ID: 1089752392

View in Genome Browser
Species Human (GRCh38)
Location 11:120660928-120660950
Sequence GTCCCACAGCAACAAGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 222}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089752392_1089752396 -6 Left 1089752392 11:120660928-120660950 CCCTTGCCTTGTTGCTGTGGGAC 0: 1
1: 0
2: 1
3: 16
4: 222
Right 1089752396 11:120660945-120660967 TGGGACGCCCACTTTAGGTGTGG 0: 1
1: 0
2: 1
3: 3
4: 151
1089752392_1089752398 -1 Left 1089752392 11:120660928-120660950 CCCTTGCCTTGTTGCTGTGGGAC 0: 1
1: 0
2: 1
3: 16
4: 222
Right 1089752398 11:120660950-120660972 CGCCCACTTTAGGTGTGGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 71
1089752392_1089752401 2 Left 1089752392 11:120660928-120660950 CCCTTGCCTTGTTGCTGTGGGAC 0: 1
1: 0
2: 1
3: 16
4: 222
Right 1089752401 11:120660953-120660975 CCACTTTAGGTGTGGGCAGGCGG 0: 1
1: 0
2: 1
3: 8
4: 182
1089752392_1089752402 3 Left 1089752392 11:120660928-120660950 CCCTTGCCTTGTTGCTGTGGGAC 0: 1
1: 0
2: 1
3: 16
4: 222
Right 1089752402 11:120660954-120660976 CACTTTAGGTGTGGGCAGGCGGG 0: 1
1: 0
2: 1
3: 14
4: 155
1089752392_1089752397 -5 Left 1089752392 11:120660928-120660950 CCCTTGCCTTGTTGCTGTGGGAC 0: 1
1: 0
2: 1
3: 16
4: 222
Right 1089752397 11:120660946-120660968 GGGACGCCCACTTTAGGTGTGGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089752392 Original CRISPR GTCCCACAGCAACAAGGCAA GGG (reversed) Intronic
900433787 1:2616872-2616894 TTCCCCCATCAACAAGGCTACGG - Intronic
900789912 1:4673033-4673055 GTCCTACAGCCACAAGGAACTGG + Intronic
900826082 1:4928070-4928092 CTCCCACAGCAGCCAGGAAAGGG + Intergenic
902456855 1:16539539-16539561 CTCCCGCAGCAACCAGGCCAGGG - Intergenic
902495314 1:16868374-16868396 CTCCCGCAGCAACCAGGCCAGGG + Intronic
904202577 1:28830889-28830911 GGCCCACAGCAAGAAGCCATTGG + Intronic
904499418 1:30905601-30905623 GTCACACAGCCACAAGGTAGTGG + Intronic
905978190 1:42196345-42196367 GTCCCTAAGCAACAGTGCAATGG - Intronic
906577456 1:46903813-46903835 GTGCCACAGAACCAAGGAAATGG + Intergenic
908874154 1:68650660-68650682 GTCACACAGCTACAATGTAATGG + Intergenic
910291755 1:85606398-85606420 TTCCAACAGAAACAAGGGAAGGG - Intergenic
912261722 1:108117402-108117424 GTCCCACAGCAAATAGACACTGG - Intergenic
913184585 1:116357713-116357735 TTCCCACACCAGCAGGGCAAAGG + Intergenic
913662104 1:121013182-121013204 CTCCCATAGCAACCAGGCCAGGG - Intergenic
914013478 1:143796367-143796389 CTCCCATAGCAACCAGGCCAGGG - Intergenic
914164346 1:145164818-145164840 CTCCCATAGCAACCAGGCCAGGG + Intergenic
914652103 1:149704976-149704998 CTCCCATAGCAACCAGGCCAGGG - Exonic
