ID: 1089748328

View in Genome Browser
Species Human (GRCh38)
Location 11:120632587-120632609
Sequence AAGAGCAGGAAGAAGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 947
Summary {0: 1, 1: 0, 2: 11, 3: 91, 4: 844}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089748328_1089748334 17 Left 1089748328 11:120632587-120632609 CCAGCCACCTTCTTCCTGCTCTT 0: 1
1: 0
2: 11
3: 91
4: 844
Right 1089748334 11:120632627-120632649 GCTGAAAACTTGGCTCTTCCAGG 0: 1
1: 0
2: 4
3: 62
4: 344
1089748328_1089748333 7 Left 1089748328 11:120632587-120632609 CCAGCCACCTTCTTCCTGCTCTT 0: 1
1: 0
2: 11
3: 91
4: 844
Right 1089748333 11:120632617-120632639 CATTTATCTTGCTGAAAACTTGG 0: 1
1: 0
2: 4
3: 30
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089748328 Original CRISPR AAGAGCAGGAAGAAGGTGGC TGG (reversed) Intronic
900484433 1:2914719-2914741 CAGAGCAGGATGAGGGAGGCTGG + Intergenic
900538099 1:3188825-3188847 GAGAGGAGGAAGCAGGGGGCGGG + Intronic
900674530 1:3876741-3876763 AGGTGCAGGCAGCAGGTGGCAGG - Intronic
900700309 1:4044209-4044231 AAGAGGAAGAAGAAAGAGGCTGG - Intergenic
900909448 1:5584611-5584633 AAGAGGAGGAAGAGAGAGGCGGG + Intergenic
901157995 1:7153637-7153659 AAGAGCAGGTGGGAGGTTGCCGG - Intronic
901420320 1:9146331-9146353 AGGAGGAGGAGGAAGGGGGCGGG - Intergenic
902360943 1:15942323-15942345 AAGTGCAGGAAGAAGGTGAGGGG - Exonic
902464586 1:16608139-16608161 AAGAGCAGAAAGCAGGTGAAAGG + Intronic
902620170 1:17646195-17646217 AGGAGCTGGAATGAGGTGGCAGG - Intronic
902706316 1:18207733-18207755 AAAGGCAGGAAGAATCTGGCAGG + Intronic
902778921 1:18692199-18692221 AAGAAAAGGAAGAAGGTGGAAGG + Intronic
902960615 1:19960685-19960707 AAGGGCAAGAAGAAGGCGGCAGG - Intergenic
903156222 1:21445566-21445588 AAGAGCAGAAAGCAGGTGAAAGG - Intronic
903259632 1:22124344-22124366 AACAGCAGGAAGAAAGGAGCTGG - Intronic
903747484 1:25597764-25597786 AAGTGCAGGTGGAAGGTCGCAGG - Intergenic
903828961 1:26163638-26163660 CCGAGAAGGAAGAAGGGGGCCGG - Intergenic
904019383 1:27450793-27450815 AAAAGAAGGGAGAAGGAGGCTGG - Intronic
904106266 1:28087793-28087815 AAGAGCAGCTAACAGGTGGCAGG - Intronic
904337970 1:29810331-29810353 GAGGGAAGGAAGAAGGTGGAGGG - Intergenic
904390799 1:30184518-30184540 AAGAAGGGGAAGAAGGTGGAAGG - Intergenic
904850530 1:33455775-33455797 AGGAGAGGGAAGGAGGTGGCTGG + Intergenic
904855070 1:33491571-33491593 ATGAGCAGGAGGAAGGGGGCTGG + Exonic
905696674 1:39979757-39979779 AAGGGCAAGAAGAAGAGGGCAGG - Intergenic
907068999 1:51518143-51518165 AGGAGCAGGAAGGAACTGGCAGG + Intronic
907470804 1:54672239-54672261 ATGGGCAGGAAGGAGGAGGCAGG + Intronic
908280802 1:62532862-62532884 ATGAGGAGGAAGAGAGTGGCAGG + Intronic
908539879 1:65112185-65112207 GAGAGCAGGAACAAGGGGGTGGG + Intergenic
910452574 1:87361980-87362002 GAGGACAGGAAGGAGGTGGCGGG - Intergenic
910665290 1:89719273-89719295 AAGAGGAAGAATAAGGTGGGGGG - Exonic
911008756 1:93255780-93255802 AAGAGGAAGAAGAAGGAGGGGGG + Intronic
911480861 1:98438385-98438407 AATGGAGGGAAGAAGGTGGCAGG - Intergenic
911604520 1:99888037-99888059 AAGAAAAGGAAGATGGTGGAGGG + Exonic
911830224 1:102541286-102541308 AGGAGCAGGAGGAAGGTAGGAGG + Intergenic
912993433 1:114510921-114510943 AGGAGGAGGAGGAAGGCGGCAGG - Exonic
913118339 1:115717057-115717079 AGGAGCAGGACCAAGGTGGTGGG - Intronic
913120651 1:115737580-115737602 AAGAGCAGGCAGAAGGGACCAGG - Intronic
913303458 1:117398375-117398397 AAGAACTGAAAGAAGGTGGCTGG + Intronic
913461213 1:119087850-119087872 AAGAGCAGAAAGAAGGTGAGAGG + Intronic
913571084 1:120120563-120120585 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
913700829 1:121373020-121373042 TAGAGCAGGCACTAGGTGGCTGG + Intronic
914041379 1:144053487-144053509 TAGAGCAGGCACTAGGTGGCTGG + Intergenic
914136706 1:144907003-144907025 TAGAGCAGGCACTAGGTGGCTGG - Intronic
914259294 1:145985441-145985463 TAGATCAGGAAGAGGGTGGTTGG - Intergenic
914291894 1:146281541-146281563 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914552938 1:148732324-148732346 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914687067 1:149989746-149989768 AAGAAGAAGAAGAAGGTGGGGGG + Intronic
914746698 1:150506440-150506462 TAGAGCAAGTGGAAGGTGGCAGG - Intronic
914782307 1:150796770-150796792 AAGAGCAGGATGGATTTGGCTGG + Exonic
915496097 1:156283713-156283735 AGGAACAGAAAGAAGGTGGGTGG - Intronic
915608573 1:156971751-156971773 AAGAGCAGATCGAAGGTGCCCGG - Exonic
915647201 1:157281402-157281424 TAGAGCAGGGAGAAGGGAGCAGG + Intergenic
915981882 1:160425466-160425488 AAGAGCAAGAAGAAGAAGGGTGG - Exonic
916047844 1:161013922-161013944 AACAGGAGGAAGCAGCTGGCTGG - Intronic
916165275 1:161961222-161961244 AAGAGCAGGAAGGTGGTAGCAGG + Exonic
916627071 1:166569951-166569973 AGGAGAAGGCTGAAGGTGGCAGG + Intergenic
918002679 1:180512476-180512498 AAGGGCAAGAAGAAGGGGGCAGG + Intergenic
918015850 1:180632025-180632047 GAGAGGAGGAGGAAGATGGCGGG + Exonic
918136294 1:181677017-181677039 AAGAGGAGGAAGAAGCTGAGAGG - Intronic
918511159 1:185316331-185316353 AAGCGCGGGGAGAAGGGGGCGGG - Intronic
918743704 1:188170765-188170787 AAGAACAAGAAAAATGTGGCAGG - Intergenic
919594569 1:199546070-199546092 AAAAGAAGGAAGAAGGAGTCAGG + Intergenic
919757865 1:201077135-201077157 AAGAGGAGGCACAAGGTGGGAGG + Intronic
920176059 1:204102623-204102645 TGGAGGAGGAAGAGGGTGGCGGG + Intronic
920261982 1:204694548-204694570 GAGAGCAGGAAGTAGGCAGCAGG - Intergenic
920488247 1:206391756-206391778 TAGAGCAGGCACTAGGTGGCTGG + Intronic
920694175 1:208169229-208169251 AAGGGCAGGCAGGAGGTGACAGG + Intronic
920834585 1:209497893-209497915 GAGAGCAGGCAGCAGGTGCCAGG + Intergenic
920864811 1:209743179-209743201 AAGAGAAGGAGGAAGGTGAAGGG + Intergenic
921065460 1:211619472-211619494 AAGAGGAGGAAGAAGCTGCTAGG + Intergenic
921099506 1:211916252-211916274 AAGAGCTGGAAGAAGGAACCTGG - Intergenic
921110870 1:212035507-212035529 AAAACCAGCAAGAAGGCGGCGGG - Exonic
921131225 1:212221695-212221717 AAGACAATGGAGAAGGTGGCTGG + Intergenic
921164189 1:212494316-212494338 AATGGCAGGCAGGAGGTGGCGGG + Intergenic
921254034 1:213323370-213323392 AGGTGCAGGATGAAGGTGGCAGG + Intergenic
921351655 1:214242336-214242358 AAGAGCAGGAGGAAGAAGGTGGG - Intergenic
922189615 1:223306409-223306431 ATCAACAGGAAGATGGTGGCAGG + Intronic
922189809 1:223308334-223308356 AAGAGCAGGAACAAGAGGGTGGG - Intronic
922212907 1:223499180-223499202 AAGAGCAGGGAGGAGGTGCCAGG - Intergenic
923216817 1:231856270-231856292 AGAGGCAGGAAGAAGGTGGCAGG + Intronic
923394476 1:233547408-233547430 CAGTGCAGGGAGAAGGTGTCTGG - Intergenic
923663588 1:235979629-235979651 AGGAGCATGAAGAAGGAGGGAGG - Intronic
924261719 1:242238324-242238346 AAGTGCAGGAAGAGGGTAGCAGG - Intronic
924372502 1:243367560-243367582 AAAAGCAGAAAGAGGGTGACTGG - Intronic
924660034 1:246007511-246007533 AAGAAAAGGCAGAAGGAGGCCGG + Intronic
1063508541 10:6624208-6624230 AAAAGCGGGAAGGAGGTGGTTGG - Intergenic
1063577419 10:7274505-7274527 AAGAGCTGGATGAAGGGGGAAGG - Intronic
1063602992 10:7498814-7498836 AAGAGGAGGAGGAGGGAGGCCGG + Intergenic
1063607970 10:7539638-7539660 AAGAGCAGATAGATGGTGGGAGG + Intergenic
1063985910 10:11501678-11501700 GAGACCAGTGAGAAGGTGGCAGG - Intronic
1064376346 10:14799966-14799988 TAGAGGAGAAAGAAGGAGGCAGG + Intergenic
1064950111 10:20839112-20839134 AAAAACTGGAAGAAGGTGTCAGG - Intronic
1065318377 10:24486182-24486204 GAGAACAGGCTGAAGGTGGCAGG - Intronic
1067183067 10:44005150-44005172 AGGACCAGGAAGAAGGGGACCGG + Intergenic
1067706803 10:48612115-48612137 AAAAGCAGGAGGAAGTTGGCTGG - Intronic
1067794759 10:49312765-49312787 AAGAGATGGAAGCAGGTGGACGG - Intronic
1067813678 10:49453443-49453465 AACAGCACAAAGGAGGTGGCTGG - Intergenic
1068084249 10:52355125-52355147 TTGAGGAGGAAGAAGGTGTCAGG + Intergenic
1068343263 10:55737005-55737027 AAGAGCAGAAGGGAGGTGCCAGG + Intergenic
1068764815 10:60751513-60751535 AAGAACAGGGATAAGGTGACTGG - Intergenic
1068812641 10:61273910-61273932 CACAGCAGGAAGTAAGTGGCAGG + Intergenic
1069335146 10:67340174-67340196 AAGGGCAGGAGGAAGGAGGAGGG + Intronic
1069606140 10:69739960-69739982 CAGGGCAGGAAGAACGGGGCAGG - Intergenic
1069821335 10:71230534-71230556 GAGGGCAGAGAGAAGGTGGCTGG - Intronic
1070079957 10:73176318-73176340 CAGAGCAGGAGGTAAGTGGCAGG - Intronic
1070524468 10:77283334-77283356 AGGAGGAGGGAGAAGGAGGCAGG + Intronic
1070726329 10:78793717-78793739 TGTGGCAGGAAGAAGGTGGCGGG - Intergenic
1070933979 10:80279335-80279357 AAGGGCAGGAGGGAGGTGGCAGG + Intronic
