ID: 1089749045

View in Genome Browser
Species Human (GRCh38)
Location 11:120637221-120637243
Sequence CGGGTGTTCTTGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089749037_1089749045 15 Left 1089749037 11:120637183-120637205 CCAGGTGGGGGTGGGGAGAAAGT 0: 1
1: 1
2: 5
3: 55
4: 507
Right 1089749045 11:120637221-120637243 CGGGTGTTCTTGAGGGAAGCAGG 0: 1
1: 0
2: 1
3: 6
4: 141
1089749035_1089749045 22 Left 1089749035 11:120637176-120637198 CCAGACGCCAGGTGGGGGTGGGG 0: 1
1: 0
2: 6
3: 53
4: 455
Right 1089749045 11:120637221-120637243 CGGGTGTTCTTGAGGGAAGCAGG 0: 1
1: 0
2: 1
3: 6
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089749045 Original CRISPR CGGGTGTTCTTGAGGGAAGC AGG Intronic
900034227 1:393538-393560 CGGCTGTTCTGCAGGGAAGGAGG - Intergenic
900055062 1:623428-623450 CGGCTGTTCTGCAGGGAAGGAGG - Intergenic
900706487 1:4083494-4083516 TGGGTGCTCTTCAGGAAAGCAGG + Intergenic
901239249 1:7683472-7683494 CGGGAGCTCTTTAGGGGAGCTGG + Intronic
902620503 1:17648002-17648024 AGGGTTGTCTTGAAGGAAGCAGG + Intronic
904829890 1:33299779-33299801 GGGGTGGTCTTCAGGGCAGCAGG - Exonic
907468152 1:54653197-54653219 CTGGTGATCTGGAGGGAGGCTGG - Exonic
909013612 1:70360403-70360425 CTTGTGTTCTTGAAGGAAGCAGG - Intronic
912543177 1:110432240-110432262 TAGGTATTCTTGAGGGGAGCAGG - Intergenic
916079273 1:161222356-161222378 TGGGTGTTCTAGAGGCCAGCTGG + Exonic
918210235 1:182343912-182343934 CTGGTGTTCTTAAAGGAAGAGGG + Intergenic
921069787 1:211649445-211649467 TGTGTGTCCTTGGGGGAAGCTGG + Intergenic
922256583 1:223897707-223897729 CGGCTGTTCTGCAGGGAAGGAGG - Intergenic
922272010 1:224043440-224043462 AGGGTGTGCTGGAGGGAAGGAGG - Intergenic
922272106 1:224043732-224043754 GGGGTGTTCTGGAGGGGAGGGGG - Intergenic
922478078 1:225920561-225920583 AGGGTCTTCTTAAGGGCAGCTGG + Exonic
1063005565 10:1967132-1967154 TGGGTGTTCTTGGGGGAGGTGGG + Intergenic
1065849663 10:29777223-29777245 CTGGTGATATTGAAGGAAGCCGG + Intergenic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1069837501 10:71318684-71318706 CGCGTGTTCTTTAAGAAAGCAGG - Intergenic
1069863118 10:71483500-71483522 CCTGGGTTCTTGAGGGAGGCTGG - Intronic
1072297629 10:94026571-94026593 AGGTTGTTTTTAAGGGAAGCTGG - Intronic
1073449288 10:103600211-103600233 GGGGAGTCCTTGGGGGAAGCCGG + Exonic
1074477311 10:113784775-113784797 CGGGCGTTATTGAGGGGAGAAGG + Intergenic
1076260122 10:129058619-129058641 AGGCTGTGCTTGAGTGAAGCAGG - Intergenic
1077846667 11:6032653-6032675 CTGGTGGACTAGAGGGAAGCGGG + Intergenic
1079099289 11:17530947-17530969 CCTGTTTTCTTGAGTGAAGCTGG - Intronic
1080637195 11:34134435-34134457 CTGGTGTGTCTGAGGGAAGCTGG + Intronic
1081757630 11:45555955-45555977 CTGGTCTTGCTGAGGGAAGCAGG - Intergenic
1085048657 11:73368118-73368140 AGGGTTTTCTGGAGGGCAGCAGG + Exonic