916166924 1:161973004-161973026 GTCCTCCAGCAACCAGGCTAGGG + Intergenic
916314958 1:163438753-163438775 GTCCCATGTCAACAAGGGAAGGG - Intergenic
918096587 1:181341201-181341223 GACCCAGAGCAGCAAGGCCAAGG - Intergenic
919030991 1:192242468-192242490 GTCCCTCAGCTGCAATGCAAGGG - Intergenic
921054268 1:211532223-211532245 ATACCACAGCTAGAAGGCAACGG - Intergenic
922486680 1:225978497-225978519 GCCCCACACCAGCAAGGCCAAGG + Intergenic
923453165 1:234138845-234138867 CTTCCAAAGCAACAAGGCCAGGG - Intronic
923849373 1:237776693-237776715 CTCCCACAGCAACAACCCAGAGG - Intronic
1063174728 10:3540936-3540958 TTCCCACAGCAACAAGGGCTGGG - Intergenic
1066645007 10:37597567-37597589 GTCTCACTGAATCAAGGCAAGGG - Intergenic
1067480980 10:46597501-46597523 GTCCCACAGCTAGAAGGTGATGG + Intergenic
1067613772 10:47744321-47744343 GTCCCACAGCTAGAAGGTGATGG - Intergenic
1067799700 10:49350571-49350593 GTCACTCAGCAACAGAGCAATGG + Intergenic
1069394109 10:67969626-67969648 CTCCCTCAGCAACAAGACATGGG - Intronic
1069834448 10:71299763-71299785 GTCCAAAAGCAAAAAGGCAAAGG + Exonic
1071075319 10:81743954-81743976 TTCCCAGAGGAACAAGGAAATGG + Intergenic
1071680637 10:87702300-87702322 GTCCCACAGCCAGAAGACACAGG - Intronic
1072804189 10:98414432-98414454 GTCCCAGAGCTGCAAGGCAATGG + Intronic
1072825471 10:98601786-98601808 GTCCCACAGGAACAACGCAGTGG - Intronic
1074118987 10:110479228-110479250 GTCTCACAACAACCTGGCAAAGG - Intergenic
1074530603 10:114296285-114296307 CTCTCACAGCAACAAGGGAGTGG + Intronic
1077480184 11:2810947-2810969 GGCCCACAGCACCAAGACGATGG - Intronic
1079097074 11:17517876-17517898 GTCCCAGAGCTCCAAGGCAAGGG - Intronic
1079603476 11:22339804-22339826 GTCCCACAGCTACCATGGAAAGG + Intronic
1080017185 11:27519912-27519934 TTCTAACAGCAACCAGGCAAAGG - Intergenic
1080957577 11:37117940-37117962 GCACCACAGCAACAAGACAAAGG - Intergenic
1081503448 11:43689958-43689980 GCCCCAAAGCAACAATGCCAAGG - Intronic
1082771072 11:57207806-57207828 CTCACACAGCAAGAAGGAAAAGG + Intergenic
1083710467 11:64545319-64545341 GTCCCAGAGCAGCATGGGAAAGG - Intergenic
1084517756 11:69645644-69645666 GTCCAGCAGGAACAAGGCACTGG - Intronic
1087120450 11:94568934-94568956 GTCCCAAAGGAACATGACAAAGG - Intronic
1087751415 11:102011350-102011372 GCCCCACATCAACCAGGCATTGG - Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1088578779 11:111297633-111297655 CTCCTACAGCAAAAAGGCAGGGG + Intergenic
1089047477 11:115515806-115515828 GTTCCACAGCAAGAGGGCAATGG - Intergenic
1089752392 11:120660928-120660950 GTCCCACAGCAACAAGGCAAGGG - Intronic
1090749026 11:129729885-129729907 GTCCCACAGTCACACGGAAAAGG - Intergenic
