ID: 1089748882

View in Genome Browser
Species Human (GRCh38)
Location 11:120636296-120636318
Sequence AGGGGCACTCATGCTCCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089748882_1089748893 13 Left 1089748882 11:120636296-120636318 CCCAGGGGAGCATGAGTGCCCCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1089748893 11:120636332-120636354 ATGGCACTCTGTCATAATCCAGG 0: 1
1: 0
2: 1
3: 11
4: 85
1089748882_1089748884 -6 Left 1089748882 11:120636296-120636318 CCCAGGGGAGCATGAGTGCCCCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1089748884 11:120636313-120636335 GCCCCTCCTTTACCCTCCCATGG 0: 1
1: 0
2: 0
3: 38
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089748882 Original CRISPR AGGGGCACTCATGCTCCCCT GGG (reversed) Intronic
900255573 1:1696712-1696734 AGGGCCGCTCATGCTTTCCTGGG + Intronic
900264249 1:1749414-1749436 AGGGCCGCTCATGCTTTCCTGGG + Intergenic
900468205 1:2835958-2835980 AAGGGCAGTCATGGACCCCTGGG + Intergenic
901034169 1:6326287-6326309 AGGGGGACAGATGCTCCCCAGGG + Intronic
901066372 1:6496601-6496623 CGGGGCACCCAGGCTCCCCTGGG + Intronic
906713549 1:47950901-47950923 AAGGGTACTGATGCTCACCTGGG + Intronic
911360800 1:96873589-96873611 AGGGGCACCAAAGCACCCCTTGG - Intergenic
912109645 1:106325473-106325495 AGGGGCACTCATTTGCTCCTAGG - Intergenic
916282161 1:163063693-163063715 TGGGGCACTGATCCTCCACTTGG - Intergenic
921836215 1:219781650-219781672 AGGAGCACTCAGGCTCCCTCTGG + Intronic
923046665 1:230361029-230361051 AGGTGCACTCAGGCTGGCCTGGG - Intronic
924909636 1:248496895-248496917 AGAGGCACTCATAATCCCCGTGG - Intergenic
924914466 1:248551165-248551187 AGAGGCACTCATAATCCCCGTGG + Intergenic
1063201236 10:3786107-3786129 GGGAGCACGCAGGCTCCCCTTGG + Intergenic
1063563746 10:7153137-7153159 AGAGGCCCCCATGCTCCACTTGG - Intergenic
1064390640 10:14939082-14939104 AGGGGCAGACAAGCTCCCCTGGG - Intronic
1064401009 10:15021078-15021100 AGGAGCAAACAAGCTCCCCTGGG - Intergenic
1065528733 10:26647910-26647932 TGGGGCACTCCTGCTCTTCTTGG - Intergenic
1065998226 10:31079756-31079778 AGGGGCACCCAGGCAGCCCTGGG - Intergenic
1068517053 10:58037931-58037953 AGGGGCACCCATTCTACCTTTGG - Intergenic
1070537595 10:77391270-77391292 AAGGGCACACATCCTTCCCTGGG - Intronic
1072831269 10:98661101-98661123 ACCTGCACTAATGCTCCCCTGGG + Intronic
1073064996 10:100753042-100753064 AGGGGCACACAGGCTTCCTTTGG + Intronic
1075617543 10:123902634-123902656 AGGGGCACACAAGCACCCTTGGG + Intronic
1078553150 11:12294128-12294150 AGGGGCTCTCCTGCTGCCCTAGG - Exonic
1078830329 11:14971967-14971989 CGGGACACTCAGGCTCCCCAGGG - Intronic
1082063410 11:47879585-47879607 ATGGGCACTCAGGGTCCCCATGG + Intergenic
1082983265 11:59143426-59143448 AGGGGCACTGACGCTCTCCCTGG + Intronic
1084671623 11:70610237-70610259 AGGGGCACCAAAGCTCCCATTGG - Intronic
