ID: 1089745885

View in Genome Browser
Species Human (GRCh38)
Location 11:120616466-120616488
Sequence CATTATCTTCAGACGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089745877_1089745885 30 Left 1089745877 11:120616413-120616435 CCTGTTAGATTGCTCTTTCAAAT 0: 1
1: 0
2: 1
3: 18
4: 199
Right 1089745885 11:120616466-120616488 CATTATCTTCAGACGGAAGCTGG 0: 1
1: 0
2: 1
3: 5
4: 88
1089745879_1089745885 4 Left 1089745879 11:120616439-120616461 CCGTGACAGACATGTTCCTTAGG 0: 1
1: 0
2: 0
3: 17
4: 107
Right 1089745885 11:120616466-120616488 CATTATCTTCAGACGGAAGCTGG 0: 1
1: 0
2: 1
3: 5
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089745885 Original CRISPR CATTATCTTCAGACGGAAGC TGG Intronic
903083945 1:20837980-20838002 CTCTAGCTGCAGACGGAAGCAGG + Intronic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
904378600 1:30096621-30096643 CATCATGGTCAGAGGGAAGCAGG + Intergenic
906934095 1:50196530-50196552 CATTTTCATCAAAGGGAAGCTGG - Intronic
913697510 1:121341791-121341813 CACTCTCTTCACACAGAAGCTGG - Intronic
914140049 1:144938261-144938283 CACTCTCTTCACACAGAAGCTGG + Intronic
915594910 1:156891236-156891258 CATTATCTGCAAAGGGGAGCAGG + Intergenic
915885804 1:159719342-159719364 CATTTTCTTCACAAGGCAGCAGG - Intergenic
919536603 1:198796081-198796103 CATTTTCTTCACAAGGCAGCAGG + Intergenic
920247963 1:204602472-204602494 CATGATCTTTGGTCGGAAGCTGG + Intergenic
920484899 1:206360440-206360462 CACTCTCTTCACACAGAAGCTGG - Intronic
1062901358 10:1149078-1149100 CATTCTCTCCAGAAGGAGGCTGG - Intergenic
1066788321 10:39031419-39031441 AATTATCTTCAGACAAAAACTGG - Intergenic
1071536914 10:86441053-86441075 CATTAGTTTCAGCAGGAAGCAGG - Intronic
1072450067 10:95532621-95532643 CATTATCTTCATTTGCAAGCTGG - Intronic
1073245228 10:102085738-102085760 CATTATCCTCAGAAGGAGGAGGG + Intergenic
1079351754 11:19697763-19697785 CATTGTCTTCAGAAGAGAGCAGG + Intronic
1081095414 11:38927403-38927425 AATTATCTTGAGAATGAAGCCGG - Intergenic
1082291507 11:50379070-50379092 CAATATCTTCAGATAAAAGCTGG + Intergenic
1089741758 11:120589434-120589456 CTTTATCTTCAGTCAAAAGCAGG - Intronic
1089745885 11:120616466-120616488 CATTATCTTCAGACGGAAGCTGG + Intronic
1090383299 11:126342042-126342064 AATTATCTTCACAAGGAATCTGG + Intronic
1093544287 12:20328053-20328075 CATTACTTTCAAAAGGAAGCTGG + Intergenic
1094036830 12:26081104-26081126 CACTTTCTTCACAAGGAAGCAGG + Intergenic
1094857225 12:34411648-34411670 AATTATCTTCAGATAAAAGCTGG - Intergenic
1099572057 12:84334952-84334974 CATCTTCTTCACAAGGAAGCAGG - Intergenic
1111237799 13:85431399-85431421 CATGTTCTTCAGACGGGAGTAGG + Intergenic
1113421221 13:110173045-110173067 GCTTATCTCCAGACGGCAGCAGG - Intronic
1128075176 15:64821342-64821364 CAGTATGTTCAGAGGGCAGCAGG - Intronic
1132214556 15:100053200-100053222 CTGGATCTTGAGACGGAAGCAGG + Intronic
1132758006 16:1495348-1495370 CATCTTCATCAGCCGGAAGCTGG - Exonic
1133068427 16:3227685-3227707 CATCATCTTCACAAGGCAGCAGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1134642952 16:15843863-15843885 CATCATCATCACCCGGAAGCTGG - Intronic
1135748479 16:25037366-25037388 CATTATCTTGAGAATGAAGAAGG - Intergenic
1135875730 16:26198380-26198402 CATAAGCCTCAGAAGGAAGCAGG - Intergenic
1136412420 16:30085121-30085143 CATCTTCCTCAGACGGAGGCTGG + Exonic
1138935948 16:61723373-61723395 CATTCTCTTCAGAAAGAATCTGG + Intronic
1143775740 17:9197737-9197759 GATTTTCTTCAGGCTGAAGCTGG + Intronic
1147452614 17:40515190-40515212 CCTTCTCTGCAGACAGAAGCAGG + Intergenic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1152604078 17:81280215-81280237 CATTGACTTCAGACGGCTGCTGG - Intronic
1157421464 18:47550949-47550971 CATTCTCTTCAGTTAGAAGCTGG - Intergenic