1070961856 10:80505156-80505178 AAGAGCAGGCAGCAGGGAGCGGG + Intronic
1071003592 10:80858381-80858403 AGGAGCAGAAAGAATGTGGCTGG - Intergenic
1071836971 10:89427935-89427957 ATGAGCATGAAGAATGTGGGTGG + Intergenic
1072111340 10:92323031-92323053 AAAAGAATAAAGAAGGTGGCTGG - Intronic
1072195396 10:93113560-93113582 ATGAGCATGAAGGAGGTGCCTGG + Intergenic
1072639584 10:97201871-97201893 AAGAGGAGGGAGCAGGTGGAGGG - Intronic
1072783054 10:98262982-98263004 AGGAACAGAAAGAGGGTGGCTGG + Exonic
1073198599 10:101716138-101716160 AAGAAATTGAAGAAGGTGGCTGG - Intergenic
1073444189 10:103571138-103571160 GGGAGCAGGAAGCAGGAGGCGGG - Intronic
1073451876 10:103614766-103614788 CAGATCAGGAAGACGGTGGGCGG - Intronic
1073499684 10:103925146-103925168 AATAGCACAAAGAAGGTGGGAGG - Intergenic
1073667474 10:105550049-105550071 AACAGCACAAAGAAGGTGGATGG + Intergenic
1074240307 10:111632194-111632216 TAGAGCAGGCAGAAAGTGCCTGG - Intergenic
1074266191 10:111905922-111905944 AGGAGTAGGAACAAGGTGGGAGG + Intergenic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075532553 10:123242010-123242032 CAGGGCAGGAAGGAGGTGCCAGG - Intergenic
1075590687 10:123688972-123688994 AAAGGTAGGAGGAAGGTGGCTGG + Exonic
1075901915 10:126049973-126049995 CAGGGCAGAAAGGAGGTGGCTGG + Intronic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076643949 10:131938532-131938554 AAGACCAGGAGGAAAGTAGCAGG - Intronic
1076838411 10:133032723-133032745 ATGAGGAGGGAGAAGGGGGCAGG - Intergenic
1077365069 11:2158348-2158370 AAGAGGAGGGAGGCGGTGGCTGG - Intronic
1077370763 11:2180566-2180588 AGGAGCAGGAAGGAGGAGGTGGG + Intergenic
1077392564 11:2306887-2306909 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1077447663 11:2606494-2606516 AAGAGCAGGAGCAAGGTGGAGGG - Intronic
1077607088 11:3619673-3619695 TAGAGCAGGAAGGATGAGGCCGG + Intergenic
1077921861 11:6647340-6647362 CAGAGCTGGAAGAAGGAGGAGGG + Intronic
1078011886 11:7578768-7578790 AAGAGCAGTAAGAATGAGTCAGG + Intronic
1078386411 11:10896846-10896868 GAAAGCAGGAAGAAGGAGACGGG - Intergenic
1078450880 11:11439876-11439898 AAGAACAGGATGATGGAGGCAGG + Intronic
1078524158 11:12087835-12087857 AAGAGGAGGAAGAAGTTAGCTGG - Intergenic
1078535746 11:12172141-12172163 CAAAGCAGGAAGAAGGTAGATGG + Intronic
1078640407 11:13090251-13090273 AGGGACAGGAAGAAGGTAGCTGG - Intergenic
1078733930 11:14002535-14002557 AAGTGCAGGAGGAATGTGGTAGG + Intronic
1078797785 11:14610434-14610456 AATAGTAGGAAGCAGGAGGCAGG - Intronic
1079132560 11:17756030-17756052 AAGTGCAAGAAGAAGGAGGGAGG + Intronic
1079310427 11:19360727-19360749 AAGGGGAGGAAGAAGAAGGCTGG + Intronic
1079697084 11:23495362-23495384 AAGAGAAGGAGGAAGGTGGAGGG + Intergenic
1080384116 11:31800454-31800476 AGGAGCGGTATGAAGGTGGCTGG - Intronic
1080575244 11:33592944-33592966 AAAAGCAGGATCAAGGGGGCTGG + Intronic
1080603933 11:33848303-33848325 CAGAGCAGGAGGAAGGTGGCGGG - Intergenic
1080822159 11:35817841-35817863 CAGAGCAGAAGGAAGGTGGGGGG - Exonic
1081036906 11:38159625-38159647 AAGAGCAGGAGCAAGAGGGCAGG - Intergenic
1081068227 11:38575887-38575909 AAGAGCAGGAGCAAGGTTGGGGG + Intergenic
1081872948 11:46391553-46391575 AAGAGCAGGAAGCAGGTCCCCGG - Intergenic
1083385899 11:62310154-62310176 AAGAGCAGGACCAAGTTGGGGGG + Intergenic
1083615970 11:64026799-64026821 AAGAGCTGGAAGAGTGTGCCAGG - Intronic
1083852228 11:65375086-65375108 CAGAGCAGGAAAATGGGGGCTGG + Intergenic
1084450645 11:69234731-69234753 AAGGGCAGGAGGAAGGGGGGGGG + Intergenic
1084929827 11:72546132-72546154 AAGATGAGGAAGGAGGTGGCTGG - Intergenic
1085247605 11:75116247-75116269 CAAAGCAGGCAGAAGGTGGGTGG + Intronic
1085300436 11:75455368-75455390 GAGGGCAGGAGGAAGGTGGGGGG + Intronic
1085718013 11:78890030-78890052 GAGAGCAGCAAGAGGGTGTCAGG + Intronic
1085829413 11:79883809-79883831 AGGTGCAGCGAGAAGGTGGCTGG + Intergenic
1086351535 11:85946800-85946822 AGGGGCAGGAACAAGGTGGTTGG + Intergenic
1086920943 11:92585952-92585974 ATGTGAAGGGAGAAGGTGGCTGG + Intronic
1087140781 11:94763766-94763788 AGGAGGAGGAAGAAGGGGGTGGG + Intronic
1087649538 11:100848439-100848461 ATGAGCAGGAAGATGGTTGCTGG - Intronic
1087817919 11:102679387-102679409 GAGAGTAGGAGGAGGGTGGCGGG + Intergenic
1088412890 11:109555022-109555044 AGGAGAAGGAAGAAGGGGACTGG + Intergenic
1088784267 11:113166220-113166242 AACAGCAGGAAGACAGTGGAGGG + Intronic
1089031183 11:115331005-115331027 AAGAGGAGGAATCAGGTTGCAGG + Intronic
1089399546 11:118156547-118156569 AAGAGGAGGGAGAGGGAGGCAGG - Intergenic
1089500142 11:118927162-118927184 AACAGCAGGAACAAGCAGGCTGG - Intronic
1089603595 11:119629066-119629088 CAGAGCAGGAGGGAGGTGGGTGG + Intronic
1089627313 11:119759626-119759648 TGGAGCAGGAAGAAGGTTTCTGG + Intergenic
1089639661 11:119839358-119839380 AAGAAGAGAAAGAAGGTGGAGGG - Intergenic
1089748328 11:120632587-120632609 AAGAGCAGGAAGAAGGTGGCTGG - Intronic
1089920677 11:122206749-122206771 CTGAGGAGGAAGAAGGAGGCCGG + Intergenic
1090005874 11:123001846-123001868 AGGAGCAGGAGCAAGGTTGCTGG - Intergenic
1090049621 11:123366276-123366298 AAAAGCAGGAACAAGTTAGCAGG + Intergenic
1090620182 11:128553688-128553710 AGGAGGAGGAGGAGGGTGGCGGG - Intronic
1090838599 11:130471343-130471365 AAGAGCTGCAAGAAGGTGACTGG + Exonic
1090854609 11:130600691-130600713 CAGAGCAGGAGGAAGGGGGCAGG + Intergenic
1090902562 11:131045880-131045902 CAGGGAAGGAAGGAGGTGGCGGG + Intergenic
1090952596 11:131486715-131486737 AAGGAAAGGAAGAAGGTGACAGG - Intronic
1091179422 11:133590024-133590046 AAGAGCAGGAATAAGGCTGGTGG - Intergenic
1091551210 12:1536213-1536235 AAGGGAAGGAAGAGGGAGGCAGG + Intronic
1091796273 12:3299076-3299098 GAGAGGAAGAAGAAGGTGGCGGG - Intergenic
1091999204 12:5018901-5018923 AAGACAAGGAGGAGGGTGGCAGG - Intergenic
1092576017 12:9783213-9783235 AAAGGCAAGAAGAAGGTGGTGGG + Intergenic
1092629312 12:10361342-10361364 AAGAACAGGAAGAAGAGGGCAGG + Intergenic
1092913548 12:13169190-13169212 ATGTGCAGGCAGGAGGTGGCTGG + Intergenic
1093307937 12:17542936-17542958 AACAGAAGCAAAAAGGTGGCAGG - Intergenic
1093504566 12:19850202-19850224 ATGAGCAGGAAGAATTGGGCTGG + Intergenic
1094360038 12:29620796-29620818 CAGCACAGGAAAAAGGTGGCAGG + Intronic
1095401357 12:41818077-41818099 AGGAGCAGGAGCAAGGGGGCAGG - Intergenic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1096580029 12:52579110-52579132 ATGAGAAGAAAGCAGGTGGCTGG + Intergenic
1096676951 12:53231289-53231311 AAGAGCAGGAAGACCGGGACAGG - Intronic
1096688297 12:53303680-53303702 AAGAGCAGGAAGCTGCTTGCAGG - Intronic
1096747597 12:53738783-53738805 GGGAGAAGGAAGAGGGTGGCCGG - Intergenic
1096965181 12:55620546-55620568 GCGAGAAGGAAGAAGGTGGGAGG + Intergenic
1097026129 12:56056986-56057008 ATGAGAAGGATGCAGGTGGCAGG + Intergenic
1097462987 12:59887083-59887105 AATACCAGGAAGAAGGTGAAGGG + Intergenic
1097565068 12:61257896-61257918 AAGAGAAGGCAAAAGGTGGGGGG - Intergenic
1097790664 12:63811970-63811992 AAGAGGAGGAAGGAGGGGGAGGG + Intergenic
1098239045 12:68447445-68447467 AAGAACAGGAATAATGAGGCTGG + Intergenic
1098385135 12:69910405-69910427 AGGTGGAGGGAGAAGGTGGCAGG + Intronic
1098504852 12:71237605-71237627 AAGAGGAGGAGGAGGGTGGATGG - Intronic
1098523531 12:71460743-71460765 GAGAGGAGGAAGAATGGGGCTGG - Intronic
1098542377 12:71671047-71671069 AGGAGGAGGAAGAAGGGGGTTGG + Intronic
1098558957 12:71851174-71851196 TAGAGCAGGAGGAAGGGGGAGGG + Intronic
1098572499 12:72004718-72004740 AAAAGCAGAAAGAAGATGGTTGG + Intronic
1098910354 12:76202877-76202899 AAGTGCAAGAAGCAGATGGCAGG + Intergenic
1099638167 12:85243762-85243784 AAAAGTAGGAAGAAGGTGGGAGG + Intronic
1099734225 12:86547307-86547329 AAGAGCAGGAAGAGGAAGGGGGG - Intronic
1100001044 12:89835544-89835566 CAGAGCTTGAAGAAGGAGGCAGG + Intergenic
1100341586 12:93684465-93684487 CAGAGCAGGAGGTAAGTGGCAGG - Intronic
1100434914 12:94562419-94562441 AAGAGAAGGTAGAGGGTTGCAGG - Intergenic
1100523747 12:95400815-95400837 AAGAGAAGGCAGAGGGTGGTTGG - Intergenic
1100719152 12:97338854-97338876 GAGAGCAGGAAGAAGCTGCAAGG + Intergenic
1100764277 12:97846212-97846234 AAGAGCAGGCAGAAGGGCTCTGG - Intergenic
1101578453 12:106019752-106019774 AAGAGCAGGAAGCAGGAGTGTGG - Intergenic
1102428799 12:112865436-112865458 AACATGAGGAAGAACGTGGCTGG + Exonic
1102493371 12:113302678-113302700 ACGAGGAGGATGCAGGTGGCTGG - Intronic
1102521625 12:113480739-113480761 AAGAGCTGGAAGCGGGGGGCGGG + Intergenic
1102546980 12:113664388-113664410 AGCAGAAGAAAGAAGGTGGCAGG + Intergenic
