ID: 1089758584

View in Genome Browser
Species Human (GRCh38)
Location 11:120706322-120706344
Sequence CCAGGAGTCCAGAAGAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089758584_1089758593 29 Left 1089758584 11:120706322-120706344 CCCAGTTTCTTCTGGACTCCTGG 0: 1
1: 0
2: 2
3: 27
4: 345
Right 1089758593 11:120706374-120706396 CTCTTCCATTCCGACTGCGTTGG 0: 1
1: 0
2: 0
3: 2
4: 63
1089758584_1089758588 2 Left 1089758584 11:120706322-120706344 CCCAGTTTCTTCTGGACTCCTGG 0: 1
1: 0
2: 2
3: 27
4: 345
Right 1089758588 11:120706347-120706369 GATCCAGCCTGAGTGCTGTGTGG 0: 1
1: 0
2: 3
3: 16
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089758584 Original CRISPR CCAGGAGTCCAGAAGAAACT GGG (reversed) Intronic
900181265 1:1312027-1312049 CCAGGAGACCAGCAGCACCTTGG + Exonic
901485256 1:9555650-9555672 CCAAGACTCCAGGAGAAATTGGG + Intronic
901657057 1:10775477-10775499 CCAGGCATCCTGGAGAAACTTGG - Intronic
902151276 1:14445450-14445472 CCAGGAAACCACCAGAAACTGGG + Intergenic
902168234 1:14589896-14589918 GCAGAAGTCCATAAGAATCTGGG + Intergenic
902444704 1:16455091-16455113 CCAGGAGAACAGATAAAACTAGG - Intronic
903032487 1:20473754-20473776 CCTGGAGTTGTGAAGAAACTGGG - Intergenic
903155306 1:21438849-21438871 CCAGGAGAACAGATAAAACTAGG - Intergenic
903448092 1:23435236-23435258 CCAGGAGTTCAGAATCAGCTTGG - Intronic
903878852 1:26494979-26495001 CCAGGAGTCCAAGAGCAGCTTGG + Intergenic
904170909 1:28591910-28591932 CCAGGGCCCCAGAAGGAACTTGG - Intronic
906078203 1:43067546-43067568 CCAGGAGTCCCAAACAAACCCGG + Intergenic
907146877 1:52242691-52242713 CCATCAGTACATAAGAAACTAGG - Intronic
907960760 1:59278716-59278738 CCAGGAGACCAGAAGAATCATGG - Intergenic
909784748 1:79597058-79597080 CCAGGAGTTCAGGAACAACTTGG - Intergenic
913023426 1:114810063-114810085 CCCTGAGTTGAGAAGAAACTGGG + Intergenic
913940560 1:125100331-125100353 CCAGGAGTTCACAAGCAACCTGG + Intergenic
913944060 1:125140544-125140566 CCAGGAGTTCACAAGCAACCTGG - Intergenic
914226094 1:145720851-145720873 CCAGGAGTCCACAAGACTCCAGG + Intronic
914882196 1:151556009-151556031 CTAGGAGTTAAGAAGAAAGTGGG - Intronic
915493649 1:156266060-156266082 CCAGGAGTCCCGATCAGACTTGG - Exonic
917031419 1:170696437-170696459 CCAGCAGTCCAGAAGAGATGTGG + Intronic
917051993 1:170935276-170935298 CCAACAGTCCAGTAGAAGCTGGG - Intergenic
918317438 1:183333619-183333641 CCAGAAGTCCAAAACAAATTAGG - Intronic
919673326 1:200357638-200357660 CCAGGAGTTCAAAACAAGCTTGG - Intergenic
919797568 1:201330617-201330639 CCAGGGGTGCAGGAGTAACTGGG + Exonic
919834620 1:201565338-201565360 CAATGAGCCCAGAAGAAACCAGG - Intergenic
922585734 1:226733990-226734012 TCAGGAGTTCAAAAGCAACTGGG + Intronic
923149108 1:231217980-231218002 CCAGGAGCCCAGAAGCAATACGG + Intronic
923646145 1:235822247-235822269 CCAAGAGTCCTGGAGAAACATGG + Intronic
1064214096 10:13385173-13385195 CCAAGAGTCCAGAAGCTACAAGG + Intergenic
1065549141 10:26852855-26852877 CCAGGAGTTCAGGACAAACCTGG + Intronic
1065676740 10:28183576-28183598 CCAGGAGTTCAGGAGCAGCTTGG + Intronic
1065984906 10:30940069-30940091 CCAGGAGTGCAGAACAAAAATGG + Intronic
1066228402 10:33407509-33407531 CCAGGAGTTCAAGAGCAACTGGG - Intergenic
1066951628 10:42124115-42124137 CCAGGAGTTCAAAAGCAACCTGG + Intergenic
1067419884 10:46135857-46135879 CCAGGAGTTCAGAACCAGCTTGG + Intergenic
1067832362 10:49617487-49617509 CCAGAAGTCCAGGAGAGTCTGGG + Intronic
