ID: 1089745565

View in Genome Browser
Species Human (GRCh38)
Location 11:120614461-120614483
Sequence GAGACAGAGGTGCCTGCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 275}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089745563_1089745565 -6 Left 1089745563 11:120614444-120614466 CCAGAAAGTTCTTGGATGAGACA 0: 1
1: 0
2: 1
3: 12
4: 161
Right 1089745565 11:120614461-120614483 GAGACAGAGGTGCCTGCATCTGG 0: 1
1: 0
2: 0
3: 32
4: 275
1089745559_1089745565 26 Left 1089745559 11:120614412-120614434 CCCATGTGCATGGGCTGCATGAG 0: 1
1: 0
2: 0
3: 12
4: 200
Right 1089745565 11:120614461-120614483 GAGACAGAGGTGCCTGCATCTGG 0: 1
1: 0
2: 0
3: 32
4: 275
1089745562_1089745565 1 Left 1089745562 11:120614437-120614459 CCAGAGACCAGAAAGTTCTTGGA 0: 1
1: 0
2: 0
3: 23
4: 201
Right 1089745565 11:120614461-120614483 GAGACAGAGGTGCCTGCATCTGG 0: 1
1: 0
2: 0
3: 32
4: 275
1089745560_1089745565 25 Left 1089745560 11:120614413-120614435 CCATGTGCATGGGCTGCATGAGC 0: 1
1: 0
2: 0
3: 16
4: 165
Right 1089745565 11:120614461-120614483 GAGACAGAGGTGCCTGCATCTGG 0: 1
1: 0
2: 0
3: 32
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089745565 Original CRISPR GAGACAGAGGTGCCTGCATC TGG Intronic
900630451 1:3632401-3632423 GAGGCTGCTGTGCCTGCATCGGG + Intronic
900890373 1:5445420-5445442 AATACAAAGGTGCCAGCATCTGG + Intergenic
902359224 1:15933030-15933052 GAGACAGATGAGGCTGTATCTGG + Exonic
904969037 1:34404661-34404683 AAGACTGAGGGGCCAGCATCTGG + Intergenic
905268878 1:36773681-36773703 GAGACAGAGGTGACTTTTTCAGG - Intergenic
905640273 1:39584550-39584572 AAGACTGAAGGGCCTGCATCTGG - Intergenic
905887325 1:41498284-41498306 GGGCCAGAGGTCCCTGCATTTGG + Intergenic
906097736 1:43235674-43235696 GAGATAGAAGTGCCTCCAGCTGG + Intronic
906776818 1:48537245-48537267 GAGGCAGAGGTGTGTGCATAGGG + Intronic
906931957 1:50178569-50178591 TAGACTGAGGAGCCTGAATCAGG - Intronic
910640367 1:89454529-89454551 GAGATGGAGTTGCCTACATCTGG - Intergenic
911150247 1:94591395-94591417 GAGACAGAGGTGCCCGACCCAGG + Intergenic
912507667 1:110167220-110167242 GAGACAGCTCTGCCTGCATCAGG + Intronic
914225177 1:145714151-145714173 GAGACAGAGGTGGCAGCTTCAGG - Intergenic
916622202 1:166511328-166511350 AAGACTGAGGTGCCCACATCTGG + Intergenic
917981227 1:180270951-180270973 GAGACAGAGGGGAGGGCATCTGG + Intronic
918046956 1:180947422-180947444 GAGACAGTGGTGCCTGGACTGGG + Exonic
918328006 1:183428482-183428504 AAGACTGAGGGGCCAGCATCTGG - Intergenic
918466679 1:184827789-184827811 GAGACTGCGGGGCCTGCTTCAGG - Intronic
919036532 1:192318031-192318053 GAGAAAGAGTTGCCAGCATTTGG - Intronic
919737105 1:200959568-200959590 GAGACAGAGTTCCCTGGGTCGGG + Intergenic
920224655 1:204429845-204429867 GAGGCAGAGGTGGAAGCATCCGG - Intronic
920500123 1:206480407-206480429 GAGTCAGAGCTGCCTTGATCGGG - Intronic
920656092 1:207876289-207876311 GAGTCAGACATGCCTGCATTTGG - Intergenic
