ID: 1089761744

View in Genome Browser
Species Human (GRCh38)
Location 11:120731387-120731409
Sequence TTGAACTCCCTTGCATCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 1, 2: 3, 3: 36, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089761744 Original CRISPR TTGAACTCCCTTGCATCCCT GGG Intronic
900580782 1:3407648-3407670 TTAAACTTCCTTGCCTCTCTGGG + Intronic
901166692 1:7226352-7226374 TTCATCACCCTTACATCCCTAGG + Intronic
902526897 1:17065040-17065062 TTGAACATCCCAGCATCCCTTGG + Intergenic
903195720 1:21686494-21686516 TTGAACATCCTTGCATCCCTGGG + Intronic
904650673 1:32003608-32003630 GTGAACTCCCTTCTCTCCCTGGG + Intergenic
904679930 1:32222164-32222186 TTCATCTCCCTAGCTTCCCTGGG - Intronic
907561377 1:55392215-55392237 TTAAACCACCTTGCATCTCTGGG + Intergenic
908150488 1:61296296-61296318 TTAAACTCCCTTGAATCTCCAGG + Intronic
910502809 1:87912880-87912902 TTCAACTACCTTGCATTCCTGGG + Intergenic
910940980 1:92533603-92533625 TTAACCAGCCTTGCATCCCTGGG - Intronic
912264820 1:108146735-108146757 TTGAACAGCCTTGCATCCCAGGG + Intronic
912624241 1:111194529-111194551 CTGAACTGCCCAGCATCCCTGGG - Intronic
915790186 1:158661194-158661216 TTAAATTCCCTTGAAACCCTAGG + Intronic
916033302 1:160897930-160897952 TTAACCTGCCTTGCATCCCAAGG - Intergenic
917801318 1:178573177-178573199 TTTAACCCCCATACATCCCTGGG + Intergenic
918026956 1:180759935-180759957 TTGAACAGCCTTGCATCCCAGGG - Intronic
919003438 1:191864528-191864550 TTGAACAACCTTGCATCTCTGGG - Intergenic
919437617 1:197581969-197581991 TTGATCTTCCTTTCAACCCTGGG + Intronic
921314168 1:213874958-213874980 CTGAACGCCCTTGCCTCACTCGG + Intergenic
922319750 1:224475915-224475937 TGAAACATCCTTGCATCCCTGGG - Intronic
924141614 1:241029614-241029636 TTCAATTACCTTGCATCCCAGGG + Intronic
1063397343 10:5702274-5702296 TGGACCATCCTTGCATCCCTGGG + Intronic
1064150459 10:12859422-12859444 TTGAACCAGCTTGCATCCCAGGG - Intergenic
1065672474 10:28135400-28135422 TTGTACTCCCTTGGAGCCATTGG + Intronic
1066257289 10:33692635-33692657 TTGAACCACCTTGCATCCCAGGG + Intergenic
1066409854 10:35157065-35157087 TGAAACATCCTTGCATCCCTGGG - Intronic
1068736720 10:60421610-60421632 CTGACCTCCCTTGACTCCCTAGG + Intronic
1069198962 10:65589426-65589448 TTGCACAGCCTTGCATCCCAGGG + Intergenic
1069262711 10:66418701-66418723 TTGAACATCCTTGTGTCCCTTGG - Intronic
1071007962 10:80904957-80904979 TTGACCATTCTTGCATCCCTGGG + Intergenic
1072284429 10:93899421-93899443 TTGAACTCCCTACCCTCCCTGGG + Intronic
1074682899 10:115927087-115927109 TTGAACCAGCTTGCATCCCAGGG - Intronic
1075269092 10:121033545-121033567 TTGAACTCCCTTGTGTCATTGGG + Intergenic
1077857887 11:6147332-6147354 TTGAACCAGCTTGCATCCCAGGG - Intergenic
1077860091 11:6170264-6170286 TTGTCCTTCCTGGCATCCCTGGG - Exonic
1078560211 11:12364587-12364609 TGGAAGTCCCAGGCATCCCTTGG + Intergenic