1067931707 10:50568628-50568650 CCAGGGTTCCAGAAGAGCCTGGG + Intronic
1068316412 10:55349133-55349155 CCATGACTACAGAAGAAACATGG - Intronic
1068403817 10:56564269-56564291 CCAGCATTCCAGAAGAATCAGGG - Intergenic
1068512635 10:57985538-57985560 CCAGGAGTTCAAAACAAGCTGGG + Intergenic
1068705998 10:60076083-60076105 CCAGGGTACCAGAGGAAACTTGG + Exonic
1070775856 10:79109462-79109484 CCAGGAGTCCTGAAGGAACTGGG + Intronic
1071612635 10:87045586-87045608 CCAGGAGTCCACAAGCAGCCTGG - Intergenic
1072335816 10:94397016-94397038 CCAGGAGTTCAGACCAACCTGGG + Intergenic
1072841191 10:98775747-98775769 CCTGGAGTTCAGAAGAAGCCTGG - Intronic
1073562972 10:104512587-104512609 CAAGGAGTCCAGAAGTAGCCTGG - Intergenic
1074141895 10:110680491-110680513 CCAGGAGAACAGATGAGACTTGG - Intronic
1074795676 10:116940439-116940461 CTAAGATTCCAGAAGAAAATGGG + Intronic
1077235166 11:1478489-1478511 CCAGGAGGCCAGAAGGAAGAAGG - Intronic
1077590937 11:3490564-3490586 CCAGGAGACCACAGGAAGCTAGG + Intergenic
1078352744 11:10607974-10607996 CCAGGAGTCAGAAACAAACTTGG - Intronic
1078540043 11:12206065-12206087 CCAGGAGTCCAGTGGAAATTTGG + Intronic
1078825917 11:14930239-14930261 CCAGAAGTCCTGCAGAAACAAGG - Intronic
1078849077 11:15147757-15147779 GCAGGAGCCCAGAATAAACTAGG - Intronic
1079135576 11:17774464-17774486 CCAAGAGTACAGAGGAATCTGGG - Intronic
1079195218 11:18320635-18320657 TCAGGAGTGATGAAGAAACTGGG - Intronic
1079929769 11:26543315-26543337 TCAGGAAGCCAGAAGAAAATGGG + Intronic
1081258479 11:40927842-40927864 CCAGTAATTCAGCAGAAACTAGG - Intronic
1082639678 11:55642784-55642806 CCAGGAGTTCAAAACCAACTTGG - Intergenic
1083068892 11:59955839-59955861 CCAGGAGTCAAGACCAACCTGGG - Intergenic
1084403261 11:68956791-68956813 CCTGGAGTCCACATCAAACTTGG - Intergenic
1084999728 11:73021084-73021106 CCAGGAGTTCAGATCAACCTGGG - Intronic
1087189936 11:95243073-95243095 GCATGAGTCCAGGATAAACTAGG - Intergenic
1087823460 11:102737590-102737612 CCAGGAACCCATCAGAAACTTGG + Intergenic
1089416240 11:118293703-118293725 CCAGGAGTCCAAAAAAGCCTGGG + Intergenic
1089758584 11:120706322-120706344 CCAGGAGTCCAGAAGAAACTGGG - Intronic
1089829998 11:121318894-121318916 TCAGGAGGCCAGAAGAGACAAGG + Intergenic
1091385090 12:88777-88799 CCAGGCCTGCAGAAGAAAATAGG + Intronic
1091829881 12:3542148-3542170 CCCTGAGTCTAGAAGTAACTGGG - Intronic
1091847089 12:3665645-3665667 CCAAGGGTCAAGTAGAAACTGGG + Intronic
1092417223 12:8299561-8299583 CCAGGAGACCACAGGAAGCTAGG + Intergenic
1094613232 12:32013506-32013528 CCAGGAGGGCAGAAGAAAAAGGG - Intergenic
1095973359 12:47921178-47921200 CCAGGAGTTCACATGAAACACGG - Intronic
1096372512 12:51080943-51080965 CCAGGAGTGCAAAACCAACTTGG + Intronic
1096428782 12:51526085-51526107 CCAGGAGTTCAGAACCAACCCGG + Intergenic
1099892416 12:88606137-88606159 CCTAGAGGCCAGAAGAAAGTTGG + Intergenic
1104112097 12:125713884-125713906 GAAGGAGTCCAGAAGAAGCCTGG - Intergenic
1105034030 12:132905362-132905384 TCAGGAGTCCAGAGGAGCCTGGG + Intronic
1108967039 13:56321097-56321119 CCAGGAGTCCAAAAGCAAGGTGG - Intergenic
1109041087 13:57338245-57338267 CCAGGGGTCAAGAAGATATTTGG + Intergenic
1109468311 13:62768492-62768514 CCAGGAGTCGAGACCAACCTGGG - Intergenic
1109680150 13:65741006-65741028 CCAGGTATCAAGAAAAAACTTGG - Intergenic
1110745377 13:79047392-79047414 CCAGGACTCCAGAGGAGAGTGGG - Intergenic
1113733058 13:112656431-112656453 ACAGGAGTTAAGAAGAAATTAGG + Intronic
