ID: 1089759782

View in Genome Browser
Species Human (GRCh38)
Location 11:120714967-120714989
Sequence CAGAGTGGCAAATGCATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 243}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089759782 Original CRISPR CAGAGTGGCAAATGCATGGG AGG Intronic
901107798 1:6770831-6770853 CTGAGTGGTCAATGCCTGGGGGG + Intergenic
904065368 1:27746039-27746061 TAGTGTGGAAAATGCATTGGAGG + Intronic
904315394 1:29656692-29656714 CAGAGTGCCAAATGTGTGAGAGG + Intergenic
905330043 1:37188244-37188266 CAGGATGGCAAATGTATGGCTGG - Intergenic
905799843 1:40836182-40836204 CAGAGTGGCAGCTGCAGAGGTGG + Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
906117841 1:43367664-43367686 GAGAGAGGTAAATGCAGGGGTGG + Exonic
907747217 1:57225062-57225084 CAGAGTGGCAAGATCTTGGGTGG - Intronic
907869056 1:58426367-58426389 CATAGTGTCAAATTCATGGCAGG - Intronic
908164363 1:61443430-61443452 CAGAGAAGCAATTGCATGGCTGG - Intronic
908773265 1:67615393-67615415 CAGAGTGACTAATGCCTGGAGGG + Intergenic
908798614 1:67855758-67855780 CAGAGTGGCAAATGCATATGTGG + Intergenic
909054510 1:70806150-70806172 CAGCGCGGCAAATGGAAGGGGGG + Intergenic
911123632 1:94320106-94320128 CTGAGTGCCAAATGGATAGGGGG - Intergenic
911985321 1:104615699-104615721 CAGAGTGGAAGATGAAGGGGAGG + Intergenic
912796305 1:112695599-112695621 AAGAATGGCAAATGCCGGGGAGG + Intronic
915564167 1:156704812-156704834 CAGAGTGGAAAGTGCAGAGGGGG + Intronic
915804122 1:158826734-158826756 CAGAGTAGAAAATGTATGAGGGG + Intergenic
916744420 1:167673763-167673785 CAAAGTGTCAAAAGCATGGAAGG - Intronic
917577239 1:176336414-176336436 GAGTGTGGCAAATGGATGGAGGG + Intergenic
918161624 1:181906300-181906322 CAAAGTAGCATATGCAGGGGTGG + Intergenic
923086834 1:230708710-230708732 CAGCTCGGCAAATCCATGGGTGG - Intronic
924825420 1:247533129-247533151 CAGAGTGGCAGGAGCAGGGGTGG - Intronic
1063516523 10:6701559-6701581 CAGAGTGGCAGGTGCAAGGCAGG + Intergenic
1065321137 10:24511218-24511240 CAGAGTGCCAGGTGCATGGAGGG + Intronic
1066311210 10:34198818-34198840 CACAGTCCCAAATACATGGGAGG - Intronic
1067188824 10:44052961-44052983 CACATTGCCAAATGCCTGGGAGG - Intergenic
1067582901 10:47456734-47456756 CACAGAGGGAAAAGCATGGGAGG + Intergenic
1070397262 10:76022236-76022258 CAGAGTGTCTAATCCATAGGAGG + Intronic
1070829038 10:79407543-79407565 CAGAGTCTCAAATGCCTGGGCGG + Intronic
1070912817 10:80132940-80132962 CAGAGAGGCAGATGCAGGGAGGG + Intronic
1074859521 10:117499723-117499745 GAGAGTGACAAATGCAGGTGGGG + Intergenic
1075463209 10:122632329-122632351 CACAGTGGAGAATGGATGGGAGG - Intronic
1077118440 11:895970-895992 CGGAGTGGCCACTGCAGGGGAGG - Intronic