1091133401 11:133165691-133165713 GTCACACAGCATCAAGCAAAAGG + Intronic
1092930465 12:13310679-13310701 GTCCCAAAGTAAAAAGGGAAAGG + Intergenic
1094249787 12:28346850-28346872 GTCCCCCAACATCAAGGGAAAGG - Intronic
1096477329 12:51916186-51916208 CTCCCACAGCACCAGGCCAAAGG - Exonic
1097934323 12:65228138-65228160 GACCCACAGCTACAAGAAAATGG - Intronic
1099230996 12:80025686-80025708 GTCCCTCAGAAATAAGGGAAAGG - Intergenic
1104189039 12:126460034-126460056 GCCCTGCAGCAACAGGGCAAAGG - Intergenic
1112186524 13:97133320-97133342 GTCCTACAGCCATAAGGCGATGG - Intergenic
1113217110 13:108055077-108055099 GTGCCACAGCATCAAGCTAATGG - Intergenic
1115747056 14:36448812-36448834 GTCACAGAGCAACAAGCCATGGG + Intergenic
1117318296 14:54596281-54596303 GTCCTAAAGAAACAAGGAAAGGG + Intronic
1117718419 14:58604257-58604279 ATCCAACAGCAACAAGACAATGG - Intergenic
1118077052 14:62310726-62310748 GTCCCATAGCAACAAGGTTTGGG + Intergenic
1119724254 14:76912634-76912656 GTCACACAGTTACAATGCAAGGG - Intergenic
1125385486 15:39132119-39132141 CTACCACAGCAACAAGGTAAAGG + Intergenic
1125427534 15:39564709-39564731 GGCAAACAGCAACAATGCAAGGG + Intergenic
1125479829 15:40072426-40072448 GCCCGACAGCCACAAGGGAACGG - Intergenic
1125494812 15:40182504-40182526 GACCCAAAGCAACACAGCAAAGG - Intronic
1127808697 15:62544375-62544397 GTCCCACAGAAAGATGGCTAAGG - Intronic
1128183701 15:65626261-65626283 GTCACACAGCAAATAGGCAGTGG + Intronic
1129032632 15:72629766-72629788 GTCCCCCAGCCAGAAGGCAGGGG - Intergenic
1129407410 15:75328587-75328609 GTCCCCCAGCCAGAAGGCAGGGG - Intergenic
1129470582 15:75751378-75751400 GTCCCCCAGCCACAGGGCAGGGG - Intergenic
1129734410 15:77951758-77951780 GTCCCGCAGCCAGAAGGCAGGGG + Intergenic
1129841179 15:78744233-78744255 GTCCCGCAGCCAGAAGGCAGGGG - Intergenic
1132092827 15:98959548-98959570 GTCCCCCAGCAAGAAGCAAAGGG - Exonic
1132751662 16:1460472-1460494 GGCCCACAGCAACAGGGAGAAGG + Exonic
1132989122 16:2784125-2784147 GACCCACAGCCGCAAGGCACTGG - Exonic
1133932256 16:10242136-10242158 GGCCTCCAGCACCAAGGCAATGG - Intergenic
1134042857 16:11081437-11081459 GCGCCACAGCAACAAGGACATGG - Intronic
1136396049 16:29993130-29993152 GTTCCACAGACACAGGGCAAGGG + Exonic
1136414965 16:30097280-30097302 GGGCCACTGCAACAAGGCAGTGG - Intergenic
1137581665 16:49637351-49637373 GGCCCACAGCAAGAAGTCCAAGG - Exonic
1139775763 16:69316229-69316251 GGCCCACAGCGACAAGGCCAAGG + Exonic
1140409758 16:74734581-74734603 GGCCCACAGCAGCACGGCAGGGG + Intronic
1142160437 16:88554772-88554794 GTCCCTGAGATACAAGGCAAGGG - Intergenic
1142552487 17:749542-749564 ATCACACAGCCACAAGGTAATGG + Intronic