1114798539 14:25743990-25744012 CCAGGAGTCTAAAAGCAACCTGG - Intergenic
1116760355 14:49005562-49005584 CCAGTTGGCAAGAAGAAACTAGG + Intergenic
1116777801 14:49201767-49201789 CCAGCAAACCACAAGAAACTAGG + Intergenic
1118360721 14:65054318-65054340 CCAGGAGTTCAAAACCAACTTGG - Intronic
1118919130 14:70133777-70133799 CCAGGAATACAGAAGAAGATGGG + Intronic
1119253054 14:73173938-73173960 CCAGGAGTTCACAAGCAGCTTGG + Intronic
1119609356 14:76048640-76048662 CCACTAGACCAGAAAAAACTCGG - Intronic
1119706606 14:76786892-76786914 CCTGAAGTGCAGAAGATACTAGG + Intergenic
1122756706 14:103986158-103986180 ACAGGATTACAGAAGAAACCTGG - Intronic
1123198207 14:106637512-106637534 TCAGGACACCAGAAGAGACTCGG - Intergenic
1123395546 15:19931155-19931177 CCAGGAGTTCAAAAGCAACCTGG - Intergenic
1123922372 15:25079381-25079403 CCAGGAGTCAAGGACAATCTTGG - Intergenic
1124607110 15:31177994-31178016 CTAGGAGTTCACTAGAAACTGGG - Intergenic
1124911221 15:33922639-33922661 CCAGGAGTCCAGACCAGCCTGGG - Intronic
1125494603 15:40180602-40180624 CAAGGAGGCCAGAAGACAGTGGG - Intronic
1126872815 15:53008111-53008133 CCAGGAGCCCAGCTAAAACTGGG + Intergenic
1128012990 15:64316325-64316347 CCAGGAGTTCAGGACAAGCTTGG + Intronic
1130386676 15:83418090-83418112 CCAGGTGGCCAGCAGAGACTTGG + Intergenic
1131544167 15:93302003-93302025 CCATGCTTCCAGAATAAACTAGG - Intergenic
1133356314 16:5139597-5139619 CCAGGAGACCACAGGAAGCTAGG + Intergenic
1133378236 16:5307336-5307358 TCAGTAGTCCAGAAAATACTGGG - Intergenic
1133386880 16:5376961-5376983 CCCTGAGTGCAGAAGAGACTTGG - Intergenic
1133519731 16:6545355-6545377 GCAAGAGGCCAGATGAAACTGGG - Intronic
1133598748 16:7318691-7318713 GCAGAAGTCCAGAAGCCACTAGG - Intronic
1133697692 16:8280523-8280545 TCAGGAGTCCAGGAGAAACTTGG - Intergenic
1133930501 16:10228441-10228463 CCTTGAGTCCAGGAGAAGCTGGG - Intergenic
1134483039 16:14634617-14634639 CCAGGAGACCAGACCAACCTAGG + Intronic
1135223337 16:20633819-20633841 CCAGGAGTTCAAAACAAACCTGG + Intronic
1135334945 16:21593355-21593377 CCTGTAGTCCAGGAGGAACTTGG + Intergenic
1136042355 16:27590380-27590402 CCAGGAGTTCAGACCAAGCTGGG - Intronic
1136140663 16:28286328-28286350 CCAGGAGTTCAGAACCAACCTGG + Intergenic
1136184425 16:28578061-28578083 CCAGGGGTCCAGACGAGCCTAGG - Intronic
1136697991 16:32103336-32103358 CCAGGAGTTCACAAGCAACCTGG - Intergenic
1136769606 16:32824531-32824553 CCAGGAGTTCACAAGCAACCTGG + Intergenic
1136798488 16:33046622-33046644 CCAGGAGTTCACAAGCAACCTGG - Intergenic
1136945891 16:34650482-34650504 CCAGGAGTTCAAAAGCAACCTGG - Intergenic
1136956217 16:34789514-34789536 CCAGGAGTTCAAAAGCAACCTGG - Intergenic
1137088627 16:36160344-36160366 CCAGGAGTTCAAAAGCAACCTGG - Intergenic
1137220004 16:46439665-46439687 CCAGGAGTTCAAAAGCAACCTGG + Intergenic
1138096151 16:54213562-54213584 CCAGGAATCCAGGAGAGTCTGGG + Intergenic
1140328989 16:74034447-74034469 CCAGTAGTCCAGAGGAGAATCGG - Intergenic
1141088674 16:81114966-81114988 CCAGGAGTTCAAAACCAACTTGG + Intergenic
1141397983 16:83721625-83721647 CCAGGAGACCACAAGCTACTTGG - Intronic
1203072023 16_KI270728v1_random:1086636-1086658 CCAGGAGTTCACAAGCAACCTGG + Intergenic
1142822053 17:2477130-2477152 CCAGGAGTCAAGACCAACCTGGG + Intronic
1142847830 17:2690704-2690726 CCAGGAGGCCAGCAGAAACAGGG - Exonic
1144913216 17:18700272-18700294 ACTGAAGCCCAGAAGAAACTTGG + Intronic
1145692167 17:26753573-26753595 CCAGGAGTTCAAAAGCAACCTGG - Intergenic