1086570263 11:88275778-88275800 AGGCTGTTCTTGAGGTCAGCAGG - Intergenic
1087009803 11:93502327-93502349 TGGGTGTTTTTGAGGGTAGGGGG - Intronic
1089583870 11:119497804-119497826 CGGGTCTGTCTGAGGGAAGCCGG - Intergenic
1089749045 11:120637221-120637243 CGGGTGTTCTTGAGGGAAGCAGG + Intronic
1090204032 11:124875144-124875166 CGGGTGTCTTGGAGGGTAGCAGG + Exonic
1092991052 12:13899934-13899956 TGGGTGTCCTTTAGGGGAGCTGG - Intronic
1093212031 12:16319369-16319391 TGTGTGTTGTTGGGGGAAGCAGG + Intergenic
1095164508 12:38955925-38955947 GGGTTGTTTTTGAGGGAGGCAGG - Intergenic
1095836381 12:46643871-46643893 GGGGTCTTCTTGAGGGTAGAGGG + Intergenic
1099512806 12:83557745-83557767 GGGGTGTACTTGAGGGGAGTCGG - Intergenic
1100344006 12:93709414-93709436 CGGGTCTACTTGAGGGGAGAGGG - Intronic
1100454506 12:94739383-94739405 CGGGTCTACTTGAGGGTGGCGGG - Intergenic
1100772221 12:97936099-97936121 TGGGTGGTCTTGATGGAAACGGG - Intergenic
1102037379 12:109779708-109779730 CTTGTGTCCTTGAGGAAAGCTGG + Intergenic
1103613243 12:122136684-122136706 CGCGTCTTCCTGAGGGAAGAGGG - Intronic
1103898284 12:124289076-124289098 TGTGTGTTCTTGGGGGAAGCTGG - Intronic
1110758906 13:79208322-79208344 AGGGTGATCTTCAGAGAAGCGGG - Intergenic
1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG + Exonic
1116657964 14:47674950-47674972 GAAGTGTTCTTCAGGGAAGCGGG + Exonic
1120013488 14:79444178-79444200 CGGGTATTTTTCAGAGAAGCAGG - Intronic
1122690930 14:103531914-103531936 GGGGCCATCTTGAGGGAAGCTGG + Intronic
1122770220 14:104094566-104094588 AGGGGGTTCGTAAGGGAAGCAGG - Intronic
1123030868 14:105450440-105450462 AGGCTGTTCTGGGGGGAAGCGGG + Intronic
1123922827 15:25082545-25082567 CGGGTGTGCTTGAGAAAGGCAGG - Intergenic
1124637928 15:31376766-31376788 CCGGTGTCCATGAGGGAAGAGGG + Exonic
1131384631 15:91993835-91993857 CGCTTGCTCTGGAGGGAAGCTGG + Intronic
1139937125 16:70579637-70579659 CGAGTGTTCTGGAGAGGAGCTGG + Intergenic
1140270722 16:73464337-73464359 CGGCTCTTCTGGAGGGAAGATGG + Intergenic
1140537814 16:75727024-75727046 AGGTTTTTCTGGAGGGAAGCGGG + Intronic
1140657438 16:77155304-77155326 CTGGGGCTCTTCAGGGAAGCTGG + Intergenic
1141572116 16:84940591-84940613 AGGGCGTTCTTGAGGCAAGAAGG + Intergenic
1144071186 17:11672504-11672526 CTGGTGATTTTGAGGGAAGATGG - Intronic
1144385544 17:14746113-14746135 GGAGTGTTCTTGAAGGCAGCTGG - Intergenic
1145020109 17:19423507-19423529 AGGGTGTTCTAGAGGAAAGATGG - Intergenic
1145915566 17:28571760-28571782 AGTGTGTTCTACAGGGAAGCGGG - Exonic
1147829841 17:43291678-43291700 CGGGTGCTCTTGGGGCAAGGTGG + Intergenic
1149658602 17:58323187-58323209 AATGTGTTCTTGAGGGCAGCAGG + Intronic
1162396102 19:10418902-10418924 GGGGTGTTCCTGAGAGAAGTGGG + Intronic
1167514522 19:49915307-49915329 CAGGGGTTCTTCAGGGAGGCAGG + Intronic
