ID: 1089755635

View in Genome Browser
Species Human (GRCh38)
Location 11:120684398-120684420
Sequence CCATTCAGTTATTCATAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089755635 Original CRISPR CCATTCAGTTATTCATAGTA TGG Intronic
903523209 1:23971087-23971109 TCATTCATTTACTCATAGTTTGG - Exonic
907765161 1:57402836-57402858 CCATTCTTTTATTCAGAGGAAGG - Intronic
908789116 1:67763760-67763782 CCAATCAGTAATTCATAGGGTGG - Intronic
909611033 1:77552076-77552098 CCAATCAGATATTCAGAGTAGGG - Intronic
911363507 1:96908879-96908901 GCATTCAGTTATTAGTGGTAAGG - Intergenic
911504159 1:98727741-98727763 CTATTCGGTTATTGATACTATGG - Intronic
911686795 1:100786723-100786745 CAATTTAGTTATTCATCTTAGGG - Intergenic
921812961 1:219535397-219535419 CCATTCAATTCTACCTAGTAAGG - Intergenic
921963104 1:221056879-221056901 CCATTTTGTTATTAATAGAATGG + Intergenic
922772321 1:228192706-228192728 TCATTCATTCATTCATAGAAAGG - Intergenic
924306551 1:242694797-242694819 CCATCGTGTTATTAATAGTATGG - Intergenic
1065630798 10:27678939-27678961 CCATTCAGGTATTCTTAATTGGG + Intronic
1066590881 10:36992874-36992896 CCATACAGGTATTCATGGAAAGG + Intergenic
1072300931 10:94061367-94061389 CCATCCACAGATTCATAGTATGG - Intronic
1078965464 11:16335217-16335239 CTATTCAGTGATTCAAGGTAAGG + Intronic
1079317880 11:19424984-19425006 CCATTCAGTCAGTCATTCTATGG + Intronic
1080119386 11:28659052-28659074 CCATTCATTTCTTCATTTTAAGG + Intergenic
1081471319 11:43373909-43373931 CCATACAGTTAGTCATAGACTGG + Intronic
1085954804 11:81378824-81378846 TCATTCTGTCATTCATAGTAAGG - Intergenic
1086649425 11:89269415-89269437 ACATTGAATTATTCATAGCAGGG + Intronic
1088319029 11:108535799-108535821 CATATCACTTATTCATAGTAGGG + Intronic
1089755635 11:120684398-120684420 CCATTCAGTTATTCATAGTATGG + Intronic
1092441062 12:8504568-8504590 CCACTCAGTTACTCAGAGTATGG + Intergenic
1093622562 12:21309741-21309763 ACATTCAGTTATTCATTTTCTGG - Intronic
1095359154 12:41314766-41314788 CCATTCAGATATTCCCAATATGG + Intronic
1096857138 12:54491931-54491953 CCATTCAGCTATCCATAATCAGG - Intergenic
1097856252 12:64465861-64465883 CAATTCAGTCATTTTTAGTATGG - Intronic
1098483470 12:70993743-70993765 CCATTCACTTATATATAGAAGGG - Intergenic
1100773244 12:97947223-97947245 CCATGCAGGTATTTATGGTAAGG + Intergenic
1101481932 12:105106975-105106997 CTCTTCAGTGATTCGTAGTATGG + Intergenic
1105362935 13:19737495-19737517 CCATTCAGTGAATCATATCAAGG + Intronic
1112984468 13:105430645-105430667 TTATTCAGTTGTTCATAGCATGG + Intergenic
1113445628 13:110364262-110364284 CCATGCAGTTATTTTTAGTGTGG + Intronic
1114849790 14:26370119-26370141 CCATTCAGTACTTCAATGTAAGG - Intergenic
1116477126 14:45353009-45353031 GCCTTCAGTCATTCATAGAAAGG - Intergenic
1117625304 14:57630722-57630744 TCATTCACTTATTCATAGTTTGG + Intronic
1118357651 14:65028062-65028084 CCATACAGTTATTTATATTGTGG - Intronic
1119874235 14:78043519-78043541 GCACTCAGGTATTTATAGTAAGG + Intergenic
1122333461 14:100946357-100946379 TCAATCAGTTATTCAAAATAAGG + Intergenic
1123571516 15:21615321-21615343 CCATTCAGTAATTTAGAGTGGGG + Intergenic
1123608135 15:22057912-22057934 CCATTCAGTAATTTAGAGTGGGG + Intergenic
1124011144 15:25839694-25839716 CCATTGAGTTATTAATGGTAAGG - Intronic
1125139734 15:36390814-36390836 CCATTCAGTTACTGACATTAAGG - Intergenic
1127648526 15:60983076-60983098 CCATTCAGTTGGTTGTAGTAGGG - Intronic
1129487577 15:75889996-75890018 CCATACAGATCTTCATAGCATGG + Intronic