1146375392 17:32290443-32290465 CCACCAATCTAGAAGAAACTGGG + Intronic
1146468802 17:33108319-33108341 CCAGGAGTCCAGGAGATATTTGG - Intronic
1146692439 17:34885808-34885830 CCAGGAGTTCAAAACCAACTTGG + Intergenic
1151314729 17:73314659-73314681 CCAGGAGTTCAAGAGAAACCTGG + Intergenic
1151392343 17:73795814-73795836 CCTGGAATCCAGCAGACACTGGG - Intergenic
1151505175 17:74522683-74522705 CCACGTTTCCAGAAGAGACTCGG - Exonic
1203183692 17_KI270729v1_random:91120-91142 CCAGGAGTTCACAAGAAACCTGG - Intergenic
1153487459 18:5614360-5614382 CCATGAATCAAGCAGAAACTTGG - Intronic
1155982529 18:32196136-32196158 CCAGAAGGCCAGCAGAAACAGGG - Intronic
1158305558 18:56101483-56101505 CCATGAGTCCAGCAGCAGCTGGG - Intergenic
1158443107 18:57494759-57494781 CCAGGAGTTCAGAAGAAATGGGG + Intergenic
1160288667 18:77570435-77570457 TCAGGAGTTCAGAAGAGCCTGGG + Intergenic
1161845731 19:6710927-6710949 CCAGGGGTGCGGAAGAAACAAGG + Intronic
1161889888 19:7027305-7027327 TCAGTAGTCTAGAAGCAACTTGG - Intergenic
1161891564 19:7043441-7043463 TCAGTAGTCTAGAAGCAACTTGG + Intergenic
1162425710 19:10594187-10594209 CCAGGCATCCAGAAGGAACTAGG - Intergenic
1163739132 19:18999907-18999929 CCAGGAGTCCAGATGACCCCAGG - Intronic
1166347386 19:42175193-42175215 CCAGGAGGCCACAAGGAAGTAGG + Intronic
1166805645 19:45485491-45485513 CCAGGAGTCCAGGAAAGACGAGG - Exonic
1167813328 19:51854541-51854563 CCAGGAGTTCAGGAGAAGCATGG - Intergenic
1168007973 19:53506539-53506561 CCAGTAGACCAGAGGAAGCTAGG - Intergenic
1168133011 19:54332685-54332707 CCTGGAGTCCAGAAGGTGCTAGG - Intergenic
1168333614 19:55584464-55584486 CCAGGAGTTCAGATGAGGCTAGG - Intergenic
1202671810 1_KI270709v1_random:61658-61680 CCAGGAGTTCACAAGCAACCTGG - Intergenic
925575664 2:5357532-5357554 TCAGGAATTCAGAAGAAGCTTGG + Intergenic
926341230 2:11906356-11906378 CCAGGTGTGGAGAGGAAACTGGG + Intergenic
926946634 2:18195158-18195180 CCAGGAGTTCAGAACAAATGGGG - Intronic
927912874 2:26914114-26914136 CCAGTATTACAGAAGAATCTGGG + Intronic
927946577 2:27138332-27138354 CCTTGAATCCAGAAGGAACTGGG + Exonic
928141174 2:28730623-28730645 TCAAGAGCACAGAAGAAACTGGG + Intergenic
929072467 2:38047003-38047025 CCAGAAGATCAGAAGAAAATGGG + Intronic
930527484 2:52548072-52548094 CCAGGAGTTCAAGAGCAACTTGG - Intergenic
930741293 2:54835329-54835351 CCAGGACTCCAGCACACACTAGG - Intronic
930787701 2:55286631-55286653 CCTGGAGGACAGAAGAAACTTGG - Intergenic
931309524 2:61065578-61065600 CCCTGAGTCCAGAAGAAAGGGGG - Intergenic
931709178 2:64973043-64973065 CCAGGGATCCAGATGAAGCTGGG + Intergenic
932030909 2:68183541-68183563 CCAGGATTCCAGAAGGAAAATGG - Intronic
932444980 2:71774644-71774666 CCAGGAGTTCAAGACAAACTTGG - Intergenic
933077243 2:77944443-77944465 ACAGGCATCAAGAAGAAACTAGG + Intergenic
934249615 2:90338648-90338670 CCAGGAGTTCAAAAGCAACCTGG + Intergenic
934259961 2:91464799-91464821 CCAGGAGTTCAAAAGCAACCTGG - Intergenic
934303266 2:91796718-91796740 CCAGGAGTTCAAAAGCAACCTGG - Intergenic
934329993 2:92056037-92056059 CCAGGAGTTCAAAAGCAACCTGG + Intergenic
934468217 2:94285951-94285973 CCAGGAGTTCAAAAGCAACCTGG + Intergenic
935326620 2:101943492-101943514 CGTGGAGTCCAGGAGAAACCAGG + Intergenic
936145569 2:109978471-109978493 CCTGGAATCCAGGAGAGACTGGG + Intergenic
936199117 2:110393007-110393029 CCTGGAATCCAGGAGAGACTGGG - Intergenic
937060627 2:118977967-118977989 CCAGGAGGCCTGAGGGAACTAGG + Intronic
940277771 2:151957354-151957376 CCAGGAATCAAGAGGAATCTAGG - Intronic