1102950542 12:117028000-117028022 AAGAGCACAAAGATGGTGACAGG - Intronic
1103010689 12:117456140-117456162 AAAAGAAGGAAGAAGGAGCCAGG + Exonic
1103195785 12:119042674-119042696 AAGGGCAGGAAGAGGGAGGAAGG + Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103583911 12:121936919-121936941 AAGAGCAGGTGGCAGGAGGCAGG + Intronic
1103613025 12:122135558-122135580 AAGAGCCGGGAGACGGGGGCAGG - Exonic
1103692700 12:122788385-122788407 AATAGCAGCAAGAGGGTGGGTGG - Intronic
1103948014 12:124537823-124537845 AAGGGCAGGAAAGAAGTGGCTGG - Intronic
1104035520 12:125094668-125094690 GAGAGCAGGCAGAAGGAGGTGGG - Intronic
1104340941 12:127947791-127947813 ATGGGCAGGAAGAACGTGTCTGG + Intergenic
1104384288 12:128336797-128336819 AAAGACAGGAAGAAGATGGCAGG - Intronic
1104420152 12:128628231-128628253 AAGAGCAGGGAGGAGATGACCGG - Intronic
1104463629 12:128973573-128973595 TAGAGCAGGAGGAAGTTGGAGGG - Intronic
1104685881 12:130783617-130783639 AAGAGGAGGCTGAGGGTGGCGGG + Intergenic
1104792096 12:131489747-131489769 AAGAGAAGGGAGAATGGGGCAGG + Intergenic
1105340017 13:19513884-19513906 AAGAGCATGAAGGTGGTGGAGGG - Intronic
1105575809 13:21650568-21650590 AAGAGGAAGAAGGAGGGGGCTGG - Intergenic
1105601122 13:21888063-21888085 AAGAGCATCAAGAAAGTGGATGG - Intergenic
1105872189 13:24515202-24515224 AAGATGAGGGTGAAGGTGGCAGG + Intergenic
1105948353 13:25208668-25208690 AAGGGAAGGAAGAAGGTGGCGGG + Intergenic
1106679789 13:31998288-31998310 GAGAGCAGGAAGTAGGTGAGTGG + Intergenic
1107175039 13:37390245-37390267 AAGAGAAGGTAGAAAGTGGTTGG + Intergenic
1107315464 13:39126923-39126945 ATGTGAAGGAAAAAGGTGGCAGG + Intergenic
1108274018 13:48789764-48789786 GAGGGCAGGAAGAAGGAGGAAGG + Intergenic
1108291717 13:48968307-48968329 CAGAGGAGGAAGACGGTGACTGG + Intergenic
1108524253 13:51272396-51272418 AGGAGCAGGAGGGAGATGGCCGG + Intronic
1108854630 13:54777249-54777271 GAGAGAAGGAAGAAGGAGGAAGG + Intergenic
1108862047 13:54872778-54872800 TAGAGCTGGAAGTAGGTGGGTGG + Intergenic
1110796618 13:79645801-79645823 AATAGAAGCAAGCAGGTGGCGGG - Intergenic
1110885746 13:80632515-80632537 ATCAGCAGGAAAAAGGTAGCAGG - Intergenic
1111078247 13:83266750-83266772 AACAGCACAAAGAAGGTGGTGGG - Intergenic
1111685789 13:91499211-91499233 AAGAGCAGGAAGAGGGTGTTGGG + Intronic
1112018916 13:95354594-95354616 CAGAGCAGGTAGAATGTGGAAGG - Intergenic
1112105095 13:96231499-96231521 CAGAGCAGGAGGAAGGCGGGAGG + Intronic
1112124285 13:96447558-96447580 AAGGGCAAGAAGAAGGCAGCAGG - Intronic
1112154684 13:96804345-96804367 AAGAGGAGGAGGGAGGTGCCTGG + Intronic
1112158561 13:96844951-96844973 AAGAGCAGGATGGGAGTGGCAGG - Intergenic
1112237718 13:97651187-97651209 AAGGGCAAGAAGAAGAGGGCAGG + Intergenic
1112314678 13:98350846-98350868 ACCAGCAGGAAGGAGGTGGCTGG - Intronic
1112536550 13:100262698-100262720 AAAAGAAGGAAGAAGGAGGAGGG - Intronic
1112716276 13:102189853-102189875 GAGAGCAGGGAGGAGGTGCCAGG + Intronic
1113222427 13:108120419-108120441 AAATGCAAGAAGAAAGTGGCAGG - Intergenic
1113235179 13:108264703-108264725 AAGAGTAGGAAGAAGGGTGGAGG - Intronic
1113757642 13:112824600-112824622 AAGAGCAGGAAGGAGGGGTGTGG - Intronic
1114407218 14:22468133-22468155 AACATCAAGGAGAAGGTGGCTGG + Intergenic
1114528516 14:23380909-23380931 GAGAACAGGAAGCAGGAGGCAGG - Intergenic
1114598547 14:23935006-23935028 AAGAGAAAGGAGAAGGTGCCAGG + Intergenic
1115977129 14:39009044-39009066 ATGAGCAGCAAGAAGGTGGAAGG + Intergenic
1115989637 14:39139114-39139136 AATATTAAGAAGAAGGTGGCTGG + Intergenic
1116019865 14:39447293-39447315 ATGTGCAGGAAGAAGGTTCCAGG + Intergenic
1117144306 14:52821572-52821594 AATAGCCAGATGAAGGTGGCGGG + Intergenic
1117496668 14:56312492-56312514 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1117991362 14:61436898-61436920 TAGAGCAGGGAGAAGGTACCAGG - Intronic
1118033470 14:61840674-61840696 AACAGCAGTGACAAGGTGGCTGG + Intergenic
1118795779 14:69142279-69142301 CAGAGCATGAATAAAGTGGCAGG + Intronic
1118964869 14:70571390-70571412 AAGTGCAGAGAGAAGGTGGCGGG - Intergenic
1119018587 14:71085298-71085320 AAGAACAAGAAACAGGTGGCTGG - Intronic
1119159045 14:72438047-72438069 AGGAGCAGGAAAAAGGGGGGTGG + Intronic
1119252851 14:73171708-73171730 AAGAGCAGGTAGCAGGTAACTGG + Intronic
1119439062 14:74616074-74616096 ATGGGCAGTAAGTAGGTGGCAGG - Intergenic
1119644130 14:76336412-76336434 GAGAGCAGGCAGCAGATGGCTGG + Intronic
1119781096 14:77277393-77277415 AATGGCAGGACTAAGGTGGCTGG - Exonic
1119894378 14:78207307-78207329 GTGCGCAGGAAGAAGGTGGGTGG - Intergenic
1119996833 14:79262445-79262467 AAGAGGAGGAGGAAGGAGGAAGG + Intronic
1120369728 14:83617660-83617682 TGGAGCAGGAGGAAGGGGGCTGG + Intergenic
1120671024 14:87362957-87362979 AATAGCAGGAAGAAGATGAAAGG + Intergenic
1120915967 14:89710738-89710760 AAGAGAAGAAAGATGGAGGCTGG - Intergenic
1120981963 14:90298276-90298298 ACCAGCAGGAACGAGGTGGCTGG - Exonic
1121688589 14:95858104-95858126 GAGAGCAGGGAGAAGGTGGGTGG + Intergenic
1122102445 14:99424329-99424351 AAGAGCAGGAAGAACGAAGCAGG + Intronic
1122169413 14:99859678-99859700 AAGCACAGGAAGTAAGTGGCTGG + Intronic
1122227336 14:100287365-100287387 AAGGGCAGAGAGAAGGGGGCAGG - Intergenic
1122811207 14:104290238-104290260 AGCAGCAGGAAGCAGGAGGCAGG - Intergenic
1122937313 14:104966226-104966248 CGGAGCAGTAGGAAGGTGGCGGG - Intronic
1123890453 15:24773198-24773220 CAGAGGGGGAAGACGGTGGCCGG + Intergenic
1124572657 15:30879831-30879853 AAGATGGGAAAGAAGGTGGCAGG + Intergenic
1125608895 15:40957810-40957832 AGGAGGAGGCAGCAGGTGGCAGG + Intergenic
1127296232 15:57610972-57610994 AAGACCAAGAAGAAGGTGGACGG + Intronic
1128434878 15:67636946-67636968 AAAAGCAGGCAGAAGTTGGAAGG + Intronic
1128750153 15:70143066-70143088 AGGGGCAGGAAGGAGGTGGGAGG + Intergenic
1129175589 15:73837699-73837721 AAGGCCAGGAGGAGGGTGGCAGG + Intergenic
1129801438 15:78418059-78418081 AAGAGCAGGCAGAATGTGTAGGG + Intergenic
1130271294 15:82450304-82450326 TAGAGAAGGAAGAAAGTGGAGGG + Intergenic
1130284139 15:82541301-82541323 CAGAGTTGGAAGAAGGGGGCAGG - Intronic
1130360873 15:83184744-83184766 AAGAGCAGGAAGAAGGCAAATGG + Intronic
1130489040 15:84417143-84417165 TAGAGAAGGAAGAAAGTGGAGGG - Intergenic
1130871237 15:87973849-87973871 AAGAGCAAAATGAAGGTGGCAGG - Intronic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131150614 15:90045311-90045333 AACAGCAGAAAGAAGGAAGCTGG + Intronic
1131364135 15:91823441-91823463 CAGAGCAGGAGCAAGGTGGGTGG - Intergenic
1131569959 15:93524648-93524670 AAGAGCAGGTGGATGGTGGCCGG - Intergenic
1131778276 15:95826077-95826099 AAGAGAAGGAATAACTTGGCAGG - Intergenic
1132185338 15:99798349-99798371 AAGGGGAGGAAGAAGGAGGGAGG + Intergenic
1132200166 15:99947465-99947487 AAGAGCATGAAGATGGAGGAGGG - Intergenic
1132267883 15:100492973-100492995 AAGAGCACAAAGAAGGGGACGGG - Intronic
1133089965 16:3396461-3396483 CAGAGCAGGAAGCAGCTTGCTGG - Intronic
1133214526 16:4283547-4283569 AAGGGTAGGAAGAAGGGGCCAGG - Intergenic
1133310010 16:4839132-4839154 AAGGGCGGGGAGAAGATGGCAGG + Intronic
1133433274 16:5757181-5757203 AAGAGCATGAAGAGCGTGGCGGG + Intergenic
1133484813 16:6209604-6209626 TAGGGCAGGAGGATGGTGGCAGG - Intronic
1133713828 16:8427973-8427995 AAAAAAAGGAAGAGGGTGGCTGG + Intergenic
1133816323 16:9200037-9200059 AAAAGAAGGAAGAAGGAGGAAGG - Intergenic
1134041715 16:11073701-11073723 TGGAGCAGGAGGAAGGAGGCTGG - Intronic
1134112399 16:11523859-11523881 AGGAGCAGGGAGCAGGTGGGTGG - Intergenic
1134287185 16:12872041-12872063 AAGAGGAAGAAGAAGGAGGAGGG - Intergenic
1134345081 16:13383154-13383176 AAAAGTAGAAAGAAGGTGGTGGG + Intergenic
1134503722 16:14789217-14789239 AGGAGAAGGAAGCAGATGGCAGG - Intronic
1134567579 16:15264659-15264681 GAGAGAAGGAAGAAGGAGACAGG - Intergenic
1134576850 16:15339682-15339704 AGGAGAAGGAAGCAGATGGCAGG + Intergenic
1134725592 16:16416807-16416829 AGGAGAAGGAAGCAGATGGCAGG - Intergenic
1134734909 16:16492011-16492033 GAGAGAAGGAAGAAGGAGACAGG + Intergenic
1134814882 16:17197630-17197652 AAAAGCAGGCAGAACGTGGAAGG + Intronic
1134904850 16:17971580-17971602 AAGAAGAGGAAGAAAGAGGCAGG + Intergenic
1134932613 16:18220208-18220230 GAGAGAAGGAAGAAGGAGACAGG - Intergenic
1134941842 16:18295051-18295073 AGGAGAAGGAAGCAGATGGCAGG + Intergenic
1135435018 16:22420909-22420931 AAGAGCAGGAGGGAGGACGCGGG + Intronic
1135777646 16:25270970-25270992 AAGAAAAGGAAGAAGCTAGCAGG - Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136076332 16:27819881-27819903 AAGATCATGAAGAAAGTTGCTGG + Intronic