1086737016 11:90319562-90319584 AGAGGTAATTATGCTCCCCTTGG - Intergenic
1089748882 11:120636296-120636318 AGGGGCACTCATGCTCCCCTGGG - Intronic
1089759421 11:120712175-120712197 AGGGGCACCCAGCCTGCCCTTGG + Intronic
1090242612 11:125194576-125194598 AGGGGCACTCAGCCTCTCCTGGG + Intronic
1091020659 11:132096654-132096676 AGGAGCAATCAGGCTCCGCTCGG + Intronic
1091753888 12:3039517-3039539 AGGGGCACACAGGGACCCCTGGG - Intronic
1092498839 12:9025741-9025763 AGGGGCACTCTTTCTACCCAAGG - Intergenic
1093016157 12:14156576-14156598 AGGGGCACAGATGATTCCCTTGG + Intergenic
1093067021 12:14668783-14668805 AGGGCCACTCAGGATCTCCTGGG - Intronic
1093370567 12:18359761-18359783 ATGGCCACCCCTGCTCCCCTTGG + Intronic
1094037722 12:26088568-26088590 AGGGGCAAACAAGCTCCCTTGGG + Intergenic
1094846004 12:34361702-34361724 AGGGACACTCAGGGTCCCCATGG + Intergenic
1094846612 12:34364142-34364164 AGGGACACGCAGGTTCCCCTGGG + Intergenic
1094846704 12:34364521-34364543 AGGGACACTCAGCATCCCCTGGG + Intergenic
1094847475 12:34367668-34367690 AGGGACACCCAGGGTCCCCTGGG + Intergenic
1094847929 12:34369542-34369564 AGGGACACCCAGGGTCCCCTGGG + Intergenic
1094849743 12:34377034-34377056 AGGGACACCCAGGTTCCCCTGGG + Intergenic
1094851412 12:34383944-34383966 AGGGGCCCTCAGGGACCCCTGGG + Intergenic
1094853856 12:34394272-34394294 AGGGACACCCAGGGTCCCCTAGG - Intergenic
1094854443 12:34396714-34396736 AGGGACACCCAGGGTCCCCTGGG - Intergenic
1094854633 12:34397450-34397472 AGGGACACCCAGGGTCCCCTGGG - Intergenic
1094854678 12:34397638-34397660 AGGGACACCCAGGGTCCCCTGGG - Intergenic
1094856859 12:34406739-34406761 AGGGACACGCAGGGTCCCCTGGG - Intergenic
1096478002 12:51920408-51920430 AGGAGCACTCAAGCCCCCTTGGG - Intronic
1100881185 12:99018266-99018288 AGGGGCAAACAAGCTCCCTTGGG - Intronic
1103167667 12:118784076-118784098 AGTGGCACACATCCTCCTCTTGG + Intergenic
1103699570 12:122841878-122841900 CTGGGCTCTCATGCTCCCCTCGG + Intronic
1106374882 13:29176623-29176645 AGGGGCAAACAAGCTCCCCCAGG + Intronic
1113511320 13:110856958-110856980 AAGGGCACTCAAGCAGCCCTGGG - Intergenic
1115392321 14:32866907-32866929 AGGGGAATTCATGCTCCCCATGG - Intergenic
1116994749 14:51311298-51311320 AGGGGCAGTCATGTTCCCATGGG - Intergenic
1122692731 14:103538836-103538858 TGGGCCACACAGGCTCCCCTGGG - Intergenic
1124662475 15:31561506-31561528 AGGGGCACCCATGCTCCTCCCGG + Intronic
1125347649 15:38734279-38734301 AGGGGCAAACAAGCTCCCTTGGG + Intergenic
1127300835 15:57651873-57651895 AGGAGCACTCTGGCTCCCCCGGG - Intronic
1127520534 15:59739137-59739159 AGGGGCACGACAGCTCCCCTGGG - Intergenic
1129155047 15:73712487-73712509 AGGGGCCCTCCTCCTTCCCTTGG - Intronic
1130210251 15:81915729-81915751 AGGGGCAAACAAGCTCCCCTGGG + Intergenic
1131642483 15:94307427-94307449 AGGGACACTCCTGCTACCCTGGG - Intronic