940670220 2:156658678-156658700 CCAGGAGTTCAGGACAAACTTGG - Intergenic
940957210 2:159740966-159740988 CCAGGAGTTCAAAACAAGCTTGG + Intronic
941993526 2:171579540-171579562 CCAGGAGTTCAGAACAGCCTGGG - Intergenic
943696461 2:190940672-190940694 CCAGGAAGCCAGAAGAATCCTGG - Intronic
945001364 2:205354525-205354547 CCAGGAGTTCAGAAAAGTCTGGG - Intronic
945895020 2:215471906-215471928 CCAGGAGTTCACAACAAGCTTGG - Intergenic
946061561 2:216946222-216946244 CCAGGACTCCAGAATAAAAATGG - Intergenic
947189132 2:227483487-227483509 CCAGGAGTACAGTAAAAACAAGG - Intronic
947621821 2:231595705-231595727 CCTGGGGTCCTGAAGAAACGAGG - Intergenic
949075120 2:242052342-242052364 CCTTGAGTCCAGAAGAGACACGG - Intergenic
1169200358 20:3706283-3706305 CAAGGGGTCCAGAAGCAGCTTGG + Intronic
1169377091 20:5074870-5074892 CCAGGAGTTCAAAACAAACCTGG - Intronic
1169777699 20:9274229-9274251 CCAGGAGTCCATAAAAAATCAGG - Intronic
1169790722 20:9407578-9407600 CCAGGAGTTCAAGACAAACTTGG - Intronic
1172560280 20:35881868-35881890 ACAGGTGGCCAGAAGAAGCTGGG - Intronic
1172785925 20:37468961-37468983 CCAGGAGGTGAGATGAAACTGGG + Intergenic
1173036602 20:39417628-39417650 TCAGGAGACAAGAAGAAACATGG - Intergenic
1174521964 20:51138633-51138655 CCAGGAGTTCAGGACAAACCTGG - Intergenic
1175937333 20:62519801-62519823 GCAGGAGTCCCCAAGAACCTGGG + Intergenic
1176223005 20:63978996-63979018 TCAGGATTCCAGAAGGAAATGGG + Intronic
1176415510 21:6472289-6472311 CCAGGCGTCCAGGAGGAGCTTGG + Intergenic
1176585662 21:8582398-8582420 CCAGGAGTTCAAAAGAAACCTGG - Intergenic
1177172000 21:17665390-17665412 CCAGCAGACCAGACCAAACTAGG + Intergenic
1178957406 21:37035712-37035734 CCAGGAGTTCAGACCAACCTGGG + Intergenic
1179691010 21:43080622-43080644 CCAGGCGTCCAGGAGGAGCTTGG + Intergenic
1179921091 21:44508037-44508059 CCAGGAGTTCAGAAGTAACAGGG + Intronic
1180268471 22:10559297-10559319 CCAGGAGTTCAAAAGAAACCTGG - Intergenic
1180525246 22:16252575-16252597 CCAGGAGTTCAAAAGCAACCTGG - Intergenic
1182048652 22:27296776-27296798 ACAGGAGCCAACAAGAAACTGGG - Intergenic
1183485082 22:38084223-38084245 CCAGGAGGGGAGAAGAGACTGGG + Intergenic
1203290272 22_KI270735v1_random:30326-30348 CCAGGAGTTCAGGAGCAACCTGG + Intergenic
1203323125 22_KI270737v1_random:88346-88368 CCAGGAGTTCAAAAGCAACCTGG + Intergenic
949203743 3:1412914-1412936 CCAGGTCTTCAGAAGTAACTTGG + Intergenic
950222913 3:11210180-11210202 CCAGGAGTTCAGAGCAACCTGGG + Intronic
950703259 3:14765039-14765061 CCTGGATTCCAGAAGATACTGGG + Intronic
950775390 3:15345503-15345525 CCTGGAGTCCAGAGGAGAGTGGG + Intergenic
951397910 3:22192701-22192723 TCTGGAGTTCAGAAGAAGCTTGG - Intronic
952738680 3:36715018-36715040 CCTGTAGTACAGAATAAACTTGG + Exonic
953776167 3:45819309-45819331 CCAAGGGTTCAGAAGAATCTGGG - Intergenic
954183634 3:48900394-48900416 CCAGGGGGCAAGAAGAAACAAGG + Intergenic
958587849 3:96114492-96114514 CCAGCAGCCCAGCAGACACTGGG - Intergenic
958795945 3:98706454-98706476 CCAGGATTCTTGAGGAAACTGGG + Intergenic
961150824 3:124636506-124636528 GCAGGAGTCCTGAAGCAGCTAGG - Intronic
961292414 3:125858355-125858377 CCAGGAGACCACAGGAAGCTAGG - Intergenic
961894771 3:130158052-130158074 CCAGGAGACCACAGGAAGCTAGG + Intergenic
962665581 3:137650751-137650773 GCAGGAGGTCAGAAGAATCTGGG + Intergenic
963135885 3:141903639-141903661 CCAGGAACCCATAAAAAACTAGG - Exonic
967055829 3:185827243-185827265 CCAGGAGTTGAGAATGAACTTGG + Intergenic