1136452170 16:30359609-30359631 AAGAGCAAGAACAAGGAGGAGGG + Intronic
1136544851 16:30949164-30949186 ACGAGCAGGATGCAGGCGGCGGG - Exonic
1137402749 16:48166580-48166602 AAAAGCAGAATGAAGATGGCTGG + Intergenic
1138202131 16:55097142-55097164 AAGAGGAAGAAGAAGGAGTCTGG + Intergenic
1139206799 16:65036914-65036936 AAAGGCAGAAAGAAGATGGCAGG + Intronic
1139375770 16:66495450-66495472 AAGGGCAGGAGGGAGGTGGGAGG - Intronic
1139375795 16:66495537-66495559 AAGGGCAGGAGGGAGGTGGGAGG - Intronic
1139485268 16:67252664-67252686 AGGAAGAGGAAGAAGGTGCCTGG - Exonic
1139605167 16:68013104-68013126 AAGAGGAGGAAGAAAGAGGCTGG + Intronic
1139688091 16:68619998-68620020 AAGAGCAGGAGGAAGATGTGAGG - Intergenic
1140221998 16:73050312-73050334 AAGTGCAGGAGGCAGGTTGCAGG - Intronic
1140270457 16:73460825-73460847 AGGAGGAGCAAGAAAGTGGCAGG - Intergenic
1140376116 16:74446665-74446687 TAGAGGAGGAAGAAGGAGGAGGG - Intergenic
1140501343 16:75436069-75436091 CAGAAGAGGAAGAGGGTGGCAGG - Intronic
1140596854 16:76425966-76425988 AAGACCAGGAAGAGGCTGTCAGG + Intronic
1140704610 16:77615041-77615063 AGGAGGAGGAGGAAGGTGCCAGG + Intergenic
1141294134 16:82751037-82751059 AAGATCAGGAAGGAGGAGGATGG - Intronic
1141525963 16:84612047-84612069 AAGAGCACCAAGAAGATGGAAGG - Intronic
1141845119 16:86603377-86603399 AGGAGGAGGAAGAAGGAGGAGGG - Intergenic
1142324895 16:89408403-89408425 CAGAGGAGGAAGAGGATGGCAGG + Intronic
1142553255 17:753479-753501 GAGATGAGGAAGAAGGAGGCTGG + Intronic
1142957174 17:3529981-3530003 AAGGGCAGGGAGAAGAGGGCTGG - Intronic
1143326030 17:6099011-6099033 CTGAGCAGGAACCAGGTGGCAGG + Intronic
1143374428 17:6458902-6458924 AAGGACAGGAAGAAGATGGAAGG - Intronic
1144655002 17:17029663-17029685 AAGAGGAGGAAGGAGGTAGAGGG + Intergenic
1145722893 17:27089694-27089716 CAGAGCAGTAAGAGGGTGGCCGG + Intergenic
1146003687 17:29147568-29147590 AAGAGGAGGAGAAAGGAGGCTGG + Intronic
1146308217 17:31746848-31746870 CCAAGCAGGAAGAAGGGGGCTGG - Intergenic
1146542368 17:33708518-33708540 AAGAGAAGAAAGAAGGAGACAGG - Intronic
1146561107 17:33871425-33871447 ATGAGCAGGGAGAAGGAGGTGGG - Intronic
1147498812 17:40942527-40942549 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147498863 17:40942820-40942842 AAGAGAAGGAAGAAGGAAGAAGG - Intergenic
1147559984 17:41502820-41502842 GCAAGCAGGAAGAAGGTGGTGGG + Intronic
1147562580 17:41518289-41518311 AAGAGAGGGGAGCAGGTGGCTGG - Intronic
1148018827 17:44540281-44540303 AAGAGCACAAAGAAGGGGGCTGG + Intergenic
1148046184 17:44746521-44746543 AAGAGAAGGACGGAGATGGCTGG + Intronic
1148792806 17:50183194-50183216 AGGAGCAGGCAGAAGGTGAAGGG + Intergenic
1149637912 17:58185102-58185124 AAGGGCAAGAAGAAGATCGCGGG - Intergenic
1149667517 17:58376015-58376037 GAGGGCAGGAAGGAGGTGTCTGG + Intronic
1150204280 17:63389974-63389996 AAGGACAGGATGAAGGTGTCTGG - Intronic
1150678249 17:67263364-67263386 GAGACAAGGAAGAAAGTGGCCGG - Intergenic
1150981549 17:70147973-70147995 AAGAGCAAGAAGGAGGTGCCGGG + Intergenic
1151130679 17:71893520-71893542 AAGAGGAGGAAGCTGGAGGCTGG - Intergenic
1151214270 17:72567198-72567220 AGGGGCAGGAGGAAGATGGCAGG - Intergenic
1151352125 17:73537927-73537949 AAGAGGATGAAGAGGGTGGAGGG + Intronic
1151874807 17:76861561-76861583 AGGAGCAGGAGGAAGGCGGTGGG + Intergenic
1152102781 17:78312645-78312667 AAGATCAGCAAGATGCTGGCTGG - Intergenic
1152318234 17:79593243-79593265 AAGAGCTGGGAGAAGGAGGAAGG - Intergenic
1152362253 17:79838095-79838117 AAGGGCAGGAAGAAAGGGGAGGG + Intronic
1152598416 17:81249392-81249414 AAGAGGAGGATGAAGGAGGGAGG + Intronic
1152598424 17:81249416-81249438 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1152598447 17:81249488-81249510 AAGAGGAGGGAGAAGGAGGGAGG + Intronic
1152640721 17:81448180-81448202 CAGAGCAGGAGGCAGGCGGCAGG - Intronic
1153235937 18:2987742-2987764 TATAGATGGAAGAAGGTGGCAGG - Intronic
1154172926 18:12063780-12063802 TAGAGAAGGGAGCAGGTGGCCGG + Intergenic
1154193008 18:12245933-12245955 AAGGGCAGGAAGGAGGTTGGTGG - Intergenic
1154492373 18:14931998-14932020 CAGAGCAGGAGGGAGGTGGGAGG - Intergenic
1155442010 18:25871880-25871902 AAGAGAAGGAAGAAGGAAGCGGG + Intergenic
1156090820 18:33466631-33466653 CAGAGCAGGAAAAAGGGGGGTGG - Intergenic
1156453086 18:37277584-37277606 AAGAGCTGGGAGAAGAGGGCTGG + Intronic
1156921881 18:42532063-42532085 AACAGCATTAAGAGGGTGGCTGG + Intergenic
1157128034 18:44976198-44976220 TGGAGCAGGAAGCAGGCGGCAGG + Intronic
1157289231 18:46398310-46398332 CAGGGCAGGAAGAAGGAAGCAGG + Intronic
1157332895 18:46716427-46716449 AAGCCCAGGAAGAAGGGTGCAGG + Intronic
1157358031 18:46953187-46953209 AAGAAAAGGAGGAAGGTGCCGGG - Intronic
1157419255 18:47531629-47531651 AAGAGAAGGAAGATGGGGGTGGG + Intergenic
1157583177 18:48785106-48785128 AAGAGAAGGAAGAAGGAAGATGG - Intronic
1157873953 18:51254449-51254471 GAAACCAGGAAGAAGGTGGAAGG - Intergenic
1159586659 18:70288987-70289009 AGGAGGAGGAGGAAGGAGGCGGG + Exonic
1159853821 18:73560210-73560232 ACGAGAAGGTGGAAGGTGGCAGG - Intergenic
1159897173 18:74008406-74008428 AAGACCAGGAACAAGCTGGCAGG - Intergenic
1159900375 18:74039483-74039505 AGGAGCAGGAGGAAGGGGGAGGG - Intergenic
1159935753 18:74366081-74366103 AAGAGCAGGAAGGAAGTTCCAGG - Intergenic
1159940383 18:74402489-74402511 AAGAGAAGAAAGAAGGGGGAAGG + Intergenic
1160011190 18:75108050-75108072 AGGAGAAGGAAGACAGTGGCTGG - Intergenic
1160335241 18:78032862-78032884 AAGAGGAGGAGGAAGGGGGTAGG - Intergenic
1161421295 19:4177146-4177168 AAGAGCAGGAAGAGGCTTGATGG + Intronic
1161503312 19:4629733-4629755 ATAAGAAGGAAGAAGGAGGCTGG - Intergenic
1161594438 19:5143985-5144007 AAGCGGATGAAGAAGGTGTCAGG + Exonic
1162049664 19:8025293-8025315 AAGAATAGGAAGAAGGGGCCGGG - Intronic
1162543109 19:11310223-11310245 AAGTGCAGGAAGAAGGAAGAAGG + Intronic
1162757908 19:12871255-12871277 AAGAGCACGGGAAAGGTGGCGGG + Intronic
1162791425 19:13065074-13065096 AGGAGGAGGAAGGAGGTGGGTGG - Intronic
1162836718 19:13324202-13324224 AAGAGCAGGAAGGTGGTTCCTGG + Intronic
1162959297 19:14116992-14117014 AAGGGCAGGAGAAAGATGGCGGG + Intronic
1163112609 19:15170556-15170578 AAGAGCAGGAAGCAGAGGGCGGG + Intronic
1163628697 19:18405290-18405312 AAAACCAGGAAGGAGGAGGCTGG - Intergenic
1164183056 19:22836497-22836519 AAGATTAGAAAGAAGGTGGTAGG + Intergenic
1164306600 19:24009368-24009390 AAGATTAGAAAGAAGGTGGGAGG - Intergenic
1164847289 19:31444228-31444250 AAGAAGAAGAAGAAGGTGGAAGG + Intergenic
1165350437 19:35272308-35272330 AAGCTGGGGAAGAAGGTGGCGGG + Intronic
1165395896 19:35563442-35563464 ATGAGCAAGAAGAAGAAGGCGGG - Exonic
1165610390 19:37146584-37146606 AGGAGCAAGAGGAATGTGGCAGG - Intronic
1165682442 19:37789471-37789493 AAGAAGAAGAAGAAGATGGCCGG + Intronic
1166293348 19:41877338-41877360 AAGAGGAGGAAGATGGTGGCAGG - Exonic
1166992966 19:46704334-46704356 AAGAGGAGGAAGAGGATGACGGG + Exonic
1167024399 19:46904714-46904736 AACAGCAGGACAGAGGTGGCGGG + Intergenic
1167039805 19:47016944-47016966 AACAGTAAGAAGAAGATGGCTGG + Intergenic
1167072243 19:47227983-47228005 AGAAGCAGGAAGACGGAGGCTGG - Intronic
1167959500 19:53094973-53094995 AAGGGCTGGAAGAGGGCGGCGGG - Intronic
1167967320 19:53158253-53158275 ACGAGGAGGAGGGAGGTGGCGGG + Intronic
1168323091 19:55521845-55521867 CAGAGCTGGCAGAAGGTGGCAGG - Intergenic
1168535180 19:57163114-57163136 TGGAGAAGGAAGAAGTTGGCCGG - Intronic
1168599655 19:57707681-57707703 AAGAGCAGGGGGAAGGAGTCAGG - Intronic
925055425 2:853518-853540 AAGAGAAGGGTGAAGGTGGTGGG - Intergenic
925080442 2:1059209-1059231 AAGAGATGGCAGAAGGTGCCAGG - Intronic
925083294 2:1087060-1087082 AGGAGCAGAAGGAGGGTGGCAGG + Intronic
926096778 2:10086414-10086436 TAAAGCAGGAAGAAGTAGGCAGG - Intergenic
926137456 2:10346855-10346877 GAGAGAAGGAAGAGGGTGGGGGG - Intronic
926266882 2:11331005-11331027 AGGAGCAGAAAGAAGGAGGGAGG + Intronic
926349430 2:11981928-11981950 AAGAGAAGGAAGCAGGTGGGAGG + Intergenic
926592456 2:14754060-14754082 TGTAGCAGGAAGAAGGTAGCAGG - Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926726927 2:16005671-16005693 AAGAGGAGAAGGAGGGTGGCTGG - Intergenic
927014895 2:18949556-18949578 TGGAGCAGGAGGAAGGTGGCAGG - Intergenic
927056793 2:19372992-19373014 AAGGGGAAGAAGAAGGTGGTTGG - Intergenic
927096232 2:19749630-19749652 TAAAGCAGGAAGCAGGAGGCAGG - Intergenic
927266537 2:21159190-21159212 GGGAGCAGGAAGAAGGCAGCAGG + Intergenic
927683428 2:25154947-25154969 AAGGGCAGGAAGCAGGATGCAGG + Exonic
927842240 2:26453151-26453173 AAGAGTGGGAAGAAGGGGGATGG - Intronic