1077642609 11:3895112-3895134 CAGAGTGACAAATGTATTGCTGG - Intronic
1077973329 11:7219718-7219740 CAGTGTGGGAAATGAATTGGAGG + Intergenic
1078882877 11:15469923-15469945 CAGAGTGGGGAAGACATGGGTGG + Intergenic
1080689613 11:34545433-34545455 CAGAGTGGGCAAGGCCTGGGAGG - Intergenic
1081489111 11:43553618-43553640 CAGAGCTGCAAATGCCTAGGTGG - Intergenic
1083405792 11:62456094-62456116 CACAGAGGCAAAAGCATGTGAGG + Intronic
1084724914 11:70935231-70935253 CTGAGTGACAAATGGGTGGGTGG - Intronic
1088039307 11:105357765-105357787 CAGAGTGGAAGATACATGTGGGG - Intergenic
1089480012 11:118797015-118797037 CAGAGCAGCAAATGTATGGGGGG - Intergenic
1089596277 11:119582878-119582900 CAGAGAGGCATATGCTAGGGTGG + Intergenic
1089759782 11:120714967-120714989 CAGAGTGGCAAATGCATGGGAGG + Intronic
1090260287 11:125314490-125314512 CAGAGGAGCAAAAGCATGCGGGG - Intronic
1090743420 11:129687613-129687635 CAGAGAGGAAAATGCAGTGGGGG + Intergenic
1091609813 12:1996409-1996431 AAGAATGGCAAAAGCAGGGGCGG - Intronic
1091749310 12:3012572-3012594 CGGAGTGGCAGGGGCATGGGGGG + Intronic
1091820593 12:3472760-3472782 GAGAGAGGGAAATGAATGGGAGG + Intronic
1092092587 12:5815206-5815228 GAGAGTGTAAAATGCATGGCAGG - Intronic
1092936955 12:13373035-13373057 CAGAGTGGCCAATTCAGGTGAGG - Exonic
1094433420 12:30395522-30395544 CAGAGTGTCAATTGCTTGAGGGG - Intergenic
1096067301 12:48751268-48751290 CAAAGAGGCAAATGGATGTGGGG + Intergenic
1096155119 12:49337248-49337270 CAGAGTGGGAAGTGCGGGGGCGG + Intergenic
1099944560 12:89229359-89229381 AAGAGTAGCTAATGCATGCGGGG + Intergenic
1100564609 12:95783187-95783209 CAGCGTGGGAAATGCTGGGGTGG - Intronic
1102713858 12:114952881-114952903 CAGACTGGAAAATGGACGGGAGG - Intergenic
1103209369 12:119155309-119155331 CTGAGTGGCAGATGCCTGGAAGG - Intronic
1105947447 13:25201973-25201995 AAGAGTGGCTAAAGCAAGGGGGG + Intergenic
1106004653 13:25757345-25757367 CACAGTGGCAAGTGCATGCTAGG - Intronic
1107399613 13:40056510-40056532 CACACATGCAAATGCATGGGTGG + Intergenic
1107893271 13:44932810-44932832 CAGAGTGGCAAGGGCAGGGTAGG - Intergenic
1108381529 13:49859466-49859488 CAGAGTGGCATAGGTAGGGGTGG + Intergenic
1108609678 13:52071768-52071790 GAGTGTGGCCACTGCATGGGTGG + Intronic
1108616203 13:52134767-52134789 AGGAGAGGCTAATGCATGGGAGG - Intronic
1108983054 13:56544724-56544746 CAGTGTGGCAAAGGCATATGTGG + Intergenic
1110277147 13:73653092-73653114 CAGAGTGGGAAATGTAGGAGTGG + Intergenic
1112613993 13:100984598-100984620 CAGAGGGGAAAAACCATGGGGGG - Intergenic
1113662950 13:112119512-112119534 CACAGTGACACATGCATGGCTGG + Intergenic
1115187819 14:30711474-30711496 CATGGTGGCACATGCTTGGGAGG + Intronic