967265969 3:187692600-187692622 CAAGAAGTCCAGGAGAAGCTTGG - Intergenic
969809030 4:9633581-9633603 CCAGGAGACCACAGGAAGCTAGG - Intergenic
971191218 4:24430770-24430792 GCAAGAGTCCAGAAGAGACATGG + Intergenic
971917706 4:32894819-32894841 TCAGAAATCCAGTAGAAACTGGG + Intergenic
972769134 4:42179851-42179873 GCAGGAGTCCAGAACAAGTTGGG + Intergenic
972852012 4:43062065-43062087 CCAGGAGTTCAAGAGCAACTTGG - Intergenic
972925908 4:44006918-44006940 CCAGGAGTTCAAAAGAAATCTGG + Intergenic
973633205 4:52838684-52838706 CCATGAAGCCAGATGAAACTGGG - Intergenic
974381486 4:61146200-61146222 CCAGAAAGCCTGAAGAAACTTGG + Intergenic
975130610 4:70829098-70829120 CCAGGAGTTCAAGAGCAACTTGG - Intronic
975210577 4:71695505-71695527 GAAAGAGTTCAGAAGAAACTAGG + Intergenic
976603819 4:86964025-86964047 CCAGGAGTTCAGAACTAGCTTGG - Intronic
976960538 4:90966413-90966435 CAGGGAGGCCAGAAGAAAGTGGG + Intronic
977972690 4:103229881-103229903 TCAGGAATTCAGCAGAAACTGGG - Intergenic
980367552 4:131824353-131824375 CCAGGAGTCCAGTCCAACCTGGG + Intergenic
980436374 4:132779659-132779681 CCAGGAGTTCAAAACCAACTGGG + Intergenic
980818587 4:137981706-137981728 CCTGGAGTAAAGAAAAAACTCGG + Intergenic
982493341 4:156057894-156057916 CCAGGAGTTCAAAAGAAACCTGG + Intergenic
982671655 4:158327447-158327469 ACAGGAGTTAAGAAGAAATTAGG + Intronic
984382134 4:179008034-179008056 CTAGGAGTGCAGAAGAAAGCTGG + Intergenic
984410328 4:179389866-179389888 CCAGGAGTACAGAGTAAAGTGGG - Intergenic
984744028 4:183196142-183196164 CCAGGAGCCCAGTAGACACTGGG + Intronic
986483670 5:8214123-8214145 CCAGGAAACCAGCAGAAGCTGGG - Intergenic
986941278 5:12953181-12953203 CCAGAAATCCAGAAGACAATGGG + Intergenic
988614689 5:32764135-32764157 TCAGGAGTCCAGTAGAAAGAGGG - Intronic
989257258 5:39379242-39379264 CCAGGAGTTCAGAACCAACCTGG + Intronic
992748698 5:79842714-79842736 CCAGGAGTGCAGAGGAAGCGGGG - Intergenic
992762160 5:79960285-79960307 CCAGGAGGCCAAAGGAATCTAGG - Intergenic
993094361 5:83464539-83464561 CCAGGATTTCTGAAGAAACAAGG - Intergenic
995274538 5:110263075-110263097 CCAGGAATACAGAAGGACCTTGG + Intergenic
995564869 5:113423822-113423844 CCCTGAGTCCAGAAGCAAGTGGG - Intronic
995839843 5:116433266-116433288 CCAGGTGTCCTGCAGAAACCGGG - Intergenic
996238051 5:121158469-121158491 CCAGGTGTCCAGAATAAATTTGG + Intergenic
996329208 5:122311555-122311577 CCAGGGTTCCAGCATAAACTGGG - Intronic
997911544 5:137878914-137878936 CAAAAAGTCCACAAGAAACTGGG + Intronic
998099008 5:139416525-139416547 CCAGGACTCCACCAGAAATTAGG + Intronic
998228150 5:140342516-140342538 CCAGAGGTTGAGAAGAAACTGGG + Intronic
998488441 5:142524406-142524428 GCAATAGTCCAGAAGAAAGTTGG - Intergenic
1001289880 5:170449460-170449482 CAAGGAGTCCAGAGGAAAATCGG + Intronic
1001859145 5:175037912-175037934 CCAGGAGGCCAAAAGACATTTGG - Intergenic
1002044872 5:176536345-176536367 AGAAGAGTCCAGAAGAAACCAGG + Intronic
1002588149 5:180266130-180266152 CCAGCAGTCCAAAAGAAAAATGG + Intronic
1004453323 6:15767768-15767790 CCAGGAGTTCAAGACAAACTTGG - Intergenic
1005792319 6:29316478-29316500 CCGGGAGTCTAGGAGAAACCAGG - Intergenic
1007345942 6:41229467-41229489 CCAGGGGCCCAGAAGAGAGTAGG - Intronic
1007689429 6:43689667-43689689 CCAGGAATCCAGTAGAGACAAGG + Intergenic
1008071895 6:47106626-47106648 CCAGAAATCCACCAGAAACTCGG + Intergenic
1008256881 6:49313040-49313062 CCTGCAGTGCAGAAGAAAATGGG + Intergenic