928335237 2:30392254-30392276 CTGGTGTTCTAGAGAGAAGGAGG + Intergenic
929265334 2:39912837-39912859 GGTGTCTTCTGGAGGGAAGCAGG - Intergenic
929547754 2:42866730-42866752 CTGGTGTTCTTGAGCGATGATGG - Intergenic
929989692 2:46775477-46775499 AGGATATTCTTGAGTGAAGCTGG + Intergenic
931083979 2:58808308-58808330 TGGGCATTCCTGAGGGAAGCAGG - Intergenic
936133813 2:109871563-109871585 TGGGTGCTCTTGAGGGGAGAAGG - Intergenic
936210884 2:110499922-110499944 TGGGTGCTCTTGAGGGGAGAAGG + Intergenic
936435412 2:112501025-112501047 TGGGTGCTCTTGAGGGGAGAAGG + Intronic
936706223 2:115077724-115077746 GGGCTGTTCTTGAGGGCAACAGG - Intronic
940266141 2:151841028-151841050 CACGTGTCCTTTAGGGAAGCTGG - Intronic
940338530 2:152555019-152555041 AGGGCGTTCTTAAGTGAAGCTGG + Intronic
943676812 2:190723827-190723849 TGGGTGTGCTTCAGGGAAACTGG - Intergenic
1170523019 20:17207779-17207801 CTTGTCTTCTTAAGGGAAGCTGG + Intergenic
1172125394 20:32622518-32622540 TGGGTGTTCTGGAGGGGACCTGG + Intergenic
1173269256 20:41517027-41517049 CGGGTGTTCAAGAGGGAAGCAGG - Intronic
1174379450 20:50147274-50147296 CCTGTGTTGTTGAGGGAAGCAGG - Intronic
1177832996 21:26160147-26160169 GGGGAATTCCTGAGGGAAGCTGG - Intronic
1179401791 21:41091070-41091092 CTGTGGTTCATGAGGGAAGCGGG - Intergenic
1182320331 22:29474858-29474880 CTGGTTGTCTTGAGGGAAGGAGG - Intergenic
1182443583 22:30377705-30377727 TGGGAGTTCCTGAGGGAGGCTGG + Intronic
1182923199 22:34098928-34098950 GGGGTGGTCTTCAGGGATGCTGG + Intergenic
1183588614 22:38767403-38767425 CTCGTGTTCTTGAGGGATCCAGG - Intronic
1184549446 22:45196737-45196759 CACATGTTCTTGAGGAAAGCCGG - Exonic
950571411 3:13802489-13802511 CTGGAGTTCTGGAAGGAAGCAGG + Intergenic
953657805 3:44867208-44867230 CAGGTGTTGGTGTGGGAAGCAGG - Intronic
954456207 3:50601109-50601131 CTGGTGACCTTGAGGGAAGTAGG - Intergenic
956826606 3:73002975-73002997 CCTGTGTTCTTGAGAGAACCAGG - Intronic
956860142 3:73314664-73314686 CAGGTGATCTAGGGGGAAGCAGG + Intergenic
964687693 3:159415451-159415473 AGGGTGTACTTGAGGGTAGAGGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968807958 4:2787400-2787422 GGGGTGTTTTGGAGGGAGGCGGG + Intergenic
974461230 4:62190655-62190677 TGGGGGTTCTTGGGGGAAGTAGG + Intergenic
977211835 4:94227187-94227209 CTGGTGTTTTTGAGGAAAGTGGG + Intronic
990660190 5:58005075-58005097 TGGTTGTTGTTGAGGGAAACAGG + Intergenic
992752572 5:79874750-79874772 GGGGTGTTCTTGAGCAAAGGTGG - Intergenic
996435898 5:123431845-123431867 TGGGTGTTCTTTAGAGAAGGGGG - Intergenic
996999877 5:129747007-129747029 GGGGTGTTCTTGAATCAAGCAGG - Intergenic
1000371879 5:160544700-160544722 CAGGTGTTTTGGAGGGAGGCAGG + Intergenic
1001426354 5:171625328-171625350 GGGGTGTTGTTGGGGGAAGCAGG - Intergenic
1002739593 5:181425330-181425352 CGGCTGTTCTGCAGGGAAGGAGG + Intergenic