1118163989 14:63317912-63317934 GATAGTGACAAATGCATGGTTGG - Intronic
1119080904 14:71692677-71692699 CAGAGTGGCCCAGGAATGGGAGG + Intronic
1120142382 14:80942974-80942996 GATAGTTGCAAATGCATAGGAGG - Intronic
1120679402 14:87462173-87462195 CTGAGTGCCACATGCATAGGAGG + Intergenic
1121534774 14:94683966-94683988 CAGAGAGACAAAGGCAGGGGCGG + Intergenic
1122196225 14:100088216-100088238 CAGACTGGCAAAGGCTTTGGAGG - Intronic
1125769641 15:42156533-42156555 CAGAGTGCCCAAAGCATGGCTGG + Exonic
1126833178 15:52631069-52631091 CTGAGTAGCAACTGCATGGGAGG + Intronic
1128286137 15:66438660-66438682 CAGAGAGCCAAATCCATGGGGGG - Intronic
1128330595 15:66753171-66753193 CTTTGTGGGAAATGCATGGGAGG - Intronic
1128334177 15:66775561-66775583 CAGAGTGGCACTAGCCTGGGAGG - Intronic
1128519666 15:68366999-68367021 CACAGTGGAAAATGCAAGGCTGG - Intronic
1128566618 15:68704951-68704973 CAGAGTGGATAAGGCATGGGAGG - Intronic
1128705709 15:69836315-69836337 CAGTGAGGCAGGTGCATGGGAGG - Intergenic
1129755619 15:78097273-78097295 CTGAGTGGCAGTTACATGGGAGG + Intronic
1131840526 15:96431784-96431806 CAGAGAGGTAAATGCATAGATGG - Intergenic
1132208126 15:100000382-100000404 CTGAGTAGAAAATGAATGGGAGG - Intronic
1134262808 16:12666296-12666318 CAGAGAGGCAAAGTCATGAGTGG + Intronic
1135904550 16:26499223-26499245 CAGAATGGCCAATGCATTGGTGG + Intergenic
1136024118 16:27459101-27459123 CAGATGGACAAATGAATGGGTGG + Intergenic
1137273522 16:46918544-46918566 CAGTGTGGCCAAGGCAAGGGAGG - Intronic
1138553307 16:57758694-57758716 CTGAGTGCAAATTGCATGGGCGG - Exonic
1139608702 16:68039326-68039348 CAGAGTGGCTCATGCCTGTGGGG + Intronic
1140021151 16:71239977-71239999 CAGACTGCTAAATGAATGGGAGG + Intergenic
1140292312 16:73671444-73671466 CAGAGAGACAAATACATGGTTGG + Intergenic
1141031999 16:80597127-80597149 AAGAATGGCAGATGCATGGATGG + Intergenic
1141398291 16:83724172-83724194 GTGAGTGATAAATGCATGGGTGG + Intronic
1141398316 16:83724343-83724365 CTGAGTGATGAATGCATGGGTGG + Intronic
1141422449 16:83925774-83925796 CAGAGTGGGCATTGCCTGGGAGG - Exonic
1141878736 16:86844294-86844316 CGGAGTGGAAAATGCATGGAAGG - Intergenic
1142144597 16:88487640-88487662 CAGACTGGGAAATGCTGGGGTGG - Intronic
1142329848 16:89444864-89444886 CAGTGTGAGAAATGCATGAGGGG + Intronic
1142909274 17:3073064-3073086 CAGAGTGCCAAAAGGATTGGAGG + Intergenic
1142925286 17:3231174-3231196 CAGAGTGCCAAAAGGATTGGAGG - Intergenic
1143150056 17:4802183-4802205 CAGAGAGACAACTGCATGGCAGG - Intergenic
1144163131 17:12581403-12581425 CATTGTAGCAAATGCATGGTGGG - Intergenic
1144433772 17:15220915-15220937 CCGAATGGCAAATGCATGGAGGG - Intergenic
1145003370 17:19321094-19321116 TAGAGTGGGAACTGCATGGCGGG + Intronic