923603905 1:235426136-235426158 AAGACAGAGGAGCTTGCAGCAGG - Intronic
923771131 1:236938403-236938425 GAGGCAGAGGTGGGTGGATCAGG + Intergenic
1062948136 10:1476243-1476265 GAGCCAGGGGGGCCTGCCTCAGG + Intronic
1063177318 10:3563562-3563584 GAAACAGAGGTAGCAGCATCCGG + Intergenic
1067102588 10:43343688-43343710 TAGACAGCGGTGCCTGCCTGTGG - Intergenic
1068226852 10:54117307-54117329 CAGATGCAGGTGCCTGCATCTGG - Intronic
1068987295 10:63119022-63119044 GAGAGAGGGATTCCTGCATCAGG - Intergenic
1070896268 10:79985036-79985058 GAGTCAGACGTGCCTGCTGCAGG - Intergenic
1073111441 10:101065226-101065248 GACACAGAGGTGCAGGCACCAGG + Exonic
1074018533 10:109560617-109560639 AAGATTGAGGTGCCAGCATCTGG + Intergenic
1075199053 10:120387014-120387036 GAGACAGAGATGCCTGTAGAAGG - Intergenic
1075210175 10:120484413-120484435 AAGATCGAGGTGCCAGCATCTGG + Intronic
1076300408 10:129421463-129421485 GACACAGAGGGGCCTGGTTCAGG - Intergenic
1076334703 10:129697920-129697942 GAGACACAGGTGCTTGCCTCAGG + Intronic
1078620785 11:12905935-12905957 AGAACTGAGGTGCCTGCATCTGG - Intronic
1083198209 11:61103387-61103409 GTGACAGAGGTGCGTGACTCTGG + Intronic
1085467365 11:76733373-76733395 AAGACTGAGGGGCCGGCATCTGG + Intergenic
1085856635 11:80182689-80182711 AAGACTGAGCTGACTGCATCTGG - Intergenic
1086436961 11:86791174-86791196 GACACAGATTTGCCTTCATCTGG + Intronic
1087775552 11:102253561-102253583 GATCCAGAGCTGCCTGCAGCTGG - Intergenic
1088512595 11:110593655-110593677 GAGACAGAGGTACCCACAGCTGG + Intronic
1089745565 11:120614461-120614483 GAGACAGAGGTGCCTGCATCTGG + Intronic
1090948531 11:131452265-131452287 GAGAAAGTGGGGCCTGCAGCCGG - Intronic
1091224685 11:133950405-133950427 GAGACAGCGGTGCGTGTGTCAGG - Intronic
1092159841 12:6310353-6310375 GAGAGAGGGGTGCCTGCCACAGG + Intergenic
1094850819 12:34381594-34381616 GAGACAGAGGTCCCTTCCTACGG - Intergenic
1096066855 12:48747894-48747916 GAGACAAAGGTGACTGTATTTGG + Intergenic
1101445099 12:104731913-104731935 GAGACAGATGAGCCTGCCCCAGG + Intronic
1102134628 12:110563023-110563045 GAGACAGAATTGCCTGAACCTGG + Intronic
1102501999 12:113359163-113359185 GAGGCCGCAGTGCCTGCATCTGG + Intronic
1102548759 12:113675472-113675494 GCGGCAGAGGGGACTGCATCTGG - Intergenic
1102877658 12:116460311-116460333 GAAACAGAGGAGCCTGCTCCAGG + Intergenic
1104313496 12:127675730-127675752 GAGGGAGAGGTGGCTGCATTGGG - Intergenic
1104854954 12:131897140-131897162 GAGACAGGAGCGCCTGCAGCTGG - Intronic
1106128801 13:26922463-26922485 GAGCCAGAGGTTCCTGAGTCTGG - Intergenic
1106147132 13:27059662-27059684 GAGACAGAATTGCTTGAATCCGG + Intergenic
1106636661 13:31535895-31535917 GACACAGGGGTGGCTTCATCAGG - Intergenic
1107458052 13:40573256-40573278 GACACAGATGTGCCCACATCTGG - Intronic
1107599849 13:42002344-42002366 TTGACAGAGGTGCCTGCACTTGG - Intergenic