1008421141 6:51300314-51300336 CCAAGTGTCTAGAACAAACTTGG + Intergenic
1010360015 6:74982279-74982301 CCAGGAGTCAAGGAGTAACTTGG - Intergenic
1013752297 6:113421495-113421517 CCTGGTTTACAGAAGAAACTTGG - Intergenic
1014223817 6:118825244-118825266 CCAGGAGACCAAAAGAAAGAGGG + Intronic
1014322775 6:119951953-119951975 TCAGGAGGCAAGAAAAAACTAGG - Intergenic
1016468678 6:144352012-144352034 CCAGAAGTCAACAAGAAAATAGG - Intronic
1016856209 6:148673086-148673108 CCAGGAGGGCTGAACAAACTGGG - Intergenic
1017057232 6:150448586-150448608 CCAGGAGTTGAGAACAACCTGGG - Intergenic
1020255717 7:6502179-6502201 ACAGTAGTCCAGGAGAAGCTGGG - Intronic
1020372163 7:7444163-7444185 CTAGAAATCCTGAAGAAACTAGG + Intronic
1021152288 7:17166328-17166350 ACAGGAGTAAAGAAAAAACTGGG - Intergenic
1023125475 7:36950457-36950479 CCAGGGGCCCAGGAGAAAATAGG - Intronic
1023496636 7:40804948-40804970 CCTGGAGTTCAGATGAAACAAGG - Intronic
1024226098 7:47327908-47327930 CCAGGAGCACAGAAGACACCAGG + Intronic
1024371929 7:48595658-48595680 CCATTAGTCCAATAGAAACTGGG - Intronic
1024770530 7:52716215-52716237 ACAGGAGTTAAGAAGAAATTAGG - Intergenic
1025250921 7:57350863-57350885 CCAGGTGTCCAGCAGAGAGTGGG + Intergenic
1025321436 7:58098195-58098217 CCAGGAGTTCACAAGCAACCTGG - Intergenic
1025474578 7:60903453-60903475 CCAGGAGTTCACAAGCAACCTGG - Intergenic
1025512425 7:61586421-61586443 CCAGGAGTTCACAAGCAACCTGG + Intergenic
1025556982 7:62321470-62321492 CCAGGAGTTCACAAGCAACCTGG + Intergenic
1026532320 7:71210344-71210366 TCAGGAGTCCAAAACCAACTTGG - Intronic
1027240565 7:76325265-76325287 CTAGGAGACCATAAGAAACTAGG - Intergenic
1027610188 7:80351017-80351039 CCAGGAGTCCAGACCAACCTGGG + Intergenic
1028170859 7:87593839-87593861 GGAGAAGTCCAGAAGAAACCAGG - Intronic
1028706965 7:93860355-93860377 CATGGAGGCCAGAAGAAAGTAGG + Intronic
1029453946 7:100657848-100657870 CTGGGAGCCCAGAAGAACCTGGG - Intergenic
1030178608 7:106681134-106681156 CCAGGAGTTCAAAAGCAGCTTGG - Intergenic
1030376415 7:108757540-108757562 CCTACAATCCAGAAGAAACTGGG + Intergenic
1030602467 7:111608337-111608359 CCAGGAATCCAGTAAAAACCAGG + Intergenic
1030616224 7:111740806-111740828 CCTGGACTGCAGAAGGAACTTGG + Intronic
1030954288 7:115831976-115831998 CCAGGAGTTCAAAACAAACTGGG - Intergenic
1031533123 7:122900177-122900199 CCCTGAGGCAAGAAGAAACTTGG + Intergenic
1031957717 7:127959112-127959134 CCACGAGTTCAGAAGAAGGTGGG + Intronic
1032027591 7:128455952-128455974 GCAGGAGTCCGGAGGAAAGTCGG - Exonic
1032579125 7:133087758-133087780 CCAGGACTCCAGAAGCTTCTAGG + Intergenic
1033002508 7:137522416-137522438 CCAAGAGTCCAGAAGCCACAGGG + Intronic
1033590096 7:142801726-142801748 CCAGGACCCCAGAAGAGAATGGG - Intergenic
1033653063 7:143356456-143356478 CCAGCAGTACAGCTGAAACTGGG - Exonic
1033735920 7:144221686-144221708 AGAGGAATACAGAAGAAACTAGG - Intergenic
1033747131 7:144329266-144329288 AGAGGAATACAGAAGAAACTAGG + Intergenic
1034366364 7:150551908-150551930 CCAGCAGTTCAGGAGGAACTAGG + Intergenic
1035334707 7:158120509-158120531 CCAGGGATCCAGCAGGAACTTGG - Intronic
1037010876 8:13840862-13840884 CCAGAAGTCCAAAATCAACTTGG + Intergenic
1037039093 8:14208834-14208856 ACAGGAGTTAAGAAGAAATTAGG + Intronic
1037564541 8:20106433-20106455 CCAGGGTTCCAGAAATAACTGGG - Intergenic
1038376393 8:27044406-27044428 GCAGGAGTTCAGAAGAGACTTGG + Intergenic
1038422380 8:27441690-27441712 ACAGGAGTCTAGAATTAACTGGG - Intronic