1145982770 17:29023821-29023843 CAGTGAGGCAAACTCATGGGAGG + Intronic
1146002058 17:29136918-29136940 CAGAGTGGCAGAATCATGGTGGG - Intronic
1146366728 17:32234595-32234617 GAGAGTGGGAGAGGCATGGGTGG + Intronic
1148137388 17:45303011-45303033 TCGAATGGCAAATGCATGCGTGG + Intronic
1150524930 17:65912501-65912523 CAGAGAAGCCAGTGCATGGGAGG - Intronic
1153242079 18:3040307-3040329 CTGAGTAGCAAAGGCCTGGGGGG - Intergenic
1157824214 18:50797883-50797905 CAGAGTGGCAAGTGCCAGGCAGG - Intronic
1158413187 18:57225700-57225722 CAGAGAGGCAGATTCATTGGTGG + Intergenic
1161973731 19:7597285-7597307 CAGAGTGGGAAATGCATGCATGG - Intronic
1162295225 19:9808841-9808863 CTGAGTGGGAAGAGCATGGGAGG + Intergenic
1162728988 19:12706352-12706374 CAGGGTGGCAAAAGCACTGGTGG + Exonic
1162898689 19:13781049-13781071 CAAACAGGCAAATCCATGGGGGG + Intergenic
1163675676 19:18654183-18654205 CAGAAGGGCAGATGGATGGGTGG - Intronic
1164596687 19:29534779-29534801 CAGATTGGCAACAGCAGGGGCGG + Intronic
1164941873 19:32257065-32257087 CAGAGTGACAAATGTGTAGGAGG - Intergenic
1165060119 19:33201103-33201125 CACAGTGCCTAATGCATGGCAGG - Intronic
1166088257 19:40491283-40491305 CAGAGTGGCTAGAGAATGGGAGG + Intronic
1167180471 19:47899337-47899359 CACAGTGGCTCATGCCTGGGAGG - Intergenic
925617385 2:5756536-5756558 CAGTGTGGGAAAGGCATGGAAGG + Intergenic
925942161 2:8831014-8831036 CAGTGTGGCAAATGGATTGCAGG - Intronic
926892552 2:17650533-17650555 CAGAGTGGCTGGTGCAGGGGTGG - Intronic
928408242 2:31031842-31031864 CAGAGGGGCAAGAGCATGGCTGG + Intronic
930702481 2:54472596-54472618 CAGAGTGGTAAAAACAGGGGGGG + Intronic
930762706 2:55052816-55052838 CATAGTGGGAAAAGCATGCGGGG - Intronic
931249968 2:60521559-60521581 CAGAGTGGCAATTGCAGAGCTGG - Intronic
933268394 2:80206679-80206701 CAGAGTGGGAGATGTAGGGGAGG - Intronic
936532656 2:113287648-113287670 CAGTGTGGCGAATGGATTGGAGG + Intergenic
937345654 2:121123815-121123837 CAGAGTGGCAGAAACAAGGGTGG - Intergenic
937983417 2:127627857-127627879 CAGAGTGGCACATGCATCTCTGG + Intronic
938407833 2:131042457-131042479 CAGATTGGCAGATGCAAGTGGGG - Intronic
939658604 2:144859063-144859085 CAAGGTGCCAAATGCATGGTCGG - Intergenic
941083175 2:161086099-161086121 CAGAGTGGAGAATGGATTGGAGG + Intergenic
941953953 2:171185290-171185312 CAGAGTGGAAAATGAACTGGAGG - Intronic
942397527 2:175567589-175567611 CAGGGATGCCAATGCATGGGAGG - Intergenic
942671015 2:178376544-178376566 CCCAGTGGAAAATGGATGGGAGG - Intronic
943432139 2:187817169-187817191 CAGTGTGACAAATGAAGGGGTGG + Intergenic
946136400 2:217651208-217651230 CAGAGTAGCAACTGCAAGGAAGG - Intronic
946235558 2:218322805-218322827 CAGAGTGCCAAGTACATAGGAGG + Intronic