1131992910 15:98108048-98108070 AAGCTCACTCATGCTCCCTTTGG + Intergenic
1133055182 16:3142223-3142245 ATCGGCACTAATGCTCCACTCGG + Exonic
1133745323 16:8682085-8682107 AGGGGCAATCTTGTTCCCCAGGG - Intronic
1134606934 16:15578727-15578749 AGGGGCAAACAAGCTCCCTTGGG + Intronic
1136364410 16:29802843-29802865 AGGGGCCCCCTGGCTCCCCTGGG - Exonic
1138585136 16:57964427-57964449 GGGGGCCCGCATTCTCCCCTCGG - Intronic
1139645587 16:68327429-68327451 TGGGGGATTCATGCTGCCCTGGG + Intronic
1140231853 16:73123823-73123845 AGGGGCAAACAAGCTCCCCCAGG - Intergenic
1141269656 16:82527673-82527695 AGGGACACTCTTGGTCCTCTTGG - Intergenic
1141660557 16:85439044-85439066 GGAGGCTCTCATGTTCCCCTGGG - Intergenic
1143144127 17:4762639-4762661 AGCGGCACTCCTGCTCTTCTAGG + Intergenic
1143919218 17:10317635-10317657 AGGAGCACACATGCTCCACGAGG + Intronic
1145940487 17:28741015-28741037 AGGGGGACTCACGGTCTCCTTGG + Intronic
1146471945 17:33131719-33131741 ATGGCCACTCATGGTCCTCTTGG - Intronic
1146919716 17:36702566-36702588 AGGGCCACTCTTCCTCTCCTTGG - Intergenic
1147660729 17:42115538-42115560 ACAGGCCCTCATTCTCCCCTGGG + Intronic
1149286998 17:55176121-55176143 AGGGGCACAGATGCTGCCCATGG + Intergenic
1149850258 17:60029829-60029851 AGGGAGACTCAGCCTCCCCTTGG + Intergenic
1149859908 17:60116695-60116717 AGGGAGACTCAGCCTCCCCTTGG - Intergenic
1150432841 17:65132212-65132234 AAGCGGACTCATGCTGCCCTGGG - Intergenic
1152100306 17:78297621-78297643 AGGAGGACTCCTGCTCCACTGGG - Intergenic
1156341651 18:36214979-36215001 AGGGGCACTCAAGCTGACCTTGG + Intronic
1158015280 18:52775843-52775865 AGGAGTGCTCATGCTCACCTAGG + Intronic
1158154953 18:54415310-54415332 AGGAGTGCTCATGCTCTCCTTGG + Intergenic
1160418232 18:78726744-78726766 AGGCGCCCTCCTCCTCCCCTGGG - Intergenic
1161473877 19:4473933-4473955 AGGGGCATCCAAGGTCCCCTCGG - Intronic
1161626780 19:5331610-5331632 GGGGTCACTTTTGCTCCCCTGGG - Intronic
1163150969 19:15413879-15413901 AGGGGCCCTGGTGCTTCCCTAGG + Intronic
1163358914 19:16833071-16833093 AGGGGCACTTTTGCCCCCCAGGG - Intronic
1163405803 19:17121521-17121543 TGGGGCCCCCAGGCTCCCCTTGG - Intronic
1163817134 19:19473616-19473638 ATGGGCACGCATGCTCACCGTGG - Intronic
1164415040 19:28039906-28039928 AAGTGCACTCAGCCTCCCCTGGG + Intergenic
1165096700 19:33413547-33413569 CGGGGCACCCTGGCTCCCCTGGG - Intronic
1165783313 19:38446377-38446399 AGGGGCCCTGCTCCTCCCCTGGG - Intronic
1165795692 19:38517762-38517784 AGGGAGACCCATGGTCCCCTCGG + Intronic
1166308919 19:41951617-41951639 ACGGACACTCAGTCTCCCCTGGG + Intergenic
1166913304 19:46176701-46176723 AGGGGCTGTCATTCACCCCTGGG + Intergenic
1167223473 19:48219476-48219498 AGGGGCTTTCTTGCTCCCCAGGG - Intronic
1167431054 19:49454601-49454623 CGGGGCTCTCATGATCCCCCAGG + Intronic
1167628148 19:50605983-50606005 AGGGGGTCTCATGCTCTTCTAGG + Intergenic