928925938 2:36579553-36579575 TGGAGCAGGAGGAAGGGGGCTGG - Intronic
929116500 2:38448862-38448884 AAGAAGAGGAAGCAGGTGGTGGG + Intergenic
929474081 2:42227685-42227707 CAGAGGAGGAGGAAGGGGGCGGG - Intronic
929570002 2:43016715-43016737 GAGAGAAGGGAGAAGGTGCCAGG - Intergenic
930751983 2:54943235-54943257 AAGAGAGGGAAGAAGGTGAATGG - Intronic
930997443 2:57737503-57737525 CAGAGCAGAAAGAAGGAGACTGG + Intergenic
931108372 2:59082931-59082953 AAGAACAGGGACAAGGTGGTAGG + Intergenic
931331327 2:61287543-61287565 AAGAGGAGGAGGAAGGTGAGGGG - Intronic
931533341 2:63242850-63242872 AAAAGGAGGAAAAAGGAGGCAGG - Intronic
931590131 2:63873984-63874006 AACAGCAGGAAGAAGGAAGATGG + Intronic
931884377 2:66599769-66599791 AAGAGCAAGGAGAGGGTGGAAGG - Intergenic
932330173 2:70894292-70894314 AAGGGCAGGGAGAGGATGGCTGG - Intergenic
932623228 2:73279020-73279042 AAGGTCAGGAAGAAGGTTGTTGG + Intronic
933294272 2:80471828-80471850 AAATGCATAAAGAAGGTGGCCGG + Intronic
933588801 2:84208840-84208862 AAAAGCAGGTAGAAGTTGGAAGG + Intergenic
934215693 2:90029555-90029577 CATAGCAGGACGAAGGTGCCAGG - Intergenic
934862331 2:97774677-97774699 GTGAGCAGGAAGAGGCTGGCAGG + Intronic
935081297 2:99798102-99798124 AACAATAGGAAAAAGGTGGCTGG + Intronic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
936081326 2:109434558-109434580 AGAAGCAGGAAGAGGGTGGAAGG - Intronic
936146554 2:109984443-109984465 AGGAGCAAGAAGCTGGTGGCGGG - Intergenic
936198136 2:110387036-110387058 AGGAGCAAGAAGCTGGTGGCGGG + Intergenic
936401762 2:112169943-112169965 AAGAAAAGGAAGAAGGGGCCAGG + Intronic
936542529 2:113363795-113363817 AAGTGCAGGGAGCAGGTGGGAGG - Intergenic
937096732 2:119240562-119240584 AAGAGCAGACAGGAGCTGGCAGG + Intronic
937102632 2:119283384-119283406 CAAAGCAGGAAGGAGGAGGCAGG - Intergenic
937140042 2:119592132-119592154 AAGAGGAGAAAGAGGGAGGCTGG + Intronic
937234652 2:120423395-120423417 AAGAGGAGGAGGGAGGTGCCAGG - Intergenic
937814062 2:126231666-126231688 AAGAGAAGGAAGAGGGAGGGTGG - Intergenic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938139913 2:128787055-128787077 AACAGCAGGAGGCAGGTGCCTGG - Intergenic
938225753 2:129614714-129614736 AAGAACAGGAAGGAGGAGGGGGG + Intergenic
938263772 2:129912161-129912183 AAGAGCAGCATGGAGGAGGCAGG + Intergenic
939163664 2:138617354-138617376 AAGACCAGACAGAATGTGGCAGG - Intergenic
939178541 2:138779929-138779951 TAAAGTAGGCAGAAGGTGGCCGG - Intronic
939257520 2:139763814-139763836 AAGAGCAGGCAGAAGGGGTGAGG + Intergenic
940067869 2:149649945-149649967 AAGAGCAGGATGCATCTGGCTGG + Intergenic
940780180 2:157924994-157925016 AAGAAAAGGAAGAAGCTGGTGGG - Intronic
940904480 2:159156923-159156945 AAGAGCCTGATGAATGTGGCTGG + Intronic
940972170 2:159906014-159906036 AAAAGCAGGCAGAAGTTGGAAGG + Intergenic
941216592 2:162717459-162717481 AAGAGCAGTGAGCAGGAGGCTGG - Intronic
941325008 2:164103530-164103552 AAGACAAGGAAGAAGGGGGATGG + Intergenic
941474873 2:165938711-165938733 AAAGGCAGGAAGAAGGAGGGAGG + Intronic
942337810 2:174909268-174909290 AAGTGAAGGAAGAAGGTTGGAGG - Intronic
942358454 2:175145390-175145412 AGGAGCAGGAAGAGAGTTGCAGG - Intronic
942415568 2:175755445-175755467 AAGTGCAGGAAGTAAGAGGCTGG - Intergenic
942570965 2:177313843-177313865 AAGAGCTGGAAGAAGGCTGAGGG - Intronic
942783675 2:179675631-179675653 AAGAGCAGGAGGAAAAGGGCAGG + Intronic
942964958 2:181880914-181880936 AAAAGCAGGAAGAATGTGCAGGG - Intergenic
943347338 2:186754940-186754962 AACAGAAGGAAGATGGAGGCTGG + Intronic
943474375 2:188336575-188336597 AAAACAAGGAAGAATGTGGCTGG + Intronic
943636258 2:190310030-190310052 AAAAGCAGGCAGAAGTTGGAAGG + Intronic
943766388 2:191666874-191666896 AAGAGCAGTAAGAAGATAACTGG - Intergenic
944016923 2:195051713-195051735 AAGAGTAGGGAAAAGGTGCCAGG - Intergenic
944022716 2:195125725-195125747 GAGAGCAGGTTGATGGTGGCAGG - Intergenic
944022843 2:195126240-195126262 GAGAGCAGGTTGATGGTGGCAGG + Intergenic
944176889 2:196840031-196840053 AAGAGTAGGAAGAAGGTAATCGG - Exonic
944300011 2:198112899-198112921 ATTACCAGGAAGAAGGTGGGTGG + Intronic
944682817 2:202092299-202092321 ATGTGCAGGAAGAGGGTGGTAGG - Intronic
945037910 2:205720024-205720046 AAAAGGAGGCAGAAGCTGGCTGG - Intronic
946105664 2:217367499-217367521 AACAGCAGGAAGAATGTAGCTGG + Intronic
946220627 2:218222990-218223012 TAGGGCAGGCAGCAGGTGGCAGG - Intronic
946308553 2:218870319-218870341 GAGAGCAGGAAGAAGGAGCTGGG - Intronic
946458047 2:219845118-219845140 AATAGGAGGAAGAAAGAGGCTGG - Intergenic
946526323 2:220524616-220524638 AAGAGAAGGGAGGAGGTGCCAGG + Intergenic
946601129 2:221361506-221361528 GAGAGCAGGAAGAACGAGGTGGG + Intergenic
946939962 2:224760219-224760241 AAGAGTAGGTAGCAGGTGACAGG + Intergenic
948056529 2:235012820-235012842 AGGAGCAGGAGGAAGGAGACAGG + Intronic
948079220 2:235191720-235191742 AAGAGCAGGAAGGAGGTAATGGG - Intergenic
948170209 2:235895354-235895376 TAGAGCAGGAAGCAGGTGAGAGG - Intronic
948702546 2:239769406-239769428 AAGACCATGAAGAAGGTGAGTGG + Intronic
948751817 2:240137471-240137493 AAGAGGAGGGAGAAGGTTGGAGG + Intergenic
948770230 2:240248056-240248078 AAGAGCATTTATAAGGTGGCTGG - Intergenic
948797427 2:240412136-240412158 AGGATCCGGGAGAAGGTGGCTGG - Intergenic
1168805531 20:670310-670332 CAGAGCAGAAAGTAGGAGGCCGG - Intronic
1168837345 20:886023-886045 GAGAGGAGGAAGATGGGGGCAGG + Intronic
1169928272 20:10805759-10805781 AAGAGCAGCCAGAAGCAGGCAGG - Intergenic
1170034311 20:11973852-11973874 AAGAGGAGGAAGAAGGAGGAAGG + Intergenic
1170248332 20:14249416-14249438 AAAACCAAGGAGAAGGTGGCAGG + Intronic
1170409215 20:16070255-16070277 AAGAGCAGGAAGAGGTGGGGAGG - Intergenic
1170823238 20:19771865-19771887 AAGAGGAGGCAGGAGGAGGCAGG - Intergenic
1170987091 20:21268455-21268477 AAGAGCAGGATCAAGTTGACTGG - Intergenic
1171209962 20:23309423-23309445 AGGAGCAGGAAGAGGGAGACAGG - Intergenic
1172292131 20:33784114-33784136 AAGAGGAGGGAGAAGGGTGCTGG - Intronic
1172365242 20:34344052-34344074 AAAAAGAAGAAGAAGGTGGCAGG - Intergenic
1172474086 20:35224482-35224504 AAGAAAAGGAAGGAGTTGGCTGG - Intergenic
1172635953 20:36410073-36410095 AGGAACAGGAACAAGGTGGATGG - Intronic
1172913510 20:38427467-38427489 AAGGGCAGGAGGATGGTGCCAGG + Intergenic
1173019909 20:39258327-39258349 AAGATGAGAAACAAGGTGGCAGG - Intergenic
1173165334 20:40683549-40683571 AAAAGGAGGATGACGGTGGCGGG + Intergenic
1173198648 20:40937771-40937793 AAGAAAAGGAAGAAGGGGCCAGG + Intergenic
1173255241 20:41390064-41390086 AAGGGCAGGAGGAAGGTAGGAGG + Intergenic
1173413579 20:42837071-42837093 ATGGGCAGGAAGAAGGAGACAGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1174076132 20:47938525-47938547 AAGAGGATCAAGAAGGAGGCAGG - Intergenic
1174406883 20:50308700-50308722 GAGAGGAGGAAGTAGGGGGCTGG + Intergenic
1174870065 20:54173815-54173837 AGGGGCTGGAAGAGGGTGGCCGG + Exonic
1174992980 20:55534186-55534208 AAGAAAAGGAAGAAGGTGGCCGG + Intergenic
1175895442 20:62333806-62333828 ATGAGCCAGAGGAAGGTGGCGGG + Intronic
1176016268 20:62934875-62934897 AAGGGTAGCAAGAAAGTGGCCGG - Intronic
1176071019 20:63226526-63226548 AAGAGGAGGAAAGAGGTGGGAGG - Intergenic
1176734190 21:10527879-10527901 AAGAGCATGAAGGTGGTGGAGGG + Intronic
1177115963 21:17087718-17087740 AGGAGGAGGAAGAAGATGTCAGG + Intergenic
1177655322 21:24009516-24009538 AAGAGCAAGAATTAGGTGGATGG + Intergenic
1178612759 21:34099660-34099682 AAGAGCAGAAAGAAGGTAGAGGG - Exonic
1178900797 21:36596973-36596995 AAGAGCTGGAGGGCGGTGGCAGG + Intergenic
1178924313 21:36762263-36762285 AAGAGCTGGAAGTAGCTGGAGGG + Intronic
1179125073 21:38583265-38583287 TGGGGCAGGAAGAAGGAGGCAGG + Intronic
1179170725 21:38970802-38970824 AATATTAGGAAGATGGTGGCTGG - Intergenic
1179396307 21:41043489-41043511 CAGAGCAGAAGGAAGGTGGTGGG + Intergenic
1179586157 21:42375365-42375387 AGGAGCAGGGAGAAAGTGGGAGG - Intronic
1179949212 21:44700258-44700280 GAGAGCAGGAAGAAAAGGGCTGG + Intronic
1180941657 22:19663599-19663621 CAGAGCAGGAAGCATGTGGCTGG + Intergenic
1182072761 22:27475188-27475210 AAGCTCAGGGAGAAGGAGGCTGG + Intergenic
1182189769 22:28446570-28446592 AAGAGCGGGAACAAGATGGGGGG - Intronic
1182741073 22:32567884-32567906 AAGAGAAGGAGGAGGGAGGCAGG - Intronic
1183241696 22:36662414-36662436 AAGAGAAGGAAGCAGGGGTCAGG - Intronic
1183342863 22:37291581-37291603 TGGAGCAGGAAGGAGCTGGCAGG + Intronic
1183361990 22:37387633-37387655 CAGCCCAGGAAGAAGGTGGCAGG - Intronic
1183432507 22:37774296-37774318 TAGGGCAGGAAGAGGGTGGCAGG - Exonic
1183692145 22:39396492-39396514 AAGAGAAGGAAGGAGGTGGCCGG - Intergenic