947618335 2:231573229-231573251 CAGAGAGGTAAATGCAAGGAGGG - Intergenic
948312559 2:236999642-236999664 CAGACATGCAAATGGATGGGGGG + Intergenic
948671303 2:239570481-239570503 CTGAGTGGCTGATGCAGGGGAGG + Intergenic
949066011 2:241990630-241990652 CAGAGTGACAGATGCATGGATGG - Intergenic
1173941377 20:46913987-46914009 CAGAGTGGTAAAGGGGTGGGAGG - Intronic
1174259430 20:49283060-49283082 CCGAGATGCAAATGCATGGCTGG - Intergenic
1179451106 21:41469017-41469039 GAGAGTGGGAAATGCAGAGGTGG - Intronic
1180204669 21:46251180-46251202 CAGAATGGCAAGAGCATGGATGG + Intronic
1180878658 22:19187916-19187938 CAGAATGGCAGTTGCAGGGGAGG + Intronic
1181600121 22:23946479-23946501 CAGAGTAGCATATGAATGAGAGG + Intergenic
1181988727 22:26820535-26820557 CAGAGTGGGAAATAAATGGATGG - Intergenic
1183092979 22:35536016-35536038 CAGACTGGCAATGACATGGGAGG - Intergenic
1184055383 22:42044195-42044217 CATAGTGGCACATGCCTGGTGGG - Intronic
1185060484 22:48603891-48603913 CAGAGGGGAAAGTGAATGGGGGG + Intronic
950661267 3:14468420-14468442 ATGGGTGGCAAAAGCATGGGGGG + Intronic
953951363 3:47192919-47192941 AAGTGTGTGAAATGCATGGGGGG - Intergenic
957490624 3:80921891-80921913 CAGAATAGTAAATCCATGGGTGG + Intergenic
957557908 3:81783769-81783791 CAGAGAGGGAAATGCATAAGGGG - Intergenic
958720777 3:97840028-97840050 AAGAGTGGCAAATATGTGGGAGG + Intronic
959297721 3:104558290-104558312 AAGAGTAGCTAATGCATGCGGGG - Intergenic
959611433 3:108299526-108299548 CTGAGTTGCAAATTCAGGGGTGG + Intronic
961084741 3:124057227-124057249 CAGAGTGGCAAAAGTGGGGGCGG - Intergenic
961440019 3:126947182-126947204 CAGCCTGGCAGAAGCATGGGTGG - Intronic
963241017 3:143002180-143002202 CGGAGTGGGAAATGCAGAGGCGG + Intronic
964643009 3:158929862-158929884 CATGGTGGCAAATTCATGGTGGG + Intergenic
966457011 3:180128651-180128673 CAGATTTTCAATTGCATGGGGGG + Intergenic
966889640 3:184397774-184397796 CAGACTGGCAAATGCCTGGGTGG - Intronic
969369527 4:6723024-6723046 CAGAGTGGCTAAGCCAAGGGGGG - Intergenic
969525059 4:7700107-7700129 CAGAGGGGCAAAGGCCTGGAGGG - Intronic
979470727 4:121093157-121093179 CAGTGTGGAAAATGGATGGCCGG + Intergenic
981798462 4:148627751-148627773 CACATGGGCAGATGCATGGGAGG - Intergenic
982272607 4:153606395-153606417 CAGTGTGGTAGATGGATGGGAGG + Intronic
983484950 4:168322496-168322518 CAGAGTAGAAAATGAATTGGAGG - Intergenic
983551812 4:169025430-169025452 CAGAGTAACAACAGCATGGGTGG + Intergenic
985787808 5:1908954-1908976 CAGAGTGGTCAATGCCTGTGAGG + Intergenic
986038246 5:3961361-3961383 CAGGGTGGAAAATGCAGGTGGGG - Intergenic
987694667 5:21312286-21312308 AAGAGTGGGAAAGGCATGAGGGG - Intergenic
988158228 5:27482831-27482853 CAAAATGGCAAATGCATAGAGGG + Intergenic