1168691378 19:58379599-58379621 AGGTGCAAGCATGCTCACCTGGG - Intronic
925140629 2:1547479-1547501 TGTGGCACTCAGGCTCCCCCAGG + Intergenic
927176828 2:20415735-20415757 AGAGGCAGACATGCTCCCCATGG - Intergenic
927636125 2:24818676-24818698 AGGGGGACTCAGGCGCCCCCCGG + Intronic
927720623 2:25379643-25379665 AGGCGCAGTCATGTTCCCTTGGG - Intronic
928327978 2:30335127-30335149 TGGAGCCCTCATCCTCCCCTGGG - Intergenic
928412794 2:31067326-31067348 AGGGGCACTCATCTTCTCTTTGG - Intronic
932667952 2:73711918-73711940 AGGGGCAAACAAGCTCCCTTGGG - Intergenic
935623203 2:105146412-105146434 TGGGGCACACAGGCTCCCTTGGG + Intergenic
935806011 2:106748346-106748368 AGAGGCTCTCATTCTCCACTTGG + Intergenic
935940093 2:108229078-108229100 AGGGCCTCTCATGCTTCCATTGG + Intergenic
935978886 2:108607128-108607150 AGGGGCAAGCAGGCTCCCTTGGG - Intronic
937498343 2:122449893-122449915 AGGTGCACCCATACACCCCTGGG + Intergenic
938482498 2:131673371-131673393 AGGTGCACTCACCCACCCCTGGG - Intergenic
938803565 2:134785843-134785865 AAGGGCACACATGATCCCATTGG + Intergenic
940100289 2:150029703-150029725 TGGGACACTCCTGCTCCCTTTGG - Intergenic
946476075 2:220007672-220007694 AGGGGCAAACAAGCTCCCTTGGG + Intergenic
948142704 2:235685495-235685517 AGAGGCTGTAATGCTCCCCTGGG + Intronic
948657847 2:239487578-239487600 ACGTGCACTCCTGCTCCCATGGG - Intergenic
1175720991 20:61287264-61287286 AGGGGCACTCATGGCCAGCTTGG + Intronic
1175912640 20:62412143-62412165 GGGGGCACGTTTGCTCCCCTGGG - Intronic
1176382429 21:6120038-6120060 AGAGACACACATGGTCCCCTGGG - Intronic
1179741043 21:43418201-43418223 AGAGACACACATGGTCCCCTGGG + Intronic
1181283571 22:21736348-21736370 AGGCGCACACAAGCTCGCCTCGG - Intergenic
1182051848 22:27318294-27318316 GGGGGCACTCATGCACTCCTTGG - Intergenic
1182674694 22:32029727-32029749 AGTGCCACACATGCTCCTCTAGG + Intergenic
1183102804 22:35594217-35594239 CGCAGCACTCAGGCTCCCCTAGG - Intergenic
1183112492 22:35660741-35660763 AGGGGCAAACAAGCCCCCCTGGG + Exonic
1183588539 22:38767102-38767124 AGGGGCACTCATGCTAGGCCAGG + Intronic
1183614129 22:38932248-38932270 AGGGGCAAGCATGCTCCCTCTGG - Intergenic
1183737753 22:39653338-39653360 AGGGGCAGCCATGGTCTCCTGGG + Intronic
952814845 3:37438347-37438369 AGGGGCAAACAAGCTCCCTTGGG + Intergenic
953598431 3:44338863-44338885 TGGTGCATTCATGCTCCTCTAGG + Intronic
960325303 3:116288200-116288222 GGTGGCACTCATGCTCTCTTTGG + Intronic
962301233 3:134244905-134244927 AGGGGCAAACGAGCTCCCCTGGG - Intronic
962419552 3:135216052-135216074 TGGGGCCTTCATGCTTCCCTGGG - Intronic
965759865 3:172064170-172064192 AGGGGCAATCAGGCTCCCTTAGG - Intronic
966051163 3:175618931-175618953 AGGGATAGTCATGCTCACCTGGG + Intronic
967869515 3:194218420-194218442 AGGGGCTCTCAGCCTCCCCTGGG + Intergenic
969323488 4:6427096-6427118 AGTGTCACACTTGCTCCCCTTGG - Intronic