1158107274 18:53899880-53899902 CATTTTCTTCACAAGGCAGCAGG - Intergenic
1160218688 18:76956811-76956833 CATTCCCTTCACACGGAAGACGG - Intronic
1160414523 18:78698896-78698918 CATTTTCTTCAGACTGAATTAGG - Intergenic
1164130788 19:22359372-22359394 CATGATCTTCAGGCTGGAGCTGG + Intergenic
926242672 2:11100464-11100486 CATTAACTTCAGACACACGCAGG + Intergenic
926638099 2:15205793-15205815 CAAGATCTTCAGAAGGCAGCAGG - Intronic
933602154 2:84344182-84344204 CATTATCTTGATACCGAAACTGG - Intergenic
933854805 2:86402843-86402865 CATTATCATCAAATGAAAGCAGG - Intergenic
937243532 2:120477640-120477662 CAGTATGTTCAGAAGGAGGCTGG - Intergenic
939007922 2:136810468-136810490 CATTATCTTCAGACTGCAGTGGG - Intronic
946031679 2:216710501-216710523 TATTATCTTCAGAGAGATGCAGG + Intergenic
947960637 2:234233807-234233829 CATCATTTTCAGAAGGAACCAGG + Intergenic
1169694692 20:8374277-8374299 CATCTTCTTCACAAGGAAGCAGG - Intronic
1172379086 20:34473860-34473882 TATTATGTTCAGACTGAAACTGG - Intronic
950477547 3:13223512-13223534 CCTTCTCATCAGAGGGAAGCTGG + Intergenic
957700955 3:83711100-83711122 GATTACCTTCAGACTGAAGTTGG + Intergenic
959175115 3:102898627-102898649 CATTGTCTTCACAAGGCAGCAGG - Intergenic
959619184 3:108381676-108381698 CATTAACTTCAAAGGGAGGCAGG + Intronic
961233240 3:125339849-125339871 CATTATTTTCAGACGAGATCGGG + Intronic
962713363 3:138106507-138106529 CATCAGCTTCAGAAGGAAGAAGG + Intronic
970228671 4:13886152-13886174 CATTACCTTCAGCCTAAAGCAGG + Intergenic
981660553 4:147161326-147161348 AATTATTTTAAGACGAAAGCTGG + Intergenic
985006485 4:185539757-185539779 CATTATCTTCAGACCACAGCAGG - Intergenic
989836296 5:45997476-45997498 AAATATCTTCAGATTGAAGCTGG + Intergenic
990083280 5:51943887-51943909 CATCTTCTTCAGAGGGATGCAGG - Intergenic
994389871 5:99179438-99179460 CATTGTCTTCAGACAGAAGCAGG + Intergenic
999935404 5:156480696-156480718 CATTATCTCCAGAAGAGAGCAGG - Intronic
1002595115 5:180317195-180317217 CACTACCATCAGAGGGAAGCAGG + Intronic
1004963724 6:20822759-20822781 CACTTTCTTCAGAAGGCAGCAGG - Intronic
1010185583 6:73139873-73139895 TATTAACTTCAGAAGGAAGAAGG - Intronic
1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG + Intergenic
1014768106 6:125430471-125430493 CATTATCTACAGACTGAGGCTGG + Intergenic
1019543949 7:1564073-1564095 CATTTTCCTTACACGGAAGCAGG - Intergenic
1023352981 7:39338765-39338787 CAATTTCTGCAGAAGGAAGCTGG - Intronic
1025575578 7:62636470-62636492 AAATATCTTCAGACAAAAGCTGG - Intergenic
1025581367 7:62722707-62722729 AAATATCTTCAGACGAAAACTGG + Intergenic
1032458220 7:132089546-132089568 CTTTATCTTCAGCCTGAGGCTGG + Intergenic
1032916011 7:136491028-136491050 CATTATATTCAGAAGGTAACAGG - Intergenic
1033584694 7:142765386-142765408 CACTATCTTCAGAGGAAAACAGG + Intergenic
1033586164 7:142775954-142775976 CACTATCTTCAGAGGAAAACAGG + Intergenic
1036988514 8:13565553-13565575 CCTTATCTTCAACAGGAAGCTGG + Intergenic
1039139506 8:34370088-34370110 GATGATGTTCAAACGGAAGCTGG - Intergenic
1041305124 8:56449615-56449637 CATTATTTTCAGATGGAAGATGG + Intergenic
1042216539 8:66434060-66434082 CATTATCTTCAGGCTGGAGCAGG - Intronic
1044734356 8:95264027-95264049 CATTATATTCAAGAGGAAGCTGG + Intronic
1048280526 8:133102418-133102440 CATTTTCTTCAGACCAAAGACGG + Intronic
1052901912 9:33800618-33800640 CACTATCTTCCGAGGGAAACAGG + Intergenic
1056536222 9:87529984-87530006 CATTATCTTAATGAGGAAGCAGG - Intronic
1058622339 9:106896763-106896785 CATAAACTTCAGACAGGAGCAGG - Intronic
1192806085 X:74510670-74510692 CAATAGCTGCAGAGGGAAGCAGG + Intronic
1200226074 X:154418581-154418603 CATTGGCTTCAGAAGGAAGGAGG + Intronic
1202062964 Y:20907340-20907362 CATTCTCTTCATACAGTAGCTGG - Intergenic