991044953 5:62212805-62212827 CTGAGTGGCAAATGGAGGGGAGG - Intergenic
991745568 5:69737187-69737209 AAGAGTGGGAAAGGCATGAGGGG + Intergenic
991752138 5:69818046-69818068 AAGAGTGGGAAAGGCATGAGGGG - Intergenic
991797135 5:70316940-70316962 AAGAGTGGGAAAGGCATGAGGGG + Intergenic
991824946 5:70612501-70612523 AAGAGTGGGAAAGGCATGAGGGG + Intergenic
991831458 5:70693151-70693173 AAGAGTGGGAAAGGCATGAGGGG - Intergenic
991889514 5:71316473-71316495 AAGAGTGGGAAAGGCATGAGGGG + Intergenic
992497454 5:77307860-77307882 CAGAGAAACAAATGCAGGGGTGG - Intronic
993432852 5:87853224-87853246 CTGAGTGGCTAAAACATGGGTGG + Intergenic
995183625 5:109250664-109250686 CAGAGTGGGTGATGCATGTGTGG - Intergenic
995493964 5:112722476-112722498 CAGTGTGGGAAATGAATTGGAGG - Intronic
995834115 5:116383458-116383480 CAGAGAAGCACATGCATGGCAGG - Intronic
996348975 5:122517763-122517785 AAGAGTCTCAAATGCATTGGTGG - Intergenic
996393273 5:122986826-122986848 CAGATAGGTAAATGCATGGGTGG + Intronic
997600643 5:135136097-135136119 CAGAGCGGGAAATGGGTGGGAGG + Intronic
998791633 5:145771883-145771905 GGGAGTGGGAACTGCATGGGAGG + Intronic
999959825 5:156742561-156742583 CAGAGTGGAAAGTGCATAAGAGG - Intronic
999998705 5:157117218-157117240 CACAGTGGCTCATGCCTGGGAGG + Intronic
1000603074 5:163298130-163298152 CAAAGTGGCAGATGCATGCATGG + Intergenic
1000881453 5:166702703-166702725 AAGAGTCACAAATCCATGGGTGG + Intergenic
1001318939 5:170664367-170664389 CAGAGAGGGAAATGCTAGGGAGG - Intronic
1001530207 5:172455950-172455972 CAGAGGAGCAAATGGAGGGGCGG - Intergenic
1002783903 6:386850-386872 CAGACGGGCAGGTGCATGGGTGG - Intergenic
1004374037 6:15076359-15076381 CAGATTGGAAAAAGCCTGGGAGG + Intergenic
1005094252 6:22095760-22095782 CTGAATTGCAAATGCATAGGAGG - Intergenic
1006714639 6:36108803-36108825 CAAAGTGGCAAAAGCATGACCGG - Exonic
1006897430 6:37480004-37480026 CATAGTAGCAAATGCTGGGGAGG - Exonic
1007388969 6:41538872-41538894 CACAGTGTCTGATGCATGGGTGG + Intergenic
1007448411 6:41924761-41924783 CAGAGTGGAAAATGAGTTGGAGG + Intronic
1009559371 6:65220294-65220316 CAGAGTGTCTAGTGCATGGTAGG - Intronic
1010546516 6:77164301-77164323 GTGAGTGGCAAATGAATGTGAGG - Intergenic
1013177624 6:107690895-107690917 CGGACTGGAGAATGCATGGGAGG + Intergenic
1014350114 6:120330981-120331003 CAGAGTGGCAAATGTCTGTCAGG - Intergenic
1016162021 6:140894169-140894191 CAGTTTGGCAAATGCATCTGAGG + Intergenic
1022353574 7:29588904-29588926 TAGTGTGGCAGGTGCATGGGGGG - Intergenic
1023513651 7:40979079-40979101 CATAATGGAAAAGGCATGGGGGG - Intergenic
1024049453 7:45609582-45609604 CAGAGTGGGAGGGGCATGGGAGG + Intronic