969845580 4:9917735-9917757 AGGGGCAATTTTGCTCCCATGGG + Intronic
972840138 4:42921171-42921193 AGGGGCAAGCAAGCTCCCTTGGG - Intronic
972842249 4:42945082-42945104 AGGGGCAAACAAGCTCCCCTTGG - Intronic
972899793 4:43669156-43669178 AGAGGCAGTCATAATCCCCTTGG - Intergenic
981549762 4:145932036-145932058 AGGGGCACACAAGCTCCCTAGGG - Intronic
982099891 4:151957558-151957580 GGAGGCACTCATTCTCCTCTCGG + Intergenic
982268648 4:153564317-153564339 AGGGGCATACAAGCTCCCTTGGG - Intronic
982446564 4:155497515-155497537 AGGGGCAAACAAGCTCCCTTGGG + Intergenic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
985571144 5:646004-646026 AGCGTCACTCTTGCTCCCATCGG + Intronic
985571151 5:646069-646091 AGCGTCACTCTTGCTCCCATTGG + Intronic
986862074 5:11938132-11938154 AGGGGCAAACAGGCTCCCATAGG + Intergenic
987957888 5:24763777-24763799 AGGTGCTCCCATGCACCCCTGGG - Intergenic
990719014 5:58672255-58672277 AGGGGCACAGGTGATCCCCTGGG + Intronic
992472963 5:77076507-77076529 AGGTGCACTCTGTCTCCCCTCGG - Exonic
996465332 5:123795626-123795648 AGGGGAACTCATAATCCACTGGG + Intergenic
997632946 5:135383813-135383835 TTGGGCACTCATGCTGCACTGGG - Intronic
998876521 5:146605667-146605689 AGGGGCAGTCATGCCCCCTGGGG - Intronic
1002554493 5:180024880-180024902 AGGGGCAGTAAAGCTCTCCTGGG + Intronic
1004479695 6:16006802-16006824 AGCTTCACTCATGCTCACCTTGG + Intergenic
1004826319 6:19425341-19425363 AGGGGCAAACAAGCTCCCTTGGG + Intergenic
1006301329 6:33194908-33194930 GGGGGCACTGAGGCTCCCTTGGG - Intronic
1006950982 6:37820336-37820358 AGGGGCACCCCTGCTCCTCCCGG - Intronic
1007069205 6:39022714-39022736 AGGGGTGCACATGTTCCCCTTGG + Intronic
1007747969 6:44054898-44054920 AGGTGCCCTGATGCTCCCCAAGG + Intergenic
1017718062 6:157225680-157225702 AGGGGCCCGCAGGCTGCCCTTGG + Intergenic
1020920830 7:14262386-14262408 AGGGGCAAGCAAGGTCCCCTGGG - Intronic
1023826849 7:44015392-44015414 TGGGGCACCCAAGCTCTCCTGGG - Intergenic
1024960054 7:54964601-54964623 AGGGGCATGCATGCTCCCCTGGG - Intergenic
1027888203 7:83936633-83936655 TGGGGAACTTATGCTCACCTAGG - Intergenic
1029513167 7:101009466-101009488 AGGGGCACACAGGGTGCCCTGGG + Intronic
1029738000 7:102475143-102475165 TGGGGCACCCAAGCTCTCCTGGG - Intronic
1029755134 7:102568793-102568815 TGGGGCACCCAAGCTCTCCTGGG - Intronic
1029773083 7:102667873-102667895 TGGGGCACCCAAGCTCTCCTGGG - Intronic
1032780149 7:135158775-135158797 AGGTGCTCCCATGCACCCCTGGG - Intronic
1034498436 7:151435509-151435531 GGGGGCACACAGGCTGCCCTTGG + Intronic
1035560715 8:601768-601790 AGGGCCACTCATGCTGCACCCGG + Intergenic
1035761448 8:2071890-2071912 AAGGGCGCTCATTCTCCCCTGGG + Intronic
1036296027 8:7538198-7538220 AAAGGCACTAATGTTCCCCTTGG + Intergenic
1036326539 8:7782821-7782843 AAAGGCACTAATGTTCCCCTTGG - Intergenic