1142552512 17:749710-749732 GTCACACAGCCACAGGGTAATGG + Intronic
1144889288 17:18484805-18484827 GTCCGACAGCAGGATGGCAATGG - Intronic
1145099587 17:20063264-20063286 GTCCAACAGAAAAAAGGCAAAGG - Intronic
1145792956 17:27639195-27639217 GTCCCACAGCAGGATGGCAATGG - Intronic
1147631924 17:41937838-41937860 GTCCCACATCAACATGGGGATGG + Intronic
1150936042 17:69636839-69636861 GTCCTACAGCAGCAAGGGACTGG - Intergenic
1151250113 17:72827854-72827876 GTCCCACAGTAACCTGGCCAGGG - Intronic
1152253465 17:79223903-79223925 GGCCAAGAGGAACAAGGCAAAGG + Intronic
1152852152 17:82643488-82643510 GTCGCACAGCAACCTGGTAAAGG + Intronic
1156346266 18:36259786-36259808 GTCCCACAAGAGCCAGGCAAAGG - Intronic
1156907149 18:42367503-42367525 GTCACACAGCCTCAAGGAAATGG - Intergenic
1157493782 18:48141161-48141183 GTCCCACAGCAGGAAGGAGAAGG - Intronic
1157587508 18:48814129-48814151 GTCCCACAGCAACACTGAGAAGG - Intronic
1158630160 18:59106484-59106506 GCTCCAGAGCACCAAGGCAAAGG - Intergenic
1160096248 18:75876277-75876299 GTCCCACAGCAGCAAGGACTTGG + Intergenic
1162348380 19:10134506-10134528 GCCCCACAGCCACAAGTCACTGG + Intronic
1163767091 19:19169782-19169804 CACCCACAGCAAGAAGGCATAGG + Intronic
1164495311 19:28754956-28754978 TTCCAGCAGCAACAGGGCAATGG - Intergenic
1167476676 19:49705389-49705411 GTCACACAGCAAGGAAGCAATGG - Intronic
1168633442 19:57975314-57975336 GACCCACAGCAGGAAGGTAAAGG + Intergenic
925191538 2:1888483-1888505 GTCTTACAGAAACAAGGAAATGG - Intronic
925295646 2:2774730-2774752 GTCCCAGGGGACCAAGGCAAGGG - Intergenic
925731781 2:6924285-6924307 GCCCCCCAGCAACACGGCCACGG - Intronic
925869607 2:8257799-8257821 GTCCCTGACCAAGAAGGCAACGG - Intergenic
926336750 2:11869004-11869026 CTCCCACAGCACCGAGGGAAAGG + Intergenic
926383488 2:12314230-12314252 GTCCCACAGCAAGAGCTCAATGG - Intergenic
927852066 2:26505704-26505726 GTCCTACGGCATCGAGGCAAAGG - Intronic
928134583 2:28678660-28678682 GGCCCACAGCACCAAGGACACGG + Intergenic
929636590 2:43528559-43528581 GTCAGACAGCAAGAAAGCAATGG + Intronic
931238390 2:60431378-60431400 GTCCCACAACAAAAAGACACAGG + Intergenic
932002702 2:67899241-67899263 ATCCCCCAGCAAGATGGCAAAGG + Intergenic
932292410 2:70593751-70593773 GTCCCACAGCCCCAGGGCACAGG + Intergenic
933766419 2:85712409-85712431 GGCCCACAGGAACAACGCAGGGG + Intergenic
936500462 2:113062318-113062340 GTCCCACAGCACCAGGGCTGTGG - Intronic
937854553 2:126662978-126663000 GTCCCACAGAGACCAGGGAAAGG + Intronic
940372585 2:152919239-152919261 CTTCCACATCAACAAAGCAAAGG + Intergenic
941997236 2:171612098-171612120 GTCTCACAGCAGCAGGGCAGTGG - Intergenic