1079707646 11:23640162-23640184 TGAACCTTCCTTGCATCCCTGGG - Intergenic
1080066910 11:28028017-28028039 TTGAACCATCTTGCATCCCTGGG - Intronic
1080239496 11:30110300-30110322 GTGAACACCCTAGCATCCTTTGG + Intergenic
1085178888 11:74515792-74515814 TGGACCATCCTTGCATCCCTAGG - Intronic
1085223872 11:74900626-74900648 TGAAACATCCTTGCATCCCTGGG - Intronic
1086055601 11:82642674-82642696 CTGAACTGCCTTGCTTCTCTAGG - Intergenic
1089761744 11:120731387-120731409 TTGAACTCCCTTGCATCCCTGGG + Intronic
1090013039 11:123062110-123062132 TTGAACTCGCCTGCAGCTCTTGG - Exonic
1090879395 11:130820453-130820475 ATTCTCTCCCTTGCATCCCTGGG - Intergenic
1091167036 11:133487944-133487966 TTAACCATCCTTGCATCCCTGGG - Intronic
1091895222 12:4097377-4097399 TTGAACTCACCTGCAGCTCTTGG + Intergenic
1091911669 12:4236350-4236372 TTGAGCATCCTTGCATCACTGGG + Intergenic
1091925075 12:4339717-4339739 TGAAACATCCTTGCATCCCTGGG - Intronic
1092836934 12:12499255-12499277 TTAAAGTCCCATGCATTCCTAGG - Intronic
1094165892 12:27443185-27443207 TGAAACATCCTTGCATCCCTGGG - Intergenic
1095690811 12:45086436-45086458 TTGATCAGCCTTGCATCCCAGGG + Intergenic
1097568228 12:61297576-61297598 TTGACCAGCCTTGCATCCCAGGG - Intergenic
1100654176 12:96622684-96622706 TTGAAGTCCCTTCCATGGCTTGG + Intronic
1100660058 12:96687031-96687053 TTGAGGTCTCTTGCATTCCTTGG + Intronic
1102085217 12:110131700-110131722 GTGTACACCCTTGTATCCCTAGG - Intronic
1104256032 12:127139625-127139647 TTGAACAGCCTTGTATCCCAGGG + Intergenic
1107807501 13:44167943-44167965 TTGAACATCCTTGCTTCTCTGGG + Intergenic
1108678171 13:52756124-52756146 TTGAAATCCTTAGCATCCTTGGG - Intergenic
1109046103 13:57412885-57412907 TGAACCACCCTTGCATCCCTGGG - Intergenic
1109884708 13:68526959-68526981 TTAAACAGCCTTGCATCCCAGGG - Intergenic
1110089179 13:71424015-71424037 TTGAACTTATTTGCATCCTTTGG + Intergenic
1112083880 13:96007115-96007137 TTGAACTATCCTGTATCCCTGGG - Intronic
1112164815 13:96906904-96906926 CTGAACTCCCACGCATCTCTTGG - Intergenic
1112566525 13:100555804-100555826 TTAAACTACGTTGCATTCCTAGG - Intronic
1116781565 14:49242833-49242855 TTGAACAGCCTTGCAGTCCTTGG + Intergenic
1117242315 14:53846842-53846864 ATGAACTGCCTAGCATACCTCGG + Intergenic
1117633622 14:57720152-57720174 TGAACCTTCCTTGCATCCCTGGG + Intronic
1118376635 14:65183282-65183304 TTGAACTATCTTGCATCCCAGGG + Intergenic
1119771703 14:77224190-77224212 TAGAAGTCCCTTGCTCCCCTCGG - Intronic
1120166107 14:81202150-81202172 CTAAATTCCCTTGCATCCTTAGG - Intronic
1121087792 14:91159895-91159917 CTGAACTCCCTTCTCTCCCTAGG - Intronic
1122148817 14:99711956-99711978 TGAAGCACCCTTGCATCCCTGGG - Intronic
1122260032 14:100511922-100511944 TAGAACAGCCTTGCATTCCTGGG + Intronic
1122620672 14:103056424-103056446 TGGGACCCCCTTGCATCCCCAGG - Intronic