1108055233 13:46478623-46478645 AAGATCGAGGTGCCAGCATCTGG - Intergenic
1108669794 13:52674146-52674168 GAGACAGAATTGCTTGAATCTGG - Intronic
1111490256 13:88962981-88963003 GAGATCAAGGTGCCAGCATCTGG + Intergenic
1112387552 13:98954340-98954362 GAGAAAGAAGTGCCAGGATCAGG + Intronic
1113751277 13:112777981-112778003 CAGACAGAGGCGCCTGCACATGG - Intronic
1113975399 13:114224413-114224435 GAGCCTGAGATGCCGGCATCGGG + Intergenic
1114985036 14:28216792-28216814 GTCACAGAGGTGCTTGCATCGGG - Intergenic
1116678388 14:47935388-47935410 GAGACAGAGGTGCTTTCAGCAGG + Intergenic
1116772097 14:49138523-49138545 GAGAGAGAGGTGACTGGATTAGG + Intergenic
1116873415 14:50089153-50089175 AAGATCAAGGTGCCTGCATCTGG - Exonic
1118579922 14:67285603-67285625 GAGACCGAGGCGGCTGGATCAGG - Intronic
1122406495 14:101504105-101504127 GAGACAGTGGTGCTTACAGCTGG + Intergenic
1122555687 14:102578521-102578543 AAAATAGAGGGGCCTGCATCTGG - Intergenic
1123457192 15:20436913-20436935 GGGACAGAGGCCCCTGGATCCGG + Intergenic
1123660866 15:22563446-22563468 GGGACAGAGGCCCCTGGATCCGG - Intergenic
1124220104 15:27843859-27843881 GAGACAGCGATCCCTGCACCAGG - Intronic
1124263348 15:28212062-28212084 GGGACAGAGGCCCCTGGATCCGG + Intronic
1124314668 15:28657684-28657706 GGGACAGAGGCCCCTGGATCCGG - Intergenic
1125736993 15:41933870-41933892 CAGACAGAGGACCCAGCATCAGG + Intronic
1126279891 15:46933450-46933472 GAGACAGTAGTGCATGCAGCGGG - Intergenic
1128123599 15:65173271-65173293 GAGACAGAATTGCTTGAATCTGG + Intronic
1128306038 15:66599670-66599692 GAGAACCAGGTGTCTGCATCAGG + Intronic
1131380752 15:91962056-91962078 GAGCCTGAGATGGCTGCATCAGG - Intronic
1132010485 15:98271329-98271351 GAGACAGAGAGGCCTGAATTTGG + Intergenic
1132882829 16:2170030-2170052 GGGCCACAGGTGCCTGCCTCTGG - Intronic
1133028445 16:2998582-2998604 AAGACGGAGGGGCCTCCATCAGG + Intergenic
1133481029 16:6170755-6170777 GAGACAGTGGGGCCTGCTTGAGG - Intronic
1133895116 16:9919775-9919797 GAGCCAGAGGAGCATGCATTTGG - Intronic
1134234479 16:12454811-12454833 GAGGCAGAAGTGCCTGAACCTGG - Intronic
1134234485 16:12454840-12454862 GAGGCAGAAGTGCCTGAACCTGG - Intronic
1135432814 16:22401028-22401050 GACACAGAGGTGTCTGAACCAGG - Intronic
1136685404 16:31991247-31991269 GATACAGACGTGCCTGCGTGGGG + Intergenic
1137278830 16:46957784-46957806 GAGACACACCTTCCTGCATCCGG + Intronic
1138208592 16:55143849-55143871 AAGATTGAGGAGCCTGCATCTGG - Intergenic
1139679932 16:68553585-68553607 GAAACAGAGGTGACTTGATCTGG + Intronic
1140124799 16:72110327-72110349 GTGGCAGAGATGCCTGCATGTGG + Intronic
1140503734 16:75456697-75456719 GAGGGAGCAGTGCCTGCATCTGG + Intronic
1141043071 16:80688942-80688964 GAGACAGAGCTGCCAGGACCAGG - Intronic
1141717819 16:85736814-85736836 GAGGCCGAGGTGCGTGGATCAGG + Intronic
1142034642 16:87855620-87855642 GAGACCAAGATGCCAGCATCAGG - Intronic
1143890606 17:10099353-10099375 GAGGCAGATCTGCCTGCAGCAGG + Intronic