1184234811 22:43177487-43177509 ATGAGCAGGAAAAAGGTGGAAGG + Intronic
1184306209 22:43604016-43604038 CAGAGCAGGATGAAGGTGGTGGG - Intronic
1184509343 22:44924038-44924060 AAGAGGAGGAAGAAGAGGGAGGG + Intronic
1184733020 22:46381378-46381400 AATGGCAGGAAGAAGGAGGGCGG + Intronic
1184746348 22:46458384-46458406 CAGGGCAGGACGAGGGTGGCAGG + Intronic
1184782352 22:46655680-46655702 AGCAGCAGGAAGGAGGTGGCAGG - Intronic
1185132008 22:49044622-49044644 AGGAGCAGGACAAAGGTGGAAGG - Intergenic
1185181378 22:49365455-49365477 AGGAGCAGGAGGATGGTGGGAGG - Intergenic
1185412844 22:50695041-50695063 AAGATCAGGTAGGAGGGGGCTGG + Intergenic
949938520 3:9136101-9136123 AGAGGCTGGAAGAAGGTGGCTGG - Intronic
950172741 3:10850878-10850900 AGGACCAGGGAGGAGGTGGCAGG + Intronic
950176704 3:10880027-10880049 TAGTGCAGGTGGAAGGTGGCTGG + Intronic
950290382 3:11779323-11779345 GAGAGGAGGAGGAAGGTGCCAGG + Intergenic
952039854 3:29249000-29249022 AAGGGCAGGAAGAAGAGAGCAGG - Intergenic
952347365 3:32501328-32501350 AAGAGAAGGAAGAAGGAAGAAGG + Intronic
952523432 3:34185064-34185086 AAGACAAGGAAGATGCTGGCAGG - Intergenic
952711731 3:36438680-36438702 CAGAGCAAGAAAAATGTGGCAGG + Intronic
953047131 3:39304213-39304235 AAAAGTAGGAAGGAGGTGGCTGG + Intergenic
953080299 3:39610311-39610333 AGGAGGAGAAACAAGGTGGCTGG - Intergenic
953154889 3:40360779-40360801 CAGAGAAGGAAAAAGGTGGTGGG - Intergenic
953167839 3:40481487-40481509 AAGACCAGAAAGAAGCTGGGTGG + Intronic
954330447 3:49887201-49887223 AAGGGCAGGAACAAGGTGGAGGG + Exonic
954794026 3:53152356-53152378 GAGAGGAGGAAGAAGATGCCTGG - Intergenic
955024327 3:55152842-55152864 AATATAAGGACGAAGGTGGCTGG + Intergenic
955118150 3:56026344-56026366 AAGAAATGGAGGAAGGTGGCTGG - Intronic
955808404 3:62760585-62760607 AGGAGGAGGCAGGAGGTGGCAGG - Intronic
955864791 3:63371483-63371505 AAGCCCAGGCAGTAGGTGGCTGG - Intronic
955887234 3:63613474-63613496 GAGAGAAGGAAGAAGGAGGGAGG + Intronic
955941489 3:64150532-64150554 AGGAGGAGGAAGAAGGAGGGTGG - Intronic
955945215 3:64187387-64187409 AAGGGAGGGAAGAAGGGGGCAGG - Intronic
955951020 3:64242136-64242158 AAAAGCGGGATGAAGGTGGAAGG - Intronic
956184671 3:66551143-66551165 CAGAGCAGTAAGGAGGTTGCAGG - Intergenic
956656436 3:71557653-71557675 AAGAGCAGAAAGTCGGAGGCAGG - Intronic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
957945133 3:87053595-87053617 AAGAGGAGGAAGAATGTGCATGG + Intergenic
959560323 3:107772341-107772363 AAGACCTGGAAGAAGGAGGAAGG - Intronic
959860732 3:111212083-111212105 GAGAGCAGGAAGAATGGGGAAGG - Intronic
961317816 3:126052483-126052505 GAGAGCAGGAGGAAGGCTGCTGG - Intronic
961556858 3:127701845-127701867 AAGAGAAGGAACAGGGTTGCTGG - Intronic
962162647 3:133015142-133015164 AAGAGCAGGAAGAAGAGGAGAGG - Intergenic
962212080 3:133487460-133487482 AAGAGCCGGTGGAAGCTGGCAGG - Intergenic
962372073 3:134828941-134828963 ATGAGCTGGAGGAAGCTGGCAGG + Intronic
962842822 3:139251371-139251393 AGGAGGAGGAAGAAGGAGGGAGG - Intronic
963574679 3:147045344-147045366 AAGAGCAGGAACAAGGTTGGGGG + Intergenic
963607040 3:147420778-147420800 ATGACTAGGAAGAAAGTGGCCGG + Intronic
963743498 3:149102681-149102703 AGGAGAAGGAAACAGGTGGCTGG - Intergenic
964249937 3:154701665-154701687 AACAGCACAAAGAAGGTGGGTGG + Intergenic
964499779 3:157335942-157335964 AACAGCAGGCAGAGGGAGGCTGG - Intronic
964916358 3:161846739-161846761 ATGAGTATGAAGAAGGTGTCAGG + Intergenic
965213164 3:165822717-165822739 AAGAGTAGAAAGAAGCTGGAGGG + Intronic
966518722 3:180849356-180849378 ATGAGCAGGAATAAGGTGATGGG + Intronic
966521891 3:180882266-180882288 AAGAGGAGGAAGAAGAAGACAGG - Intronic
967255897 3:187591532-187591554 AAGAGCAGGGAGAGGGTGCTGGG - Intergenic
967442981 3:189530566-189530588 AAAAGAAGGAAGAAGGAAGCGGG - Intergenic
967609932 3:191492232-191492254 AAGAGCATGAATAGGGTGGGAGG - Intergenic
967781310 3:193443005-193443027 AAAAGCAGGCAGATGGTGGGAGG + Intronic
967881761 3:194306471-194306493 ACAGGCAGGAAGCAGGTGGCAGG - Intergenic
968836871 4:2971576-2971598 AATAGCAGGAAGAAGAAAGCGGG + Intronic
968880888 4:3299447-3299469 AAAAGCAGGCAGAAAGTGGAGGG - Intronic
968914402 4:3490996-3491018 ATGAGCAGGAAGAAGAAGGAAGG - Intronic
969080977 4:4617802-4617824 AAGAGGAGGAAGAAGGAGGTAGG - Intergenic
969262255 4:6041435-6041457 AGGAGAAGGAGGAAGGTGGAAGG - Intronic
969302822 4:6307308-6307330 AGGAGCAGCAGGAAGGTGGTGGG - Intergenic
969525049 4:7700064-7700086 GGGAGCAGGAAGCACGTGGCTGG - Intronic
970592324 4:17570237-17570259 AAGGGCAAGAAAAAGATGGCGGG + Intergenic
971744060 4:30556576-30556598 AAGATCAGGATGAAGGGGACAGG + Intergenic
972103139 4:35447468-35447490 AAGAGGAGGAGGAAGGAGGGAGG + Intergenic
972103215 4:35447771-35447793 AAGAGGAGGAGGAAGGAGGGAGG + Intergenic
972103228 4:35447818-35447840 AAGAGGAGGAGGAAGGAGGGAGG + Intergenic
972374808 4:38460299-38460321 CAGAGGAAGAAGTAGGTGGCTGG - Intergenic
972388009 4:38586517-38586539 AAAAGAAGGAAGAGGGAGGCAGG - Intergenic
972836429 4:42876127-42876149 CAGAGAAGGAAGAGGGTAGCAGG + Intergenic
972975852 4:44635028-44635050 AAAAGAAAGAAGAATGTGGCTGG + Intronic
973771341 4:54209879-54209901 AAGAACAGGAAGGAGGGGTCAGG + Intronic
975007914 4:69313486-69313508 CAGAGTAGGAGGAAGGTGGAGGG - Intronic
975038295 4:69711535-69711557 AACAACAGGAAAAATGTGGCTGG + Intergenic
975073549 4:70175487-70175509 AAGCACAGGAAGAGAGTGGCAGG - Intronic
975448023 4:74490459-74490481 AAGATGAGGCTGAAGGTGGCTGG - Intergenic
975504451 4:75122856-75122878 AAGAGGAGGAGGAAGGAGGAAGG + Intergenic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
976488801 4:85642180-85642202 AAGAGCAGGTTAAAGGTGGACGG + Intronic
977026401 4:91823654-91823676 TAGAGCAGGTAGAAGTTGGAAGG - Intergenic
977238283 4:94535315-94535337 AAGAGCAAGAGGAAGGTGAAAGG - Intronic
977357215 4:95962054-95962076 GAGGGCAGGAAGAAGGTAGAAGG + Intergenic
978178657 4:105766181-105766203 AACAGCAGGAAGCTGCTGGCTGG + Intronic
979324521 4:119363049-119363071 AAGATGAGGAAGAAGGATGCTGG + Intergenic
979350347 4:119637097-119637119 CAGAGCAGGAGGTAAGTGGCAGG - Intergenic
979417085 4:120455216-120455238 AAGAGCTAGAAGAAGTTGGGTGG - Intergenic
980185384 4:129454807-129454829 AAGAGAGAGAAGAAGATGGCAGG + Intergenic
981081529 4:140643218-140643240 AGGAGGAGCAAGAAGGTGGGAGG - Intronic
981093498 4:140756387-140756409 AAGAGGAGGAGGAAGGGAGCGGG + Intergenic
981131233 4:141160729-141160751 TAGAGCAGGAAGAAGTGGGAGGG - Intronic
981535936 4:145799783-145799805 AAGAGCAGGAAGGAAGTCGAGGG - Intronic
981911656 4:149988572-149988594 AGGAGGAGGAAGAAAGTGGGAGG - Intergenic
982227020 4:153175561-153175583 AATAGCAGGAGGAAGGCGGATGG + Intronic
982255031 4:153443344-153443366 AAGAGAAGCAAGAAGGGGGAAGG + Intergenic
982567834 4:157009056-157009078 GAGAGCAGGAAGAAGGATGAGGG + Intergenic
983075600 4:163322309-163322331 AAAATCAGAAAGAAGGTGGATGG + Intergenic
984350583 4:178587308-178587330 TACAGCAGGAAGAAGGAGACAGG - Intergenic
984459284 4:180012525-180012547 ATGAGCAGGAAGAAGGAGAAAGG - Intergenic
984942179 4:184942747-184942769 AAGGGAACTAAGAAGGTGGCAGG - Intergenic
985573988 5:665304-665326 AGGAGCAGGAGGAAGGGGGCAGG + Intronic
985887263 5:2689147-2689169 CAGCACAGGAAGGAGGTGGCTGG + Intergenic
986286070 5:6360075-6360097 GAGAGCTGGAAGGAGGAGGCAGG + Intergenic
986310575 5:6547827-6547849 AAGAAAAGGAAGAGGGAGGCAGG + Intergenic
986630315 5:9766425-9766447 AAATGCTGGAAGAAGGTAGCAGG + Intergenic
987002671 5:13675973-13675995 ATGAACAGGAGGCAGGTGGCAGG + Intergenic
987442794 5:17977550-17977572 AATAGCAGGAAGAAAGTGAAAGG - Intergenic
987576030 5:19730019-19730041 CAAAGCAGAAAGAAGGTGGGAGG - Intronic
987872680 5:23641059-23641081 AAGTGCAGAGTGAAGGTGGCCGG - Intergenic
989263570 5:39446626-39446648 AAGGGAAGGAAGAAGTAGGCAGG + Intronic
990397409 5:55396479-55396501 AAGAGGAGGAAGAGGCAGGCAGG + Intronic
990594631 5:57300515-57300537 TAAAGCAGGAAGAATGTGGAAGG + Intergenic
991772724 5:70054515-70054537 AGGAGAAGGTAGAAGATGGCAGG + Intronic
991852017 5:70929939-70929961 AGGAGAAGGTAGAAGATGGCAGG + Intronic
992632988 5:78699815-78699837 AAGAGCTGGATGAGGGTGGAAGG + Intronic
993247130 5:85465420-85465442 AAGGACAAGAAGAAGGTGGTAGG - Intergenic
993669345 5:90741190-90741212 TAGTCCAGGTAGAAGGTGGCTGG - Intronic
993686405 5:90943397-90943419 AAGATAAGGAAGAATGTGCCAGG - Intronic
993828493 5:92723553-92723575 AAGAGCAGGAGCAAGATGGCAGG + Intergenic
993852074 5:93023173-93023195 GAGAGCAGCAGGAAGGAGGCAGG - Intergenic