1026509488 7:71016372-71016394 GTGGGTGGCAAATGGATGGGAGG - Intergenic
1028671676 7:93407732-93407754 CAGAGTGGCAAAGGCAGAGTGGG + Intergenic
1028767689 7:94578552-94578574 GAGACTGGCAAATGGGTGGGGGG - Intergenic
1029881065 7:103810315-103810337 CCGAGTGACAAAAGGATGGGAGG - Intronic
1030124234 7:106139386-106139408 CAGAGTGGAAATTTCATGGCTGG - Intergenic
1030290906 7:107871861-107871883 CGGAGTGGGAAATGCATTGATGG + Intergenic
1030594825 7:111525335-111525357 CACAGTGGGACATGAATGGGAGG + Intronic
1032186011 7:129727249-129727271 CAGGGTGGCGACAGCATGGGCGG - Exonic
1032451491 7:132035575-132035597 CAGAGTGGCAGGTGCATATGTGG - Intergenic
1035655784 8:1303719-1303741 CAGAGGAGAAAATGCCTGGGAGG - Intergenic
1036286163 8:7445781-7445803 GAGATTGGCTCATGCATGGGTGG + Intronic
1036335312 8:7865747-7865769 GAGATTGGCTCATGCATGGGTGG - Intronic
1036420674 8:8592767-8592789 CAGAGTTGAAAAAGCATGGCAGG + Intergenic
1038037275 8:23696941-23696963 CTGAGTGAAAAATGCATGAGAGG - Intergenic
1038416690 8:27401759-27401781 CATAATGGAAAATGCATTGGAGG + Intronic
1038845140 8:31222092-31222114 AAAAGTAGCTAATGCATGGGGGG + Intergenic
1042146801 8:65738381-65738403 CAGAGCAGCAAATGCAGGAGAGG + Intronic
1042825224 8:72973077-72973099 GAGAGAGGCGAATGAATGGGAGG - Intergenic
1044628042 8:94253834-94253856 CAGCCTGGAAAATCCATGGGGGG + Intronic
1046368875 8:113273509-113273531 CAGCTTGGCAAAGGGATGGGTGG - Intronic
1047965776 8:130045714-130045736 CAGAGTGGAAGATGCCAGGGTGG - Intergenic
1049872150 8:144988915-144988937 CATGGTGGCACATGCCTGGGAGG - Intergenic
1050291924 9:4164300-4164322 CAGAGAGGCATAAGCATGGGAGG - Intronic
1050366500 9:4878262-4878284 CAGAGAGGAAAATGAATTGGAGG - Intronic
1050619619 9:7439186-7439208 CAGAGTTCCCAATGCCTGGGTGG - Intergenic
1050633996 9:7590895-7590917 CAGGGTAGCAGGTGCATGGGTGG - Intergenic
1053038921 9:34852320-34852342 CAGATTTTCAACTGCATGGGGGG + Intergenic
1056603462 9:88065279-88065301 CTGTGTGGGAAATGCATGAGGGG + Intergenic
1056898977 9:90581053-90581075 CATGGTGGCACATGCCTGGGAGG + Intergenic
1058180423 9:101791600-101791622 CAGAGTGGCAAATAAATGTTGGG + Intergenic
1058225146 9:102351048-102351070 GAGAGTGGCAATTGAAAGGGTGG - Intergenic
1061679006 9:132233453-132233475 CAGAGTGGGAAATGCAGGGGAGG + Intronic
1062322001 9:135994597-135994619 CACAGAGGCGAATGCATTGGGGG + Intergenic
1186454608 X:9701312-9701334 CAAACTGGCCTATGCATGGGAGG + Intronic
1189898578 X:45682403-45682425 TAGAGTGGGAAATGGAAGGGTGG - Intergenic
1191853277 X:65601920-65601942 CAGAATGTCAGATGCTTGGGAGG + Intronic
1194673459 X:96765056-96765078 CAGTGTAGAATATGCATGGGTGG - Intronic
1198028626 X:132733212-132733234 GAGATTGGAAAATGCATGAGAGG - Intronic