1144328851 17:14206633-14206655 GGGAGACAGGTGCCTACATCAGG - Intronic
1146005798 17:29159825-29159847 AAGTCAGGGTTGCCTGCATCTGG - Intronic
1146206472 17:30909218-30909240 GAGCCAGAGACACCTGCATCTGG - Intronic
1148735424 17:49862386-49862408 GAGACAGAGGTGCGGCCATCTGG + Intergenic
1149723022 17:58864698-58864720 GAGGCAGAGGTGGGTGGATCAGG + Intronic
1149981775 17:61316590-61316612 GACTCAGAGGGGCCTGCAGCTGG + Intronic
1150244901 17:63667037-63667059 GACAGAGAGGTGCCTGCTTCTGG - Exonic
1150336422 17:64333849-64333871 GAGTCAGAGGGGCCTGCCTGGGG + Intronic
1150382604 17:64732631-64732653 GAGAGCGAGGTGCCCACATCTGG + Intergenic
1150472767 17:65451173-65451195 GGGATAGATGTGCCTGCCTCTGG + Intergenic
1151061588 17:71100875-71100897 CAGAAACAGATGCCTGCATCAGG - Intergenic
1151416630 17:73970523-73970545 GAGACAGCAGAGGCTGCATCAGG - Intergenic
1151540266 17:74761248-74761270 GAAACAGAGGAGCCTGAATGGGG - Intronic
1151727675 17:75894138-75894160 GAGACAGAGGTGGCTGGAACAGG - Intronic
1151787120 17:76280463-76280485 CAGACAGAGGTCCCCGCATCTGG + Intronic
1152007861 17:77693864-77693886 GAAACAGAGGTGCCTGGAGAAGG + Intergenic
1152093696 17:78260598-78260620 GGGGCACAGGTGCCTGCTTCGGG + Intergenic
1152462983 17:80450958-80450980 AAGACGGAGGTGCCTGCAGTTGG + Intergenic
1152521565 17:80859579-80859601 GGGACGGAGGAGCCGGCATCAGG + Intronic
1152526459 17:80890726-80890748 GAGAGTGAGGGGCCGGCATCAGG + Intronic
1152560437 17:81075985-81076007 GAAGCAGAAGTGCCTGCACCCGG + Intronic
1152903037 17:82956311-82956333 TGGACTGAGGTGGCTGCATCGGG - Intronic
1156931222 18:42646483-42646505 GAGAGAGAGGTGCTTGTTTCTGG - Intergenic
1160786236 19:901286-901308 GAGACTGAGGGGCCTTCATTAGG + Intronic
1161133912 19:2608519-2608541 GGCACAGGTGTGCCTGCATCTGG - Intronic
1161884858 19:6986602-6986624 GAAACACAGGTGCCGGCATTTGG - Intergenic
1163397196 19:17070537-17070559 GAGAGGGAGGTGCCTGCAGGGGG - Intronic
1165306647 19:35006844-35006866 GCGACAGAGGTGCCTGCCTTAGG + Intronic
1165521328 19:36316618-36316640 GAAAGTGAGGGGCCTGCATCTGG + Intergenic
1165590918 19:36969090-36969112 GAGGCTGAGGTGGCTGGATCAGG - Intronic
1165622733 19:37261970-37261992 GAAAGTGAGGGGCCTGCATCTGG - Intergenic
1165634432 19:37328605-37328627 GAAAGTGAGGGGCCTGCATCTGG - Intronic
1166062918 19:40337937-40337959 TAGTTAGAGGTGCCTGCTTCTGG - Intronic
1166388950 19:42398124-42398146 GAGAGAGTGGAGCCTGGATCAGG + Intergenic
1167082123 19:47283481-47283503 GAGAAGGGGGCGCCTGCATCAGG + Intergenic
1167606799 19:50485588-50485610 GAGACAGAGGTGACGGGATGAGG - Exonic
1167689968 19:50979515-50979537 GAGACTGAGGTGCTGGCCTCAGG - Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
1168666785 19:58210362-58210384 GATACAGATGTGCCTGCCTGTGG - Intronic
925096578 2:1209048-1209070 GAGGCAGAGGAGGCTGCATGCGG - Intronic
927651696 2:24917420-24917442 GAGGCGGAGATGTCTGCATCTGG - Intronic