1005495220 6:26382380-26382402 CGGGAGGCCTTGGGGGAAGCAGG - Intergenic
1005499925 6:26420982-26421004 CGGAAGGTCTTGGGGGAAGCAGG - Intergenic
1006885515 6:37378654-37378676 CAGGTGATCTTTAGGGAAGTTGG + Intronic
1006909955 6:37557387-37557409 CGGGTGCTCCTGAGGGAAAGGGG - Intergenic
1009922506 6:70079658-70079680 TTGGTGATCTTGAAGGAAGCTGG + Intronic
1010378445 6:75201928-75201950 CGGCTGTCCCTGAGGGAGGCAGG + Intronic
1010760326 6:79715001-79715023 GGGGTGGGCTTGAGGGAAGGAGG + Intergenic
1011626368 6:89286831-89286853 CTTGTGTTCCAGAGGGAAGCTGG + Intronic
1018680857 6:166263604-166263626 AGGGTGTTCTTGGGGGTATCGGG + Intergenic
1019244709 6:170700917-170700939 CGGCTGTTCTGCAGGGAAGGAGG + Intergenic
1021312465 7:19111108-19111130 GGGGTGATATTGTGGGAAGCTGG - Intronic
1021572490 7:22080606-22080628 GGGGTCTACTTGAGGGAAGAGGG + Intergenic
1022831669 7:34073848-34073870 GGGGTGTTGCTGTGGGAAGCTGG + Intronic
1023382489 7:39623237-39623259 AGGGGGTTCTTGGGGGAAGGAGG - Intergenic
1026209585 7:68292084-68292106 GGGGTCTCCTTGAGGGTAGCAGG + Intergenic
1035503417 8:107271-107293 CGGCTGTTCTGCAGGGAAGGAGG - Intergenic
1040548742 8:48422381-48422403 CGTGCGTTCTGCAGGGAAGCTGG + Intergenic
1042235939 8:66613269-66613291 CGGCGGCTCTTGAGGGAGGCTGG - Intronic
1046394027 8:113615802-113615824 CGGGTGTTGTGGAGGTAAGTGGG - Exonic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1049271926 8:141700575-141700597 GGGGTGGTCTTGGGGGAAGATGG + Intergenic
1049521470 8:143093616-143093638 AGGGAGTTTTTGAGGGAAGGTGG - Intergenic
1049570492 8:143368188-143368210 CGGAGGTTCTGGAGGGAGGCGGG + Intergenic
1051686652 9:19665114-19665136 CGCCTGCTCTTGAGGAAAGCCGG + Intronic
1052735576 9:32339021-32339043 AGGGTGTTCCTGAGGGATACTGG + Intergenic
1052917252 9:33932842-33932864 TGGATGTCGTTGAGGGAAGCTGG - Intronic
1053115092 9:35493138-35493160 AGGGTCTTCTTGAGGGTAGAAGG - Intronic
1055266182 9:74498175-74498197 CGGGAGTTCTGGAGGGACGCGGG + Intronic
1055439617 9:76325148-76325170 CGGGTGTTCGTGTGGGAGGCAGG + Intronic
1058493657 9:105530275-105530297 AGGGTGTCCTTTAGGGAAGTGGG + Intronic
1061377796 9:130236375-130236397 CGGGTGGTCCGGAGGGAGGCTGG + Exonic
1061679387 9:132235591-132235613 GGGGTGGTGCTGAGGGAAGCTGG - Intronic
1062287959 9:135781520-135781542 CAGGTGTCCTTGTTGGAAGCAGG - Intronic
1062706970 9:137951085-137951107 AGGGTGTGCTTGTGGGAAGTTGG + Intronic
1203604899 Un_KI270748v1:50137-50159 CGGCTGTTCTGCAGGGAAGGAGG + Intergenic
1186921007 X:14280258-14280280 GGGGTGTACTTGAGGGTAGAGGG - Intergenic
1194484205 X:94467068-94467090 GGGGTGTACTTGAGGGTAGAGGG + Intergenic
1194585685 X:95731115-95731137 CTGGAGTCCTTGAGGTAAGCAGG + Intergenic
1197132100 X:123017438-123017460 GGGGTGTTCTTGAGGGTGGAGGG - Intergenic
1200330064 X:155286133-155286155 GGGGTGTTCTTGAGGGTGGAGGG - Intronic