994546867 5:101177645-101177667 CAGAGCAGGAGGAAGGTGGGTGG - Intergenic
995214693 5:109581924-109581946 ACGAGCAGGGAGTAGGTGCCAGG + Intergenic
995636135 5:114193156-114193178 AAGAGCTGGATGAAGGGGGAAGG - Intergenic
995902491 5:117086348-117086370 CAGAGCAGGAAGAACTTGCCAGG + Intergenic
995938641 5:117550698-117550720 AAGAGGAGGAAGAAGATGAGGGG + Intergenic
996001474 5:118369232-118369254 AGGAGAAGGCAGAAGGTCGCGGG - Intergenic
996174102 5:120333281-120333303 AAAAGGAGGAAGAAGGAGCCAGG - Intergenic
996318480 5:122188010-122188032 AAAAGAAAGAGGAAGGTGGCAGG + Intergenic
996421266 5:123265517-123265539 AAAAACAGGAAGAATGTGACAGG - Intergenic
997853379 5:137352630-137352652 AAGACGAGGAAGAAGGAGGGAGG + Intronic
998459029 5:142295667-142295689 AAGAGCAGGAAGGGGCTGCCAGG - Intergenic
998648285 5:144089059-144089081 ATGAGCAGGAAGAAGGCAGTGGG - Intergenic
999208783 5:149869730-149869752 AAGAGCAGGATGGAGGGGGATGG + Intronic
999310979 5:150551990-150552012 AAGAGGAGGAAAATGGGGGCTGG + Intronic
999674780 5:153987986-153988008 AAGAAAAGGAAGGAGGAGGCAGG - Intergenic
999992675 5:157063705-157063727 AAGAGCAGGGTGAAGGTGGTTGG + Intergenic
1000223176 5:159233827-159233849 TAAAGCAGGCAGAAGGTGGTGGG - Intergenic
1001241891 5:170077628-170077650 AGGTGGAGGAAGAAGGTGACAGG + Intronic
1001742357 5:174064586-174064608 AAAAGCAGGAAGAAGGGAACAGG - Intronic
1001756053 5:174170978-174171000 CAGAGCAGGAAGTGAGTGGCAGG - Intronic
1002373591 5:178773250-178773272 AAAAAAAGGAAGCAGGTGGCTGG + Intergenic
1002646453 5:180658919-180658941 AAGTGCAGGACGGAGGCGGCGGG - Intergenic
1002691087 5:181051099-181051121 AAAAACAAGAAGAAGGTGGTAGG + Intronic
1003255434 6:4471017-4471039 AAGGGCAAGAAGAAGATGGAAGG + Intergenic
1003262541 6:4533135-4533157 AACAGCATGAAAAAGGTGACAGG + Intergenic
1004507428 6:16258409-16258431 AAGTGCAGGAAGGAGGGGGCTGG + Intronic
1004649345 6:17593562-17593584 AAGAGAAGGAGGAAGGGGGAGGG - Intergenic
1004720336 6:18263835-18263857 AGGAGGAGGAAAAAGGTGGGGGG - Exonic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083485 6:21980766-21980788 CAGAGCAGGAAGGAGGAGGCTGG - Intergenic
1005083646 6:21981668-21981690 CAGAGCAGGAAGGAGGAGGTAGG - Intergenic
1005083659 6:21981720-21981742 CAGAGTAGGAAGGAGGCGGCAGG - Intergenic
1005083678 6:21981824-21981846 CAGTGCAGGAAGGAGGAGGCAGG - Intergenic
1005083684 6:21981850-21981872 CAGATCAGGAAGGAGGAGGCAGG - Intergenic
1005276788 6:24227980-24228002 AAGAGAAGGAAGGAGGTGGCAGG - Intronic
1005433486 6:25783104-25783126 AGCACCAGGAAGAAGGTGGTAGG - Exonic
1005666807 6:28065897-28065919 GAGAACAGGGAGAAGGTGGTTGG - Intergenic
1005882042 6:30069371-30069393 AAGAGAGGGAAGGAGGGGGCTGG - Exonic
1006174994 6:32116339-32116361 AGCAGCAGGAAGTAGGTGGAGGG - Intronic
1006303741 6:33207310-33207332 GAGAGCAGGAGGGAGGGGGCTGG + Intergenic
1007234571 6:40381206-40381228 GAGAGGAGGAATAAGGTGGCAGG - Intergenic
1007377440 6:41466538-41466560 AAGAGAGGGAAGAAGGAGGAAGG + Intergenic
1007482332 6:42158341-42158363 AAGAGGAGGAAGAGGGAGTCAGG - Intronic
1007927634 6:45663197-45663219 AAGAGGAGGAGGGAGATGGCAGG - Intronic
1007969777 6:46039314-46039336 AAAAGCAGGAAAAAGATGGGTGG + Intronic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1008586460 6:52955062-52955084 AAGAGTAAGTACAAGGTGGCCGG + Intergenic
1009251336 6:61303818-61303840 AAGAGTAGGAAGAAGCTTTCTGG - Intergenic
1009417903 6:63436138-63436160 AAGAGAATGAAGATGGTGGTAGG - Intergenic
1009929078 6:70154875-70154897 TAAAGCAGGCAGAAGGTGGAAGG - Intronic
1010237851 6:73589969-73589991 AAGAGAAATATGAAGGTGGCAGG + Intergenic
1010369270 6:75088704-75088726 AATAACAGGATGAAGTTGGCTGG + Intronic
1011798445 6:90982976-90982998 AAGAGAGAGAAGAAGGTGGGAGG - Intergenic
1012482953 6:99688839-99688861 AAGAGCTGGAGCAAGATGGCTGG + Intergenic
1013405345 6:109838272-109838294 AGGAGCAGGGAAATGGTGGCTGG - Intergenic
1013405504 6:109839390-109839412 AGGAGCAGGGAAATGGTGGCTGG + Intergenic
1013424353 6:109997630-109997652 CAGAGCAGGAAGCAGGTGTGGGG - Intergenic
1013720505 6:113020955-113020977 AAGGGCAGAAAAAAGGTGGAAGG + Intergenic
1013764871 6:113563038-113563060 CAGAGAAGGATGAAGGTGGCAGG - Intergenic
1014469605 6:121798478-121798500 AAGATTAGGAATAAGGTGGGTGG + Intergenic
1014743462 6:125172044-125172066 AAGAAGAGAAAGAAGGTGGGAGG - Intronic
1014957268 6:127636303-127636325 AAGAGCAGAGAGAATGTGCCAGG - Intergenic
1014996492 6:128152090-128152112 AAGGTCAGGAAGAAGGTAGAAGG + Intronic
1015577806 6:134691180-134691202 AAGAGGAGAAAGAAGGAGGGAGG + Intergenic
1015726607 6:136305990-136306012 GAGAGGAGGAAGAGGATGGCAGG - Intergenic
1015956681 6:138606215-138606237 AAGAAGAGGAGGAAGGTGCCAGG - Intronic
1016229553 6:141786077-141786099 AAGAGAAGGAAGAAAGAGGAAGG - Intergenic
1017036945 6:150275385-150275407 AAAAGCAGGAAGGAGGGGGAGGG - Intergenic
1017340617 6:153317349-153317371 AAGAGAAGAAAGTAGGGGGCTGG + Intergenic
1017373062 6:153735865-153735887 AAGTGCAGGAGGGAGGTGGTGGG - Intergenic
1018163817 6:161075020-161075042 TAGAGAAGGAAGAATGTGGCTGG + Intronic
1018190763 6:161307464-161307486 TAAAGCAGGCAGAAGGTGGAAGG - Intergenic
1018247693 6:161838600-161838622 ATGAGGAAGAGGAAGGTGGCTGG - Intronic
1018556673 6:165057866-165057888 AAAAGCAGGAAGAAGGGAGGAGG + Intergenic
1018653463 6:166010302-166010324 AGGAGCTGGAAGAAGCTGGCAGG - Intergenic
1019103169 6:169648519-169648541 AATATCAGGCAGAACGTGGCAGG + Intronic
1019568059 7:1694436-1694458 AAGAGCTGGAGGAGGATGGCTGG + Intronic
1020119759 7:5496395-5496417 AAGAGGAAGAAGAATGTGGAAGG - Intronic
1020734848 7:11935041-11935063 CAGAGTAGGAAGAAGCAGGCAGG + Intergenic
1021658395 7:22894617-22894639 CAGTGCAGGAGGAAGGTGGTTGG + Intergenic
1021758770 7:23882629-23882651 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1022036346 7:26538217-26538239 AGGAGAAGGAAGAAGGGGACAGG - Intronic
1022192600 7:28031479-28031501 GAGAGCAGGAGGAATGTAGCTGG + Intronic
1022245691 7:28556986-28557008 AAGAGAAGGAAGAAGTTACCAGG - Intronic
1022248904 7:28587464-28587486 AAGAGCAGGCCAAAGGTAGCAGG + Intronic
1022381733 7:29866760-29866782 CAGAGCAGGAAGGAGTGGGCAGG - Intronic
1022491475 7:30823450-30823472 GAAAGAAGGAAGAAGGTGGGGGG - Intronic
1022570737 7:31451138-31451160 CAGAGCAGGAATAAGGGTGCTGG - Intergenic
1022795809 7:33730627-33730649 AACAGCAGGAAGTGAGTGGCGGG + Intergenic
1023344599 7:39258716-39258738 AAGAAGAAGAAGAAGGTGGTAGG + Intronic
1023910904 7:44555789-44555811 AAGATCAGGCAGAAGAGGGCTGG + Intergenic
1023968798 7:44977195-44977217 TGGAGAAGGAAGAAGGGGGCAGG + Intronic
1024300347 7:47882705-47882727 AGGAGGAGGAAAAATGTGGCTGG + Intronic
1025275707 7:57580139-57580161 TAGAGCAGTAGGATGGTGGCCGG + Intergenic
1025709601 7:63895215-63895237 AAGGACAGTAAGAAGTTGGCTGG + Intergenic
1025778865 7:64581896-64581918 AAGATTAGAAAGAAGGTGGAAGG + Intergenic
1025815458 7:64906925-64906947 AAGATTAGAAAGAAGGTGGGAGG + Intronic
1026191898 7:68136468-68136490 AGGAGGAGGAAGAAGATGGGAGG + Intergenic
1026304135 7:69125224-69125246 AAGAGCAGGGGGAAGGGGGGCGG + Intergenic
1026369785 7:69687875-69687897 CAGAGAGGGAAGAAAGTGGCAGG - Intronic
1026980068 7:74521175-74521197 GAGAGAAGGAAGAAGGTTCCAGG - Intronic
1027945489 7:84739702-84739724 AAGTGCTAGCAGAAGGTGGCAGG + Intergenic
1028404349 7:90460023-90460045 AAGAGCAAGAAGAAAGTTGCTGG + Intronic
1028773330 7:94652354-94652376 AGAAAAAGGAAGAAGGTGGCTGG + Intronic
1028889313 7:95969259-95969281 AAGATAAGGAAGATGGTGGAGGG + Intronic
1028921376 7:96314108-96314130 AGGAGGAGGAAGAAGGAGGAAGG + Intronic
1029654741 7:101916864-101916886 AAGGGAAGGAAGAAGGGGCCAGG - Intronic
1029977874 7:104851266-104851288 AAGAACAGGAAGCCTGTGGCTGG + Intronic
1030407164 7:109129137-109129159 AAGGGCAAGAAGAAGATGGCAGG + Intergenic
1030492273 7:110252789-110252811 TAGAGTAGGAAGAAGTAGGCAGG + Intergenic
1031261898 7:119532074-119532096 AAAAGCAGAAACAAGGAGGCAGG - Intergenic
1031490413 7:122380972-122380994 AAGAGCCTGAAAAAGCTGGCTGG + Intronic
1032202811 7:129835003-129835025 AAGAACAGGAAGAGGGTACCGGG - Exonic
1032472721 7:132190092-132190114 GGGAGAAGGAAGAAGGTGGGTGG - Intronic
1032665501 7:134032404-134032426 AGCAGCAGGAAGATGGTGGCAGG - Intronic
1032782471 7:135175031-135175053 GATACCAGGAGGAAGGTGGCAGG - Intergenic
1033337465 7:140465783-140465805 AAGAGTAAGAGGTAGGTGGCCGG + Intronic
1033423352 7:141221747-141221769 GAGGGCAGCAGGAAGGTGGCTGG + Intronic
1033592850 7:142828148-142828170 AAGAGGAGGAAAAAGGTAGCTGG - Intergenic
1033817039 7:145085488-145085510 AAGGGCAGGAAGAAGAGGGCAGG + Intergenic