927665972 2:25033153-25033175 GAGACAGAGATGCCTTGATCAGG - Intergenic
927792689 2:26022868-26022890 GAGACAGAATTGCTTGCACCTGG - Intergenic
928001450 2:27526365-27526387 GAGACAGAGGGGTCTCCATCTGG + Intergenic
928326536 2:30323762-30323784 GAGACAAAAGAGCCTCCATCTGG + Intergenic
929758728 2:44788811-44788833 GAATCAGATGTGCCTGCATCTGG - Intergenic
932143189 2:69297361-69297383 CAGACAGAGGAGCCGGCATCTGG - Intergenic
934849136 2:97686067-97686089 AAGACTGAGGGGCCAGCATCTGG + Intergenic
937335402 2:121059365-121059387 GGGGCAGAGGTGGCTGCAGCTGG + Intergenic
937353952 2:121186433-121186455 CAGACAGAGGCGCCTGGAGCAGG - Intergenic
938288718 2:130138330-130138352 GACACAGGGGTGCCGGCAGCAGG - Intergenic
938467815 2:131534602-131534624 GACACAGGGGTGCCGGCAGCAGG + Intergenic
941179130 2:162236702-162236724 GAGGCAGAATTGCCTGAATCTGG - Intronic
941236754 2:162984609-162984631 GAGACAGAGGTTCCTGCAAAGGG + Intergenic
943050190 2:182904320-182904342 GAGACAGAATTGCCTGAACCTGG + Intergenic
943086346 2:183316496-183316518 GAGAGAGAGGTGACTGAGTCAGG + Intergenic
944447933 2:199810483-199810505 AAGAAAGAGGTGCCTCCAACAGG - Intronic
944667853 2:201971849-201971871 GAGACTGAGGTGCCAGGAACAGG + Intergenic
946803191 2:223442870-223442892 TAAATAGAGGTGCCTTCATCAGG + Intergenic
947979103 2:234393717-234393739 AAGATCGAGGTGCCAGCATCTGG + Intergenic
948168140 2:235878878-235878900 GTGACAGAGGTGCCTGCCAGAGG + Intronic
948199782 2:236121180-236121202 GAGACAGAAGAGCCTCCAGCTGG - Intronic
948685869 2:239669543-239669565 GAGACAGAGGGGACTCCCTCAGG - Intergenic
1170039727 20:12027241-12027263 GAGATATAGGTCACTGCATCAGG + Intergenic
1170507927 20:17047773-17047795 GGGACAGAGGTGCCTACAGCAGG - Intergenic
1171422208 20:25024882-25024904 GATGCAGGGGTGGCTGCATCTGG - Intronic
1173338400 20:42131991-42132013 GAGACAGAGGAGGCAGCAGCGGG + Intronic
1173986232 20:47263690-47263712 GAGGCAGAGGTGCCAGTAACTGG - Intronic
1174839831 20:53891277-53891299 GAGACAAAGCTGCCTGCATGAGG + Intergenic
1175840146 20:62021449-62021471 GAGACACAGCTGCCTGCACAGGG + Intronic
1175972610 20:62694321-62694343 GGGACAGAGGCTCCTGCACCCGG - Intergenic
1176172648 20:63703027-63703049 GAGATAGAGGTGCACTCATCTGG - Intronic
1177310349 21:19384156-19384178 AAGATCAAGGTGCCTGCATCTGG - Intergenic
1178559031 21:33620713-33620735 GAGGCAGAGTTGCTTGAATCTGG + Intronic
1178798498 21:35768259-35768281 GAGACATTTGTGTCTGCATCAGG + Intronic
1178857892 21:36265574-36265596 AAGACAGAGGGGCCTGCTACAGG - Intronic
1179522962 21:41957157-41957179 GAGAGAGAGGTGCCGGGAGCAGG - Intergenic
1181698261 22:24604887-24604909 GAGACAGAGCTGCCTTCAATGGG - Intronic
1183231270 22:36583650-36583672 GAGACAGAGCTGACAGCAGCAGG - Intronic
1183263405 22:36810895-36810917 GAGGCAGAGGCGCAGGCATCAGG - Intronic
1183498055 22:38161683-38161705 GGGACAGAGGTGTGTGCATGGGG + Intronic