942113272 2:172703169-172703191 GTGCTGCAGCCACAAGGCAAGGG + Intergenic
946312031 2:218887386-218887408 GTTCCACAGATAAAAGGCAAGGG + Intronic
946482944 2:220074166-220074188 GTCCCACAGAAATAATGCCAGGG - Intergenic
947070907 2:226287255-226287277 GTCCAAGAGCAGCAAGGCAAGGG + Intergenic
948240899 2:236433491-236433513 TTACAACAGCAACAATGCAAAGG - Intronic
1169183806 20:3594657-3594679 AGCCCACAGCAACAAGACACAGG - Intronic
1169251013 20:4061105-4061127 CTCTCACAGGAACAAGGCCACGG - Intergenic
1173659913 20:44726015-44726037 GTCACACAGCAAAAAGGGGATGG - Intronic
1173748680 20:45458536-45458558 GTCACACAGCAACAAGAGTAGGG + Intergenic
1176385402 21:6136505-6136527 GTGGCACAGCCACAAGCCAAGGG + Intergenic
1178249578 21:30989428-30989450 CTCCCATTGCAGCAAGGCAATGG - Intergenic
1178797233 21:35756099-35756121 GGCCCACAGAGATAAGGCAAAGG + Intronic
1179000222 21:37450763-37450785 TTCTCATAACAACAAGGCAAAGG - Intronic
1179615693 21:42581864-42581886 CTCTCACAGCAGCAGGGCAAAGG + Intergenic
1179738071 21:43401747-43401769 GTGGCACAGCCACAAGCCAAGGG - Intergenic
1179913885 21:44464133-44464155 GTCCCGCAGGAACCAGGCACAGG - Intergenic
1180696776 22:17756323-17756345 GCCCAACAGCCACAAGGCACTGG + Intronic
1180711865 22:17844696-17844718 GTCCCCCAGCAAGGATGCAAAGG - Intronic
1181851268 22:25751591-25751613 GTCCCCCAGCAAGAAAGCCAAGG - Intronic
1182481232 22:30610148-30610170 ATCCCACAGCAACAGGTAAACGG + Intronic
1184354393 22:43969314-43969336 ATCACACAGCAACAAGAAAATGG - Intronic
1184741159 22:46429824-46429846 GTCCTAGAGCATCAAGGGAAAGG - Intronic
950190231 3:10971553-10971575 GTCCCACAGCCAGAAAGTAAAGG + Intergenic
950262826 3:11554683-11554705 GTCCCTCAGAAACAAGGGAGTGG + Intronic
950352439 3:12369548-12369570 CTCCCACAGTAAGAAGTCAATGG - Intronic
950655746 3:14435189-14435211 GTCCCACAGCTACAGGACAGTGG - Intronic
953530406 3:43735438-43735460 GTCCCATAGGGACAAGGCCAGGG + Intergenic
953709112 3:45255013-45255035 GTCCAACAGCCACAAGGAACTGG + Intergenic
953824995 3:46244207-46244229 ATCACACAACAAAAAGGCAATGG + Intronic
956612897 3:71142627-71142649 GTCCTACAGCCAGAAGGAAATGG + Intronic
960131098 3:114056874-114056896 CTCCCACACCAGCAGGGCAAAGG - Intronic
960249707 3:115438405-115438427 GTCCTGCATCAACAAGTCAATGG - Intergenic
960848830 3:122030597-122030619 GTCCCAGAACAAAGAGGCAAGGG + Intergenic
961099788 3:124188864-124188886 GTCCCACAGTAGCAATGCAGAGG + Intronic
962168447 3:133075783-133075805 TTCCCACAGCAACAAAACACAGG - Intronic
962762844 3:138532848-138532870 CTCCCACAGAAATAAGTCAAAGG + Intronic
962923020 3:139967507-139967529 ATCCTTCAGCAACAAGCCAAGGG + Intronic
964706590 3:159625098-159625120 GTTCCACAGACCCAAGGCAAAGG - Intronic