1132208999 15:100006757-100006779 TCACTCAGTTAATCAAAGTAAGG + Intronic
1202980370 15_KI270727v1_random:349710-349732 CCATTCAGTAATTTAGAGTGGGG + Intergenic
1133521660 16:6564199-6564221 CCATTCATTCATTCACAGTGAGG - Intronic
1137281651 16:46981939-46981961 CTATTCAGTTATTAATAAGAGGG - Intergenic
1144000497 17:11049710-11049732 CCATTGGGTTACTCATAATATGG + Intergenic
1147595369 17:41713388-41713410 CCATTAAGTTTTTCATAATCAGG - Intronic
1149506347 17:57197102-57197124 CCATCCAGTTATTGAGAGCAAGG + Intergenic
1155373236 18:25127072-25127094 CCAATCACTCATTAATAGTATGG - Intronic
1155801607 18:30111819-30111841 CCACTCTTTTATTAATAGTAAGG + Intergenic
1156719830 18:40056695-40056717 CCATTCAGATCTTAATAGTTAGG - Intergenic
1157862991 18:51158223-51158245 TCATTCATTTATTTATAGTTTGG - Intergenic
1158536210 18:58310284-58310306 CCATTCAGTTATACACAGTAAGG - Intronic
1159633301 18:70775144-70775166 CCAAACTATTATTCATAGTATGG + Intergenic
1164758200 19:30706758-30706780 TCATTCATTTATTCATTATATGG - Intronic
930010111 2:46930845-46930867 CCATTCAGCTATTTATGGGAAGG - Intronic
935670595 2:105553619-105553641 CCACTCAGTAATTCATGATAGGG + Intergenic
936347484 2:111686320-111686342 CCATTCATTCATTCATTTTATGG + Intergenic
939542967 2:143516023-143516045 GGATTCAGTTATTCAGAGAAGGG + Intronic
939878936 2:147608287-147608309 CTTTTCAGTCATTCATAGTTAGG - Intergenic
943720170 2:191195919-191195941 GCATTCTGTTATTCCTATTAAGG - Intergenic
943916877 2:193646007-193646029 TTATTCAGTTATTCAAAGCATGG + Intergenic
945437810 2:209839489-209839511 CAACTCAGTGATGCATAGTAGGG + Intronic
945618001 2:212097609-212097631 CCATTTAAATATTGATAGTATGG - Intronic
1169450144 20:5703881-5703903 CCATTTAATTATTCATAGGAAGG - Intergenic
1173432447 20:43001065-43001087 CCAACCAGTTATTCATATAAAGG + Intronic
1178062480 21:28867251-28867273 CTATTCATTTATTCATACTTTGG - Intergenic
1183954571 22:41371713-41371735 CCATCCAGTTCTTCAAAGGAAGG - Intronic
1185265387 22:49899700-49899722 GCACTCAGTTATTCATGGCAGGG + Intergenic
949566342 3:5248305-5248327 ACGTTCAGTCATTCATAGCATGG - Intergenic
954584973 3:51725633-51725655 CCATGCAGTTTTTCATATAAGGG + Intergenic
955457805 3:59143439-59143461 TCATACACTTATTCAAAGTATGG + Intergenic
957178070 3:76838713-76838735 GCATTATGTTATTCATTGTAAGG + Intronic
958006999 3:87824616-87824638 TCATTCAGGGATTCATATTATGG - Intergenic
960707580 3:120495302-120495324 CTATTCAGTTATTCCTTTTATGG - Intergenic
964713160 3:159693866-159693888 CCATTAAGTCATTTATAGAATGG + Intronic
966108525 3:176366207-176366229 CCATTCAGTTCTTGATGGAAAGG - Intergenic
970367555 4:15375121-15375143 CAATTCTGTTTTTCAGAGTAGGG - Intronic
972184344 4:36510712-36510734 CCATTCAGTTAATTATACTTCGG + Intergenic
973662246 4:53119998-53120020 CCCTTCAGGTATGCATAGAAGGG - Intronic
974078558 4:57190204-57190226 CCATTCTGTTCTTCATATTACGG + Intergenic
976995137 4:91422236-91422258 ACATTAAGTTATTGATTGTATGG + Intronic
979193710 4:117894856-117894878 CCATCCAATTCTTCAAAGTAAGG - Intergenic
979301430 4:119091922-119091944 CCAGTCAGTTCTTCATATTGAGG + Intergenic
979526255 4:121720384-121720406 CAATTCATTGATTCATACTAAGG - Intergenic
982753134 4:159186726-159186748 ATATTCAGTTAATCATAGAATGG + Intronic
983661776 4:170136284-170136306 CCATACAGTTTTGCAAAGTAAGG + Intergenic
984081099 4:175251010-175251032 TCATTAAGTTATTCATTGTGTGG - Intergenic
987459914 5:18196908-18196930 ACATTCAGCTATTCTTATTATGG - Intergenic