1038646034 8:29363187-29363209 CCAGGGGTGGAGAAGGAACTAGG - Intergenic
1041941916 8:63398072-63398094 CCAGGATTCCACAAGCAGCTAGG + Intergenic
1042225489 8:66511700-66511722 GCAGGAGTCCAGAGGAAGCTGGG + Intronic
1042731894 8:71944825-71944847 CCTTGAGGCAAGAAGAAACTTGG - Intronic
1043185496 8:77142997-77143019 CCAAGAGTCCAAAAGAGAATAGG - Intergenic
1043953424 8:86335702-86335724 CCAGGAGTCCAGAATCAATGGGG + Intergenic
1045315604 8:101041115-101041137 CAAGGTGCCCAGAACAAACTTGG + Intergenic
1046225026 8:111267200-111267222 CCAGGAGTTCAAGAGGAACTCGG + Intergenic
1050632954 9:7580021-7580043 ACAGGAGTCAACAAGAGACTTGG - Intergenic
1052395167 9:27929769-27929791 CCACGAGTCCATAGGAATCTGGG - Intergenic
1053399373 9:37804257-37804279 CCAGAGTTCCTGAAGAAACTGGG - Intronic
1053631898 9:39950078-39950100 CCAGGAGTCCAGTCCAACCTGGG + Intergenic
1053698627 9:40663974-40663996 CCAGGAGTTCAAAAGCAACCTGG + Intergenic
1053773863 9:41513453-41513475 CCAGGAGTCCAGTCCAACCTGGG - Intergenic
1053944632 9:43294211-43294233 CCAGGAGTTCAAAAGCAACCTGG + Intergenic
1054211989 9:62300620-62300642 CCAGGAGTCCAGTCCAACCTGGG - Intergenic
1054309916 9:63463375-63463397 CCAGGAGTTCAAAAGCAACCTGG + Intergenic
1054312997 9:63548209-63548231 CCAGGAGTCCAGTCCAACCTGGG + Intergenic
1054408705 9:64787527-64787549 CCAGGAGTTCAAAAGCAACCTGG + Intergenic
1054441862 9:65271341-65271363 CCAGGAGTTCAAAAGCAACCTGG + Intergenic
1054488421 9:65750156-65750178 CCAGGAGTTCAAAAGCAACCTGG - Intergenic
1055038238 9:71841064-71841086 CCAGGAGTCCAAAACCAACCTGG + Intergenic
1055465193 9:76558637-76558659 TCTGGAGCCCAGAACAAACTTGG - Intergenic
1056707094 9:88960392-88960414 GCAGGAGTCCTCCAGAAACTGGG + Intergenic
1058320188 9:103620506-103620528 CCAGGAGTTCCGAACTAACTTGG + Intergenic
1058543257 9:106034141-106034163 CCAGGGTTGCAGAAGGAACTTGG + Intergenic
1058636556 9:107043960-107043982 CCAGCATTCCAGAAGGAACAGGG - Intergenic
1060438724 9:123618487-123618509 CATGGAGGCCAGCAGAAACTAGG + Intronic
1061221914 9:129257140-129257162 CCTGGAGGCCAGAAGGAGCTTGG - Intergenic
1061562642 9:131415983-131416005 CCAGGAGTCCAGATTTAACTAGG - Intronic
1061644812 9:131992609-131992631 CCAGGAGTTCAAAAGTAGCTGGG - Intronic
1202780993 9_KI270717v1_random:37181-37203 CCAGGAGTTCAAAAGCAACCTGG + Intergenic
1203587767 Un_KI270747v1:22789-22811 CCAGGAGTTCAAAAGCAACCTGG + Intergenic
1203615564 Un_KI270749v1:59920-59942 CCAGGAGTTCAAAAGAAACCTGG - Intergenic
1186730337 X:12403010-12403032 ACAGTAATCCAGAAGAAACATGG - Intronic
1192136039 X:68601476-68601498 CTAGTAGGCCAGAAGAAAGTGGG + Intergenic
1192655687 X:72991294-72991316 CCAGCAGTCCAGTAGAAAAATGG + Intergenic
1194016414 X:88626459-88626481 CCTACAGGCCAGAAGAAACTGGG + Intergenic
1194848112 X:98837592-98837614 CCAGCAGTCCAGAAAATACTGGG - Intergenic
1195567768 X:106362954-106362976 CCAGCAGTCCAGGAGCACCTCGG - Intergenic
1197976159 X:132168048-132168070 CCAGGAAACCAGAAGAACCCTGG + Intergenic
1198191713 X:134313875-134313897 CAAGGAGGCCAAAAGAAAGTAGG + Intergenic
1198263363 X:134986832-134986854 TCAGGAGTCCAGAACCAGCTTGG - Intergenic
1199691571 X:150312824-150312846 CCAGGAGCCCCGAAGAATGTGGG + Intergenic
1200287382 X:154836474-154836496 CAAGGAGGTCAGAAGAAAATTGG - Exonic
1200310462 X:155071801-155071823 TCAGGCGGCCAGAAGAAACGGGG - Intronic
1201675936 Y:16584080-16584102 CCAGGAGTTCAGAGACAACTCGG - Intergenic
1202016360 Y:20410852-20410874 CCAGAAGCCCAGGAGAAATTGGG + Intergenic