1040550184 8:48431553-48431575 TGGGGGAGCCATGCTCCCCTGGG - Intergenic
1041391983 8:57355001-57355023 AGGTCCATTAATGCTCCCCTGGG - Intergenic
1044220704 8:89665620-89665642 AGAGGCAAACAAGCTCCCCTAGG - Intergenic
1045215745 8:100146606-100146628 AGGGACACTCCTGCTGCTCTTGG + Intergenic
1045759541 8:105587908-105587930 AGGGGCAATTTTGCTCCCCAAGG - Intronic
1049022781 8:139969246-139969268 AGGGGCACAGAAGCTGCCCTGGG - Intronic
1049262760 8:141648656-141648678 CGGGGCCCTCAAGCTCCCCCAGG + Intergenic
1049357206 8:142194865-142194887 AGGGGCACTGCTTCTCCCCGAGG + Intergenic
1050925396 9:11257345-11257367 ATTAGCACTCATGCTCTCCTTGG - Intergenic
1052019804 9:23512588-23512610 AGGCCCACTCCTGCTCCCTTTGG - Intergenic
1052084856 9:24252487-24252509 AGGGGCAAACAAGCTCCCTTGGG + Intergenic
1056760492 9:89411263-89411285 TGGGTCACTCTTGCTTCCCTGGG - Intronic
1056825473 9:89873680-89873702 AGGGGAACTCAGCCTTCCCTGGG - Intergenic
1058248970 9:102668281-102668303 AGGGTGACACAAGCTCCCCTGGG + Intergenic
1058501751 9:105626411-105626433 AGGAGCAATCAAGCTCCCTTAGG + Intronic
1059190527 9:112321797-112321819 AGGGGCCCCCATACTTCCCTAGG + Intronic
1059307663 9:113367502-113367524 TGGGGCAGTCATGTTTCCCTGGG - Intronic
1059510349 9:114839485-114839507 ATGGGCACCCATACTCCTCTAGG + Intergenic
1061421957 9:130477495-130477517 GCGGCCACTCTTGCTCCCCTCGG + Intronic
1186709462 X:12178126-12178148 AGGGGCAAACAAGCTCCCTTAGG - Intronic
1196081959 X:111642082-111642104 AGGGGCGAACAAGCTCCCCTGGG + Intergenic
1196382342 X:115104439-115104461 AGGGGCAATCAAGTTCCCTTCGG - Intergenic
1197997271 X:132391029-132391051 AGCGGCAATCATTCTCCCCACGG + Exonic
1199971674 X:152866236-152866258 AGGGGCAAACAGGCTCCCTTGGG + Intronic
1202278898 Y:23156588-23156610 AAAGGCACTCTTGCTCCCATGGG + Intronic
1202279199 Y:23161367-23161389 AAAGGCACTCTTGCTCCCATGGG + Intronic
1202279349 Y:23163771-23163793 AAAGGCACTCTTGCTCCCATGGG + Intronic
1202285084 Y:23233059-23233081 AAAGGCACTCTTGCTCCCATGGG - Intronic
1202285235 Y:23235463-23235485 AAAGGCACTCTTGCTCCCATGGG - Intronic
1202285538 Y:23240241-23240263 AAAGGCACTCTTGCTCCCATGGG - Intronic
1202285841 Y:23245021-23245043 AAAGGCACTCTTGCTCCCATGGG - Intronic
1202286154 Y:23249772-23249794 AAAGGCACTCTTGCTCCCATGGG - Intronic
1202286306 Y:23252176-23252198 AAAGGCACTCTTGCTCCCATGGG - Intronic
1202368561 Y:24182827-24182849 AGGTGCACTCATGCCCCACCCGG - Intergenic
1202432328 Y:24797441-24797463 AAAGGCACTCTTGCTCCCATGGG + Intronic
1202432480 Y:24799845-24799867 AAAGGCACTCTTGCTCCCATGGG + Intronic
1202437486 Y:24858293-24858315 AAAGGCACTCTTGCTCCCATGGG - Intronic
1202437638 Y:24860697-24860719 AAAGGCACTCTTGCTCCCATGGG - Intronic
1202437940 Y:24865477-24865499 AAAGGCACTCTTGCTCCCATGGG - Intronic
1202502224 Y:25487290-25487312 AGGTGCACTCATGCCCCACCCGG + Intergenic