1184671220 22:46013122-46013144 GAGACTGTGGAGCCTGCGTCGGG - Intergenic
1184871002 22:47238477-47238499 GGGAAAGAGATGCCTGCATGGGG - Intergenic
1185098424 22:48824281-48824303 GAGACAGAAGCATCTGCATCAGG + Intronic
950477084 3:13221303-13221325 GAGACAGAGGGGCCTGCAGAGGG - Intergenic
950665116 3:14490565-14490587 CAGGCAGTGGTGCCTGCATATGG - Exonic
950711429 3:14815737-14815759 GACTCAGAGGTCCCAGCATCTGG - Intergenic
950897550 3:16467366-16467388 GAGAAGGAGGGGGCTGCATCTGG - Intronic
952849826 3:37718796-37718818 CACACAGAGGGGCCTGCATCTGG + Intronic
953890694 3:46750038-46750060 GAGTCAGAGAGGCCTGCTTCTGG - Intronic
954152969 3:48667566-48667588 GAGGCAGAAGTGCCTGAACCTGG + Intergenic
954722174 3:52574168-52574190 AAGATAAAGGTGCCAGCATCTGG + Intronic
954858956 3:53671354-53671376 GGAACAGAGGTGCATGCAGCAGG - Intronic
956205306 3:66749030-66749052 GACACAGAGCTGTGTGCATCTGG - Intergenic
960149207 3:114232994-114233016 GAGACAGCTCTGCCTGCATGTGG + Intergenic
961324617 3:126102892-126102914 GGGACAGAGGGGCCTGCAGTGGG + Intergenic
961407523 3:126692201-126692223 GGGACAGAGGCTCCTGCATTTGG + Intergenic
962351984 3:134663131-134663153 GTGCCAGAGGGGCCTGTATCTGG - Intronic
963059533 3:141213900-141213922 GAGACATAAGTGCATGCATCTGG - Intergenic
966811907 3:183854146-183854168 GAGACAGAATTGCCTGAACCTGG + Intronic
966878384 3:184336224-184336246 GAGAGGGAGGAGCCTGCACCGGG + Intronic
968273290 3:197421248-197421270 CAGACAGAGGGGACTGCACCAGG - Intergenic
969247982 4:5947931-5947953 CTGGAAGAGGTGCCTGCATCTGG - Intronic
971420549 4:26470361-26470383 AATACCGAGGGGCCTGCATCTGG + Intergenic
971492454 4:27227407-27227429 CAGACAGATCTTCCTGCATCAGG + Intergenic
971866911 4:32184307-32184329 AAGAAAGAGGTGGCTGCATAGGG - Intergenic
972589574 4:40471598-40471620 GAGACAGAATTGCTTGAATCCGG + Intronic
973563423 4:52160426-52160448 GAGACAGAGGTGTTGGCTTCTGG - Intergenic
973948176 4:55982134-55982156 GAGACACAGGTGGCTGCCTGTGG - Intronic
974039993 4:56848968-56848990 GAGACAGAGGCGGGTGGATCAGG + Intergenic
980384432 4:132068675-132068697 GAGGCAGAGGTGGATGGATCAGG - Intergenic
980492695 4:133549611-133549633 GAGACAAATGTGACTGGATCTGG + Intergenic
980692714 4:136316878-136316900 GAGATAGAGCTGCCTGAGTCTGG + Intergenic
982485743 4:155963811-155963833 GAGACAGAGATGGCTTCATCAGG - Intergenic
984049624 4:174847918-174847940 GAAACAGATGTTCCTGCATTAGG + Intronic
985003829 4:185512933-185512955 GACACAGAGCTGCCAGCATCGGG + Intronic
985070472 4:186162573-186162595 GAGAGAGAGGTTCCTGCACCCGG - Intronic
985491583 5:182819-182841 CAGAGAGAGATGCCTGCATGGGG + Exonic
985661572 5:1159874-1159896 AAGGCGGAGGTGCCTGCATGGGG - Intergenic
986471384 5:8080442-8080464 TAGACAGAGGTGCCTGGACGAGG - Intergenic
986955590 5:13146503-13146525 GAGACAGAGATATCTGAATCTGG - Intergenic
988101997 5:26691577-26691599 GACACAGAGGTGCATGTAACAGG + Intergenic