965700595 3:171456930-171456952 GTCACACAGTAACAAGGGGAGGG - Intronic
966798021 3:183734335-183734357 GTCACACAGCAAATAAGCAACGG - Intronic
969468288 4:7370723-7370745 GTCACACAGGATCAAGGCACAGG - Intronic
969675243 4:8610816-8610838 GTCCCACAGACACAAACCAAGGG - Intronic
971361400 4:25941489-25941511 GTCCTACAGCCACAAGGGATTGG + Intergenic
972444960 4:39135278-39135300 TTCCCACAGGAACAAGACAGAGG + Intergenic
976494577 4:85712619-85712641 GTGACACAGCCACAAGCCAAGGG - Intronic
977837955 4:101667272-101667294 GGCGCACAGTTACAAGGCAAAGG - Intronic
983401324 4:167269805-167269827 GTCCCACAGAAATTAGGAAATGG + Intergenic
986626829 5:9730538-9730560 GTCCCAGAGCACCCAGGCACAGG + Intergenic
987417206 5:17675081-17675103 TTCCCTCTGAAACAAGGCAATGG - Intergenic
987640415 5:20605066-20605088 GTCCTACAGCCACGAGGAAATGG + Intergenic
990441970 5:55855666-55855688 GTCTCACAGGACCAAAGCAAAGG - Intronic
991499659 5:67264374-67264396 TTCCTACAGAAACAAGGGAATGG + Intergenic
992390452 5:76326543-76326565 GTCCCACAGCAAAGAGGTACTGG - Exonic
992946954 5:81820468-81820490 GTCCAATAGAAAAAAGGCAAAGG - Intergenic
995775144 5:115717094-115717116 GTCCTACAGCTGCAAGGCAATGG - Intergenic
995990861 5:118238178-118238200 GTAGCACAGCAACATGGCACAGG - Intergenic
996798217 5:127374128-127374150 GTGCTACAGAAACAAGGCATTGG + Intronic
998992458 5:147832916-147832938 CTCCCTCAACAAAAAGGCAATGG - Intergenic
1000118152 5:158172659-158172681 GTCACACAGCTAGAAGGCAGTGG + Intergenic
1000190326 5:158904096-158904118 GTGCCACACCACCAAAGCAAGGG + Intronic
1001556031 5:172637847-172637869 GTCTAACAGCAACAAGGGAAGGG - Intergenic
1008887437 6:56446366-56446388 GTCCCAAAAGAATAAGGCAATGG - Intergenic
1008923654 6:56869173-56869195 GTCATACAAAAACAAGGCAAGGG + Intronic
1010142374 6:72626079-72626101 TTCCCAAATTAACAAGGCAAAGG + Intronic
1011124947 6:83997164-83997186 GTCCCTAAGCAACCAAGCAATGG - Intergenic
1012042503 6:94226695-94226717 CTTCCACATCAACAAGGCACAGG + Intergenic
1013604556 6:111735660-111735682 GTGCCAGATCAAGAAGGCAAGGG + Intronic
1013949513 6:115763001-115763023 GTCCTACAGCCACAAGGAACTGG - Intergenic
1016607154 6:145943247-145943269 GTTCCATTGCAACAAGGCAGTGG + Exonic
1018096063 6:160387966-160387988 GTCCCACAGCCACAAGGACTGGG + Intronic
1018678732 6:166245452-166245474 GTGTCAAAGCAACAAGGCAGGGG - Intergenic
1019225000 6:170501951-170501973 GTCCCACAGCCATCAGGGAAAGG + Intergenic
1020228121 7:6296247-6296269 CTCCCACAGCCAGAAGTCAAGGG + Intergenic
1020429882 7:8107906-8107928 GTCCCACTGCATCATGGCAGGGG + Intergenic
1022138924 7:27475519-27475541 CTCCTACCCCAACAAGGCAAAGG + Intergenic