989295398 5:39819541-39819563 CTATTCAGCTATTCTTATTATGG - Intergenic
990249635 5:53899967-53899989 ACATTCAGTTACTCATAATTTGG - Intronic
990486055 5:56260307-56260329 CCTTTCATCCATTCATAGTATGG - Intergenic
992943508 5:81786632-81786654 CCATTCAGATATGCATATTTTGG + Intergenic
993794075 5:92245097-92245119 TCAGTAAGTTATTCGTAGTATGG - Intergenic
994495049 5:100501459-100501481 CCATTAAGTTACTCATAGCAAGG + Intergenic
1001016981 5:168150595-168150617 CCATTCAGTAATTCACAGTGAGG + Intronic
1005569452 6:27130679-27130701 CAGTTCAGTTATCCTTAGTACGG + Intronic
1006742584 6:36320154-36320176 CCATTTAGTTATTAAGAGAAAGG - Intronic
1007273505 6:40656483-40656505 CCAGTCTGTTCTTCATGGTAGGG - Intergenic
1008353431 6:50520833-50520855 CCATTAAGTGATATATAGTAAGG + Intergenic
1008893309 6:56521722-56521744 ACATTAAGTAATTTATAGTAAGG + Intronic
1012446536 6:99312679-99312701 CCTTACAGTTATTAATAGTATGG - Intronic
1014155236 6:118102187-118102209 CCATTTAGTTATTTATAGACAGG + Intronic
1015275800 6:131382361-131382383 CACTTCAGTTTTTCATAGAACGG + Intergenic
1016099012 6:140074692-140074714 CCAGACAGTTTTTCACAGTATGG - Intergenic
1016360662 6:143264430-143264452 CCAATCAGTTTTTCACAGTGGGG - Intronic
1020821494 7:12973601-12973623 TTGTTCAGTTATTCATTGTATGG - Intergenic
1022170963 7:27830480-27830502 CCATTCAGTTCCTCATTCTAAGG - Intronic
1022864462 7:34403193-34403215 CCATTTCTTCATTCATAGTAAGG - Intergenic
1024117032 7:46204370-46204392 CCATTCATTTAATCATGTTAGGG + Intergenic
1025122795 7:56319491-56319513 CAATTCAGTTATACAACGTATGG + Intergenic
1025711565 7:63915052-63915074 CCATTCATTTATTAATACTTAGG - Intergenic
1026127318 7:67590467-67590489 ACATTTATTTATTTATAGTATGG + Intergenic
1026167206 7:67920869-67920891 CCATTGAGTTACTTATAGTTGGG - Intergenic
1029248126 7:99217362-99217384 CCAGCCAGTTCTTCAAAGTAGGG + Intergenic
1029860914 7:103571094-103571116 CCTTTCAGTTAGTGATAATATGG + Intronic
1032611301 7:133417952-133417974 ACATTTAGTTATTAATACTATGG - Intronic
1035955924 8:4079708-4079730 CCATTGGGCTATTCATACTATGG - Intronic
1036167101 8:6445817-6445839 CCCCTCAGTTATTCATACTATGG - Intronic
1040596946 8:48847663-48847685 TCATTCAGTTACTCATGGCATGG + Intergenic
1041704873 8:60835920-60835942 CCATCCACTTACTCATAGTTGGG - Intronic
1042814412 8:72863123-72863145 CAATTCAGTTCTGCCTAGTAGGG + Intronic
1043014165 8:74917680-74917702 CCATTGAATTATTAAGAGTAAGG + Intergenic
1046653879 8:116872697-116872719 CCTTTCAGGTTTTCATAGTAGGG - Intronic
1047457947 8:125033310-125033332 CTATTCAATTACTCATAGAAGGG - Intronic
1051290481 9:15540317-15540339 CATTTCAATTATTCATTGTAAGG + Intergenic
1061815689 9:133193572-133193594 CAATTCAGTAATACATGGTAGGG - Intergenic
1203493202 Un_GL000224v1:126229-126251 GCATTCAGTCCTTCATAGCACGG - Intergenic
1203505822 Un_KI270741v1:68104-68126 GCATTCAGTCCTTCATAGCACGG - Intergenic
1186644248 X:11489655-11489677 CCATACAGTTATTCATATCTTGG - Intronic
1186820978 X:13287577-13287599 ACATTCAAATATTCATTGTAGGG + Intergenic
1188334780 X:28917546-28917568 TGATTCAGTGATTCTTAGTAGGG + Intronic
1189864775 X:45315566-45315588 TCATTCTGTTTTTCATTGTAAGG - Intergenic
1191965644 X:66754190-66754212 CCATTGACTTATTCCTTGTATGG + Intergenic
1193622620 X:83774741-83774763 TAATTCAGTTATTCTTAATAAGG + Intergenic
1195837301 X:109131231-109131253 CCATTCAGTTACTCTTAGATTGG - Intergenic
1196459778 X:115918176-115918198 ACATTCAGTTAATCGTAGAAGGG + Intergenic
1196600032 X:117590825-117590847 CTATTCAGTTATTGATACTTGGG - Intergenic