991238930 5:64433841-64433863 GAGACAGAGGTGCTTGGAGCAGG + Intergenic
995044977 5:107635431-107635453 GACACAGAGCTGGCTGCCTCTGG + Intronic
1001085716 5:168698955-168698977 GAAACACAGTTGCCTGCAGCGGG + Intronic
1002841995 6:914145-914167 GAGCCAGAGGTGCAAGCAACAGG + Intergenic
1006742032 6:36315806-36315828 GAGACTCAGATGCCAGCATCAGG + Exonic
1007282282 6:40721434-40721456 CAGACAGAGATGCCTGCAAAAGG + Intergenic
1008208098 6:48687241-48687263 GAGGCAGAGGTGGCTGCTTAGGG - Intergenic
1008431244 6:51420057-51420079 CACACAGAGGTATCTGCATCAGG - Intergenic
1010805484 6:80230704-80230726 AAGGTTGAGGTGCCTGCATCTGG + Intronic
1011419035 6:87152576-87152598 GGGACAGATGTGCTTGCATCCGG - Intergenic
1013338198 6:109186798-109186820 GAGAAAGTGATGTCTGCATCAGG + Intergenic
1013539352 6:111092411-111092433 GAGGCAGAATTGCTTGCATCCGG - Intronic
1014769886 6:125448649-125448671 GAGACTGAGGGGCTGGCATCTGG + Intergenic
1014962549 6:127704997-127705019 TGGACAGAGTTGCATGCATCTGG + Intergenic
1015693810 6:135957137-135957159 GAGACAGGTGTGCCTGGGTCCGG + Intronic
1017382165 6:153843786-153843808 CAGATAGAGGTGCCTGCCTCTGG + Intergenic
1017756522 6:157533784-157533806 GAGGCAGAGGTGTCTGCTTGAGG - Intronic
1017826655 6:158086707-158086729 CAGACAGAGGTGCCCGTTTCTGG + Intronic
1018710576 6:166495636-166495658 CAGACAAAAGTGCCTGCACCTGG - Intronic
1018807603 6:167273331-167273353 GGAACAGAGCTGCCTCCATCGGG + Intronic
1019143585 6:169962874-169962896 GAGCCCGAGGTGGCTGCAGCAGG - Intergenic
1019359981 7:599746-599768 GGGACAGAGGTGCCAGGAGCTGG + Intronic
1019485128 7:1285816-1285838 GGGGCAGAGGTGGCTGCACCTGG - Intergenic
1019559312 7:1648067-1648089 GAGACAGAGCTGCAGGCAGCTGG - Intergenic
1021456081 7:20830875-20830897 TAGACAGATGTGCTGGCATCAGG - Intergenic
1021577502 7:22117562-22117584 CTGACAGGGGTGCCTTCATCTGG + Intergenic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1026135530 7:67657377-67657399 GAGGCCGAGGTGGGTGCATCAGG + Intergenic
1026527152 7:71164085-71164107 GAGACAGTGCTGCCTGTGTCTGG + Intronic
1027420795 7:78015798-78015820 GGGCCAGATGTGGCTGCATCTGG + Intergenic
1029218566 7:98970010-98970032 GAGTCAGAGGTGCCTGAGTGAGG + Intronic
1032283442 7:130524230-130524252 GATGCAGAGATGACTGCATCTGG + Intronic
1032284183 7:130528456-130528478 GATGCAGAGATGACTGCATCTGG + Intronic
1032284952 7:130532813-130532835 GACGCAGAGATGACTGCATCTGG + Intronic
1032285747 7:130537350-130537372 GACACAGAGAGGACTGCATCTGG + Intronic
1032286510 7:130541776-130541798 GACACAGAGAGGACTGCATCTGG + Intronic
1032626382 7:133595931-133595953 CAGACAGGGGTGCCAGAATCTGG - Intronic
1034324748 7:150220369-150220391 GCGACAGAGGTGCGCGCCTCGGG + Intergenic
1034768443 7:153748862-153748884 GCGACAGAGGTGCGCGCCTCGGG - Intergenic
1035240082 7:157523723-157523745 GAGACTGAAGGGCATGCATCAGG + Intergenic
1035604246 8:919309-919331 GAGACAGAGCTGCCGACATCAGG + Intergenic