1022520521 7:31003906-31003928 GTCCCACAAAGACAATGCAAAGG - Intergenic
1022808781 7:33848946-33848968 GTCCCTCAGCTGCAATGCAATGG - Intergenic
1024446588 7:49487098-49487120 TTGCTACAGAAACAAGGCAAAGG + Intergenic
1024456934 7:49619094-49619116 TTCCCCCAGCAGCAAGTCAAGGG + Intergenic
1026347995 7:69491560-69491582 GTCCCAAAGTTACAAGGCAGGGG - Intergenic
1028479111 7:91285148-91285170 GTCCCACAGCAGGAAGTCTAAGG + Intergenic
1032502908 7:132413365-132413387 GTCCCCCAGCATCAAGACAGGGG + Intronic
1033178593 7:139151512-139151534 GTCACACAGCAACTATGCCAGGG - Intronic
1033284589 7:140029855-140029877 GGCCCACAGCAACAAGGAAATGG + Intronic
1034358587 7:150474003-150474025 GTCCCACAGGCCCAAGGGAAAGG + Exonic
1035039322 7:155916132-155916154 GTGTCAGAGCAACAAGCCAATGG - Intergenic
1036784394 8:11676366-11676388 GTCACACAGCAAGAAAGAAATGG - Intergenic
1039580236 8:38659859-38659881 GACCCACAGGAACAATGTAAAGG + Intergenic
1040092042 8:43408679-43408701 GTCCAACACCAACAGGGCAAAGG - Intergenic
1041564649 8:59262694-59262716 GTCTTACAAAAACAAGGCAAAGG - Intergenic
1041678713 8:60564288-60564310 TACCCACAGCACCAAGGGAAAGG - Intronic
1041967363 8:63694784-63694806 GACCTACAGATACAAGGCAATGG + Intergenic
1042681577 8:71391705-71391727 GTCCCAAAGCAGCATAGCAAAGG - Intergenic
1043964088 8:86452088-86452110 CTTCCACACCAGCAAGGCAAGGG - Intronic
1046269337 8:111873089-111873111 GTCACACAGCTTCAAGGCTAAGG - Intergenic
1051108117 9:13603827-13603849 GCCCCGCAGCACCAAGGCAGAGG - Intergenic
1051661502 9:19431309-19431331 GTCTCACAGCTACTAAGCAATGG + Intronic
1052665124 9:31486528-31486550 GACCCACAGGAACAAGAGAATGG - Intergenic
1054928743 9:70614734-70614756 GTCACACAGCAAGTAGGTAATGG + Intronic
1057490557 9:95516616-95516638 GACCCGCAGCGACAAGGCAAGGG - Intronic
1061100362 9:128487362-128487384 GTACCACAGCAGCAATGCCAAGG + Intronic
1061309961 9:129755687-129755709 CTCCCCCAGCAACAAGGGCAGGG - Intergenic
1061650466 9:132044200-132044222 GTCCCTCAGCCACCAGGCAGTGG - Intronic
1188162574 X:26821295-26821317 GTCCCAGAGAAACAGAGCAATGG - Intergenic
1190827409 X:54030059-54030081 GTGCCACAGCAGCAGGGAAAAGG - Intronic
1191958168 X:66668973-66668995 GACACACAGCAAGAAGGAAAAGG + Intergenic
1193632925 X:83911917-83911939 CTCCCACAGCAACAATAAAATGG + Intergenic
1195611118 X:106867768-106867790 TTACCACACCAACAAGGTAAAGG + Intronic
1195643308 X:107201504-107201526 GTCCAACAGCAATAACGGAATGG + Intronic
1198228255 X:134666345-134666367 GTCCCCCAGCAAGTTGGCAATGG - Intronic
1200069606 X:153521455-153521477 GAATCAGAGCAACAAGGCAAGGG + Intronic
1202126341 Y:21572120-21572142 GTCACACTGCAAGAAGGAAAGGG - Intergenic