523867-128523889 GCCACGCTGGCCACAGACTCTGG + Intergenic
967337720 3:188362813-188362835 GACATGCTGGCCACAGAACGTGG - Intronic
968662338 4:1803963-1803985 CCCACACTGGGCACAGGGCCAGG - Intronic
968732613 4:2276792-2276814 GCCAGGGTGGGCAGAGGGCGGGG + Intronic
968962340 4:3751975-3751997 GCCACTCTGGACACAGAGGTGGG + Intergenic
969022510 4:4147664-4147686 GCCACGAGGGGCACTGGGCGTGG + Intergenic
975671342 4:76784111-76784133 GCCTGGCTGTGCACAGAGTGGGG + Intergenic
977518811 4:98055827-98055849 GCCAGGCTGGGCCCTGAGAGAGG - Intronic
977536502 4:98261183-98261205 GCCTCGCTCGCCACAGAGGGAGG + Intergenic
983569281 4:169186981-169187003 TCCAGCCTGGGGACAGAGCGAGG + Intronic
986270690 5:6228213-6228235 ACCTCTCTGGGCACAGAGCTGGG - Intergenic
986708709 5:10471874-10471896 GCTATGCTGGGCTCAGAGCATGG + Intronic
991578976 5:68134536-68134558 GCCAGGCTTGGCACTGAGCCGGG + Intergenic
992403459 5:76432843-76432865 GCCTCCCAGGGCACAGAGCATGG - Intronic
995047798 5:107670645-107670667 GCCACTCCGGGGAGAGAGCGGGG + Exonic
997421902 5:133776147-133776169 GCCACCCAGAGCACAGAGCAGGG - Intergenic
997564453 5:134876208-134876230 GCCACACAGGGCACAGAGCACGG - Intronic
997791523 5:136766611-136766633 GCCAGGCTGGGCACTGAGGAGGG - Intergenic
998450593 5:142231679-142231701 GCCTCTCTGGTCACAGAGCAGGG - Intergenic
999321617 5:150618734-150618756 GCCACTCTGGGCCCAGGGCCAGG - Exonic
1001402418 5:171453431-171453453 GCCACCATTGGCACAAAGCGAGG - Intronic
1002197826 5:177510665-177510687 GCCACAGTGGGCACAGAGCTGGG - Intronic
1002424429 5:179166973-179166995 GCCAGGCTGGGCAGGGAGGGAGG + Intronic
1002682358 5:180976745-180976767 GACACCTTGGGCACAGAGGGAGG - Intergenic
1005925748 6:30444179-30444201 GCCAGGCGGGGAGCAGAGCGCGG - Intergenic
1006068199 6:31477712-31477734 GCTTTACTGGGCACAGAGCGAGG + Intergenic
1006911050 6:37563920-37563942 GCCATGCTGGTCACAGAGGTCGG - Intergenic
1006944976 6:37778973-37778995 GCCATGCTGGGCACATAAGGAGG - Intergenic
1013131899 6:107241375-107241397 TCCAGCCTGGGGACAGAGCGAGG - Intronic
1014323880 6:119966891-119966913 GCCACCCTGGTGACAGAGTGAGG - Intergenic
1016815479 6:148299122-148299144 ACCATGCTGGGCATAGAGTGAGG - Intronic
1018762493 6:166904161-166904183 CCCACCCTGTGCACAGAGCCGGG - Intronic
1018954001 6:168395845-168395867 GCCATGCTGAGCCCAGAGCCAGG - Intergenic
1019093314 6:169558385-169558407 GCCAGGCTGGAAACAGAGCCAGG + Intronic
1019170274 6:170129815-170129837 TGCACGGTGTGCACAGAGCGTGG - Intergenic
1019595439 7:1856325-1856347 GACAGGCTGAGCCCAGAGCGTGG - Intronic
1020015675 7:4830026-4830048 GCCACGCTAGGCAGTGAGGGAGG - Intronic
1022746810 7:33180907-33180929 GTAACTCTGTGCACAGAGCGAGG + Intronic
1023434210 7:40125524-40125546 TCCACCCTGGGGACAGAGCAAGG - Intergenic
1024042185 7:45564308-45564330 ACCACGCTGGGCACAGGTCCAGG + Intergenic