1036696778 8:10980015-10980037 GGGACAGAGATGTCTGCCTCAGG - Intronic
1037277793 8:17200190-17200212 GAAACACAGGTGCCTGAATGGGG - Intronic
1037440234 8:18908609-18908631 GAGACAGACGTGCTTTCATAAGG - Intronic
1037569722 8:20148058-20148080 GAGCCAGAGGAACCTGCATGGGG + Exonic
1038489294 8:27958323-27958345 GAGACAGAGGTGCCTTCTGCAGG + Intronic
1038978744 8:32732483-32732505 TGGACAGATGTGCCTTCATCTGG + Intronic
1039799876 8:40944795-40944817 GAGACAGAGGTGCATGTCCCCGG - Intergenic
1040484302 8:47855611-47855633 AAGGCAGAGGTGCATGCATGGGG - Intronic
1041182213 8:55260588-55260610 GAGAGAGAGGGGCCTGCAAGTGG + Intronic
1043184987 8:77137207-77137229 AAGATAAAGGTGCTTGCATCTGG - Intergenic
1047801368 8:128313955-128313977 GAGACAGAGGTGCAAGAATTGGG - Intergenic
1048219391 8:132527485-132527507 GGGACAGAGGTGCCTGCCTGGGG - Intergenic
1048351877 8:133623239-133623261 GAGACAGAGGTGCCTTGCTCAGG - Intergenic
1049038280 8:140093781-140093803 GAGACAAAGGTGCCTGCTTGAGG + Intronic
1049172898 8:141173043-141173065 GAGGCGGAGGTGGCTGCATTGGG + Intronic
1049276534 8:141722873-141722895 GCAACTAAGGTGCCTGCATCCGG - Intergenic
1049600509 8:143505309-143505331 GAGCCAGGGCTGCCTGCATGTGG - Intronic
1049629185 8:143643044-143643066 GAAGCAGAGGTTCCTCCATCTGG + Intronic
1049655544 8:143795399-143795421 AGGTCAGAGGTGCCTGCAGCCGG - Exonic
1050129093 9:2391075-2391097 AAGACCATGGTGCCTGCATCTGG + Intergenic
1051404435 9:16720178-16720200 GAGAGAGAGGTGCCACCCTCAGG - Intronic
1052986218 9:34490101-34490123 CAAACAGATGTGCCTGCAGCTGG + Exonic
1055078815 9:72246467-72246489 GTGACATAGGTGCCTTCATAAGG + Intronic
1056571635 9:87821541-87821563 GAGAGACAGGTGCCAGCATCTGG + Intergenic
1056639032 9:88354517-88354539 GATTCAGAGGTGCCTGACTCAGG + Intergenic
1056699259 9:88888585-88888607 GAGACCGAGGTGGATGGATCAGG - Intergenic
1060586878 9:124792186-124792208 GACACATAGGTGCCAGAATCAGG - Intronic
1060586905 9:124792358-124792380 GACACACAGGTGCCTAAATCAGG - Intronic
1061449114 9:130659301-130659323 GAGACAGAGGCGCAGGCTTCTGG - Intergenic
1185601331 X:1341721-1341743 AGGACAGAGGTGCCTGCTGCAGG - Exonic
1186441142 X:9587547-9587569 GAGACTGAGGTGCTTGCTTTGGG + Intronic
1187526009 X:20055754-20055776 GCGGCAGTGGTCCCTGCATCCGG + Intronic
1188070577 X:25713517-25713539 GAGACAAAGAAGCCTGCAACTGG + Intergenic
1189213346 X:39303037-39303059 GAGACACTGCTCCCTGCATCTGG + Intergenic
1189288082 X:39866348-39866370 GGGAGAGAGCTGCCTGCCTCAGG - Intergenic
1190155637 X:47990023-47990045 GAGCCAGAGTAGCCTTCATCAGG + Intronic
1190486564 X:50931658-50931680 GAGAGCGAGGAGGCTGCATCTGG - Intergenic
1190818508 X:53950489-53950511 CAGACAGAGGTGCATGCTTAGGG - Intronic
1192279337 X:69667797-69667819 AAGATTGAGGGGCCTGCATCTGG + Intronic
1196846265 X:119898929-119898951 GAGACTGAGGTGGGTGGATCAGG + Intronic
1201453046 Y:14136524-14136546 GAACCAGAGATGCCTGCAACTGG - Intergenic