1126554435 15:49969943-49969965 TTGAACCACCTTACATCCCAGGG - Intronic
1127042711 15:54994628-54994650 TTGAACCCATTTGCATCCCAGGG - Intergenic
1129068367 15:72929961-72929983 TGAAACATCCTTGCATCCCTGGG + Intergenic
1130753448 15:86737964-86737986 TGAACCTTCCTTGCATCCCTGGG - Intronic
1130876438 15:88018498-88018520 CTTAACTTCCTTGCTTCCCTAGG + Intronic
1135423973 16:22323278-22323300 TTGGACTCCCTGACACCCCTGGG + Intronic
1135646199 16:24164218-24164240 TTGAATTCCCTTGCTTCCTCTGG + Intronic
1135819705 16:25672490-25672512 TGAAACATCCTTGCATCCCTGGG - Intergenic
1139239544 16:65377021-65377043 TGGAACTGCATTACATCCCTGGG + Intergenic
1139335898 16:66230972-66230994 TTGCACCCCTTTGCCTCCCTGGG - Intergenic
1140262354 16:73391240-73391262 TTGAACTCATCTGCATGCCTTGG - Intergenic
1142601302 17:1054321-1054343 CTGAGCTCCCATGCATCCCAGGG + Intronic
1146016593 17:29238701-29238723 ATGACCTCCCTTTCATCCATGGG - Intergenic
1147572313 17:41579058-41579080 TGGAAGTCCCTGGCATCCCCTGG + Intergenic
1147716380 17:42511585-42511607 TTGAAATACCTGCCATCCCTTGG - Intronic
1150565565 17:66336443-66336465 TTGAGCTCCATTTCATCCCCTGG - Intronic
1150633079 17:66893969-66893991 TTGGATTCCCATGCAACCCTGGG - Intergenic
1152235448 17:79136066-79136088 CTGAGCTCCCTGGCATCCCGTGG + Intronic
1152578953 17:81157591-81157613 TGGAACTCACTTCCGTCCCTGGG - Intronic
1153291079 18:3502113-3502135 TTCAACTTCCTTACACCCCTAGG - Intronic
1157178482 18:45474197-45474219 TTGAACCCCCTTGCATCCCGGGG + Intronic
1158098996 18:53808006-53808028 TTGACCAGCCTTGCATCCCAAGG - Intergenic
1158897176 18:61925474-61925496 ATCAAATGCCTTGCATCCCTGGG + Intergenic
1160138145 18:76292425-76292447 TGAACCACCCTTGCATCCCTGGG + Intergenic
1164361019 19:27510430-27510452 ATGAGCTCCCATACATCCCTAGG - Intergenic
924968835 2:104583-104605 TGAAACATCCTTGCATCCCTGGG + Intergenic
926309330 2:11663284-11663306 GGGAGCTCCCTTCCATCCCTCGG - Intronic
926657448 2:15424255-15424277 TGGAACTGCCTTGGATCCTTAGG - Intronic
928233517 2:29520695-29520717 TTGAACTGGCTTGCTTCACTTGG + Intronic
928449846 2:31368402-31368424 TTTAAATCCCTTTCAACCCTGGG - Intronic
928479839 2:31671428-31671450 TAAAACATCCTTGCATCCCTGGG + Intergenic
930458961 2:51644924-51644946 TGAACCACCCTTGCATCCCTGGG + Intergenic
931003890 2:57825805-57825827 TTGAACCTTCTTGCATCCCAGGG - Intergenic
931027213 2:58124096-58124118 TTGTACTGCCTTGCATTCCAAGG + Intronic
931413413 2:62057370-62057392 TTAAACTACCTTGCATTCCTGGG + Intronic
932135385 2:69224556-69224578 TTGCATTCCATTCCATCCCTAGG + Intronic
933347696 2:81110385-81110407 TGGACCACCCTTGCATCCCAGGG - Intergenic
940095507 2:149969529-149969551 TTGAAGAGCCTTGCATCCCAGGG - Intergenic
941302662 2:163823496-163823518 TTGAACCTTCTTGCATCCCAGGG + Intergenic
942351135 2:175054570-175054592 TGGAACTCCCATGCATTGCTGGG - Intergenic