1025249073 7:57339709-57339731 GTCAGGCCGGGCACAGAGCCTGG - Intergenic
1032388774 7:131542248-131542270 GCCAGACTGGGCAGAGAGAGAGG - Intronic
1033047859 7:137978802-137978824 GCAGCACTGGGCACAGAGTGCGG + Intronic
1033595839 7:142857079-142857101 GCCACTCTGTGCACTGACCGGGG - Intronic
1039475532 8:37837601-37837623 GCCAGGCAGGGCACAGTGCTGGG - Intronic
1041107874 8:54459243-54459265 GCCGCGCTGGGCCCCGAGGGCGG + Exonic
1042258605 8:66833027-66833049 TCCAGGCTGGGAACAGAGTGAGG - Intronic
1046616402 8:116482249-116482271 GCCTCCCAGGGCACAGAGCAGGG + Intergenic
1048892509 8:138960446-138960468 GCCAGGCTGGGCTGAGAGCAGGG + Intergenic
1049178220 8:141206807-141206829 GCCACGCTGGGCTGAGGACGGGG - Intergenic
1049409940 8:142468490-142468512 GGCCTTCTGGGCACAGAGCGTGG - Intronic
1049779678 8:144423221-144423243 GCCAGGCTGGGCTCAGAGGCGGG - Intergenic
1052865569 9:33462870-33462892 ACCAAGCTGGGTACAGAGTGGGG + Intronic
1053157726 9:35792108-35792130 GCCAGGATGGGGACAGTGCGAGG - Intergenic
1053303663 9:36969215-36969237 GCCCTGCTGGGGACAGAGCCAGG - Intronic
1054870218 9:70042460-70042482 ACCACCATGGGCACAGAGCATGG + Intergenic
1058920232 9:109607150-109607172 TCCAGCCTGGCCACAGAGCGAGG + Intergenic
1060549144 9:124476982-124477004 GCCCCCCTGGGCAGAGAGAGGGG - Intronic
1060595250 9:124843817-124843839 CCCACGCTGGGGACAGTGGGTGG + Intergenic
1061054404 9:128214794-128214816 CCCACGCTGGGCACAGCACGCGG + Intronic
1061884872 9:133586382-133586404 GCCGGGCTTGGCACAGAGTGGGG + Intergenic
1062024994 9:134336128-134336150 GTCACTCTGGGCACAGACAGTGG + Intronic
1062025583 9:134338762-134338784 GCAAGGCTGGGCACAGTGCAGGG - Intronic
1062469297 9:136695549-136695571 GCCTGGCTGGGCACAGTGCCCGG + Intergenic
1062608205 9:137358234-137358256 GCCACGCCGTGCACACAGGGAGG - Intronic
1062665274 9:137667452-137667474 GCCACCCTCTCCACAGAGCGGGG - Intronic
1062694278 9:137865205-137865227 ACCACTCTGGACACAGAGAGGGG + Intronic
1062707457 9:137953361-137953383 GCCAGGCTGGGGATAGAGCCTGG + Intronic
1185468385 X:368653-368675 CCCACCCTGGGCACCGACCGGGG + Intronic
1189232386 X:39462633-39462655 GCCAGACTGTGCACACAGCGTGG + Intergenic
1189853853 X:45202651-45202673 GCCATGATGGTCACAGAGAGTGG - Intergenic
1190339518 X:49285952-49285974 GCCACCCAGGCCACAGAGAGGGG - Exonic
1200085004 X:153599540-153599562 GCCACGCTGGGCCGACAGCCCGG - Intronic
1200954713 Y:8931386-8931408 GCCAGCCAGGGCACAGAGTGTGG - Intergenic
1202107091 Y:21383486-21383508 GACAGCCAGGGCACAGAGCGTGG + Exonic
1202163502 Y:21960715-21960737 GTCAAGCTGGGCACAGAAGGCGG + Intergenic
1202227854 Y:22625653-22625675 GTCAAGCTGGGCACAGAAGGTGG - Intergenic
1202315303 Y:23570523-23570545 GTCAAGCTGGGCACAGAAGGCGG + Intergenic
1202555498 Y:26100070-26100092 GTCAAGCTGGGCACAGAAGGTGG - Intergenic