1033826670 7:145199551-145199573 AAGAGCGGGAGGAAGGGTGCAGG - Intergenic
1034274509 7:149818127-149818149 AAGGACAGGCAGAAGGTGGTGGG + Intergenic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034509103 7:151519890-151519912 AAGCGGCGGAAGAAGGTGGGAGG - Exonic
1034978909 7:155463431-155463453 AGGAGCAGGAGGAAGGAGGAAGG - Exonic
1035118000 7:156540921-156540943 CAGGCCAGGAAGCAGGTGGCAGG + Intergenic
1035143323 7:156786226-156786248 AAGAGAAGGAGGAAGGAGGAAGG + Intronic
1035745259 8:1957419-1957441 AAGAGAAGGAAGGAATTGGCAGG - Exonic
1036608224 8:10327015-10327037 AAGAGCTGGCAGAAGGAGCCAGG - Intronic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037692458 8:21193769-21193791 AAGAGAAGGAGGAAGGTGAAAGG + Intergenic
1037880264 8:22570210-22570232 CAGAGGGGGAAGAAGGTGGCTGG + Intronic
1037884763 8:22590106-22590128 AACAGCATTAAGAGGGTGGCAGG + Intronic
1038024765 8:23578529-23578551 ATGAGCAGAGAGGAGGTGGCAGG - Intergenic
1038238381 8:25784442-25784464 AGGAGGAGGAAGGAGGTGGGAGG - Intergenic
1038694598 8:29795148-29795170 TAGAGGAGGAAGAAGGAGGATGG - Intergenic
1039443427 8:37611471-37611493 CAGAGCAGGAAGAGGGGGACAGG + Intergenic
1040383944 8:46900670-46900692 GAGACCAGGAGGAAGGTGGTGGG + Intergenic
1040447165 8:47507145-47507167 AGGAGCTGGCAGCAGGTGGCTGG - Intronic
1040466225 8:47697736-47697758 AAGAGCGGCAAGAAGAAGGCTGG - Intronic
1041215529 8:55596382-55596404 CAGGGCAGGAGGAAGGAGGCAGG - Intergenic
1041227308 8:55713279-55713301 GATACCAGGAACAAGGTGGCGGG - Intronic
1041521289 8:58759137-58759159 AACAGGAGGAAGCAGGAGGCTGG + Intergenic
1042576041 8:70219671-70219693 AAGGGCAGGAGGAGGGTGGAGGG + Intronic
1042661180 8:71156196-71156218 AAGACCTGGAGGGAGGTGGCTGG + Intergenic
1042830295 8:73019526-73019548 AAGGGCAGGAGGAAGGTCGGTGG - Intronic
1042840259 8:73116616-73116638 ATGGGCAGGAAGGAGGTGGGAGG + Intronic
1043521454 8:81050378-81050400 AAGAGTGGTAAGAAGGTGGCTGG + Intronic
1043540329 8:81255144-81255166 AAGAGCAGGAAGAGGGTACCAGG + Intergenic
1044619531 8:94175435-94175457 AAGAGAAGGAAGAAGCTTGATGG + Intronic
1044751090 8:95416029-95416051 AAGAGAAGAAAGAAGGGGGTGGG - Intergenic
1044785868 8:95792006-95792028 AAGAGCAGGAAACAGGTAGAAGG + Intergenic
1045041529 8:98228827-98228849 ATGAGCAGGAAGGAATTGGCTGG + Intronic
1045821443 8:106343089-106343111 AAGACCTGAAAGAAGGTAGCTGG - Intronic
1045987403 8:108264567-108264589 GAGAGCAGGAGGAAGGTGGCAGG - Intronic
1046089719 8:109487249-109487271 AGGAGCATGAAGAAAGTGGATGG - Intronic
1046520672 8:115321053-115321075 TAGAGCAGGAAGAAGGGGGCTGG - Intergenic
1047426109 8:124748453-124748475 AAGAGCAGGAGGAAGGTGGGTGG + Intergenic
1047782581 8:128122330-128122352 AGTAGCAGGAGGCAGGTGGCAGG - Intergenic
1048132926 8:131717516-131717538 AAGAGCAGAAAGAAGATGGGAGG + Intergenic
1049151210 8:141036652-141036674 AGGAGCAGGAAGAAGTGGGGAGG - Intergenic
1049271968 8:141700819-141700841 TAGAGCAGGAAGGGGCTGGCGGG - Intergenic
1049303281 8:141883159-141883181 AAGAGAAGGAAGAAGCAGGAGGG + Intergenic
1049450281 8:142657601-142657623 AAGAGCAGGAGGAAGAAGGGAGG + Exonic
1049632431 8:143665798-143665820 AGGGACAGGAAGAAGGTGGGTGG + Intergenic
1049685698 8:143938447-143938469 AAGAGGAGGAAGAGAGAGGCAGG + Intronic
1049759202 8:144324299-144324321 AAGAGCAGCAGGAAGCTGGAGGG + Intronic
1050010375 9:1179678-1179700 AAAAGCAGGAAGGACGAGGCAGG + Intergenic
1050180385 9:2916617-2916639 GGGAGCAGGAGGAAGCTGGCAGG - Intergenic
1050707850 9:8424044-8424066 AAGAGCATGAAGCGGGTGGCTGG + Intronic
1050833688 9:10048893-10048915 AAGAGCAGAAAGGTGGTGGTAGG + Intronic
1051170381 9:14314698-14314720 AGGAGGAGGAGGAAGGTGGGGGG - Intronic
1051189118 9:14492559-14492581 CAGAGCAGGAAGAAGAGGGAGGG + Intergenic
1051602507 9:18889475-18889497 CAGGGCAGGGAGAAGGTGACAGG - Intronic
1055073510 9:72191409-72191431 AAATGGAGGAAGAAGATGGCTGG + Intronic
1055399237 9:75905659-75905681 AACAGCAGGAAGTAAGGGGCAGG + Intronic
1055424530 9:76180611-76180633 AGGAGGAGGGAGAAGGTGGGTGG - Intronic
1055473772 9:76641280-76641302 AAGAGCAGGAAGAAAGTAGCAGG + Intronic
1055575935 9:77660330-77660352 AAGGGAAGGAAGAGGGTGGAGGG - Intergenic
1055738878 9:79363962-79363984 AAGAGTAGGAAGAAGGAAACTGG - Intergenic
1056016399 9:82392810-82392832 AAGAGCTGGAAGATGGGGGTAGG - Intergenic
1056845877 9:90037684-90037706 AGCAGCAGGAAGAATGAGGCAGG - Intergenic
1056853468 9:90104305-90104327 AATAGCAGCATGAAGGTGGGAGG - Intergenic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057456286 9:95215334-95215356 AAGTGAGGGAAGAAGGTGGTAGG + Intronic
1058581224 9:106460024-106460046 CAAAGCAGGAAGAAGGAGGTTGG + Intergenic
1058624656 9:106922397-106922419 AATAGCAGAATGAAGGTAGCTGG + Intronic
1058820721 9:108727345-108727367 AAGAGCAGTAAGCCGGAGGCAGG + Intergenic
1058875875 9:109244407-109244429 AAGAGAAGGAAGGAGGTTGAAGG + Intronic
1059751240 9:117249609-117249631 AAGACCAGGGGGAAGGTGGTGGG - Intronic
1059955461 9:119511172-119511194 AAGAAGAGGAAGAAGGTTGAGGG + Intronic
1060171077 9:121461560-121461582 AAGAGAAGGGAAAAGGGGGCTGG + Intergenic
1060832811 9:126728451-126728473 AAGAGGAGGAACAAGGGGGAGGG - Intergenic
1061057459 9:128232171-128232193 AGGAGCAGGGAGAAGGAGGGAGG - Intronic
1061143357 9:128781683-128781705 TTCAGCAGGAAGCAGGTGGCAGG - Intergenic
1061979099 9:134089893-134089915 CAGAACAGGAAGTAGGTGTCAGG + Intergenic
1062149611 9:135010935-135010957 AGGAGCATGGAGGAGGTGGCTGG - Intergenic
1062297506 9:135840563-135840585 AAAGGCAGGAGGAAGGTGGCTGG + Intronic
1062541730 9:137044562-137044584 AAGAGCAGCTGGACGGTGGCTGG + Intronic
1185835916 X:3345997-3346019 AAGAGTAGGAGGAAAGAGGCGGG + Intronic
1186373498 X:8970955-8970977 TAGAGCAGGAAGAACGGGGTGGG - Intergenic
1186582954 X:10840617-10840639 AAGAGAAGGAAGGCGGTGGCTGG - Intergenic
1187025275 X:15429004-15429026 AAGAGAAGTGAGAATGTGGCTGG + Intronic
1187039897 X:15582708-15582730 AAGAGTAGTGGGAAGGTGGCAGG + Intronic
1187082773 X:16008601-16008623 AAGAACAGGAAGAAGATCCCAGG - Intergenic
1187381665 X:18807478-18807500 AAGAGCAAGAAGAGGGTGGAAGG - Intronic
1187715388 X:22097455-22097477 CAGAGCAGGAAGAAGGTGAAAGG + Intronic
1188081368 X:25845345-25845367 AAAAGCAGGAAGATTGTGGAGGG - Intergenic
1189217678 X:39341012-39341034 AAGAAGAGGGAGAAGGTGTCAGG + Intergenic
1189377621 X:40477959-40477981 AAAGGCTGGAAGAAGGTGGATGG - Intergenic
1189661219 X:43302016-43302038 AGGAGCAAGACCAAGGTGGCAGG - Intergenic
1190029327 X:46956686-46956708 AAGGGAAGGAAGAAAGTAGCTGG - Intronic
1190123410 X:47682737-47682759 AGGAGAAGGGAGAAGGTGGATGG - Intergenic
1190311857 X:49122564-49122586 AAGAAGAGGAAGAAGGTGGAAGG - Intronic
1190437041 X:50435825-50435847 GAGAGCAGGAGGAAAGTGTCAGG + Intronic
1191017132 X:55820741-55820763 CAGAGCAGGAAGAAGAGAGCAGG + Intergenic
1191616617 X:63176587-63176609 AAGTGCAGGAATGAGGTGCCTGG + Intergenic
1191619680 X:63202336-63202358 AAGTGCAGGAATGAGGTGCCTGG - Intergenic
1191715372 X:64190467-64190489 AAGAGGAGGAAGAAGGAGAATGG - Exonic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1193103008 X:77636935-77636957 AGGAGAAGGAAGAAGGAGGAAGG + Intronic
1193236485 X:79113628-79113650 AGAAGCAGGCTGAAGGTGGCAGG + Intergenic
1193278506 X:79620467-79620489 CAGAGCAGGAGGTAGGCGGCAGG + Intergenic
1194407022 X:93509270-93509292 AAGAGGAGGAAGGAAGAGGCAGG + Intergenic
1194721626 X:97346981-97347003 CAGAGAAGGAAGAAGGTGATGGG - Intronic
1194889087 X:99355303-99355325 AAGGGCAAGAAGAAGATGGTGGG - Intergenic
1195054074 X:101125692-101125714 AAAAGAATGAAAAAGGTGGCTGG - Intronic
1195751860 X:108167896-108167918 AAGGGAAGGAAGAGGGTGGAGGG - Intronic
1195845570 X:109224049-109224071 AAGAGCAGAATGAAAGGGGCAGG + Intergenic
1196505537 X:116436740-116436762 AAGTGCAGGGAGAAGGAGGTAGG + Exonic
1197674398 X:129313968-129313990 GAGAGCAGGAGAAAGGTGGGGGG + Intergenic
1199038104 X:143077846-143077868 GAGAGCAGGAGCAAGGTGGGAGG + Intergenic
1199405373 X:147452268-147452290 CAAAGCAGGAAGAAGGCAGCCGG + Intergenic
1199490702 X:148397323-148397345 AAGAGCAGGATAATGGAGGCAGG + Intergenic
1200092135 X:153640993-153641015 CAGAGCAGGAAGACAGTTGCAGG + Intergenic
1200204158 X:154303839-154303861 ATGAGCAAGAAGATGGTGGGGGG - Intronic
1200766888 Y:7087765-7087787 AAGAGGAAGAGGAAGGTGGAAGG - Intronic
1201321110 Y:12699449-12699471 AAGTGCAGACTGAAGGTGGCTGG + Intergenic
1202061703 Y:20896077-20896099 AAGGGCAAGAAGAAGATGGCAGG - Intergenic
1202592220 Y:26497394-26497416 AAGAGCATGAAGGTGGTGGAGGG + Intergenic