943250171 2:185510461-185510483 TTGAACTATCCTGCATCCTTTGG - Intergenic
943549655 2:189322992-189323014 TTGAACCAGCTTGCATCCCAGGG - Intergenic
944097114 2:195980679-195980701 TGGATCATCCTTGCATCCCTGGG - Intronic
944163406 2:196691024-196691046 TTGAACTACCTTGCATCCCAGGG + Intronic
944685896 2:202117493-202117515 TTGTCCTCCCTTACATCTCTCGG - Intronic
944715058 2:202369669-202369691 TTGACCTCCCTGACATCCTTTGG - Intergenic
945371487 2:209023977-209023999 TTGAACACCCTTGTATCCCAGGG - Intergenic
1170283709 20:14681148-14681170 TTGAACTCTCTTACATTGCTGGG + Intronic
1172164218 20:32889125-32889147 ATAAACTCCCTAGCCTCCCTGGG - Intronic
1174074470 20:47923201-47923223 ATGAACTTTCTTGAATCCCTGGG + Intergenic
1177090527 21:16761595-16761617 TGAAACTTCCTTGCATCCCAGGG - Intergenic
1182994304 22:34798763-34798785 TTGATCTCCCAGGCATCCCTAGG + Intergenic
1183930355 22:41232579-41232601 TTGAATTCCTTTGTATTCCTGGG + Intronic
949173578 3:1032213-1032235 TTGAACCACCCTGCATCCCAGGG + Intergenic
949250258 3:1974951-1974973 TGGAGCATCCTTGCATCCCTGGG - Intergenic
950946236 3:16949945-16949967 TTGAATTCCCTTGTATTCATTGG + Intronic
952149398 3:30571163-30571185 TTGAACTATCTTGTATCCCAGGG - Intergenic
954563201 3:51576167-51576189 TTGAACAGCCTTGCATCCCAGGG + Intronic
954731996 3:52672158-52672180 TAGAGCTCACCTGCATCCCTTGG + Intronic
956854374 3:73261540-73261562 TTGAACTCAGAGGCATCCCTGGG + Intergenic
958044962 3:88272892-88272914 TAAAACTGCCTTGCATTCCTGGG + Intergenic
958677655 3:97287729-97287751 TGAACCACCCTTGCATCCCTGGG + Intronic
959523597 3:107349513-107349535 TTGAACTCCCTTGCATACCTGGG + Intergenic
959563143 3:107805514-107805536 TTGGACTCACTAGCATCCCTCGG - Exonic
960415865 3:117383849-117383871 TGAAACTTACTTGCATCCCTAGG - Intergenic
960734700 3:120765917-120765939 ATGTTCTCCCTTGCATGCCTTGG + Intronic
962689539 3:137880221-137880243 TTGAACTCGCCTGCAGCTCTCGG + Intergenic
962758799 3:138489319-138489341 TGAATCTTCCTTGCATCCCTGGG + Intergenic
963178435 3:142326936-142326958 TTAAACATCCTTGCATACCTGGG + Intronic
963741026 3:149081819-149081841 TTAAACTCCCTTTTATGCCTTGG - Intronic
963758773 3:149263681-149263703 TGAAACATCCTTGCATCCCTGGG - Intergenic
965257298 3:166430412-166430434 TTGAACCATCTTGCATCCCTGGG - Intergenic
965895651 3:173572277-173572299 TTAGAATCCCTTGGATCCCTTGG - Intronic
966594034 3:181710908-181710930 TTCAACTTCCTGGCATCCCACGG - Intergenic
967401402 3:189066488-189066510 TGGAGCATCCTTGCATCCCTGGG - Intronic
971602491 4:28611855-28611877 TTGAACATCCTTGCATCCAAGGG - Intergenic
972738292 4:41866342-41866364 TCGAACTCCTTCGCATCCCGGGG - Intergenic
972820702 4:42698610-42698632 TTGAACAGCCTTGCATCCCAGGG + Intergenic
972941324 4:44198171-44198193 TATAACTCACTGGCATCCCTGGG + Intronic
973762326 4:54129813-54129835 TTGACCATTCTTGCATCCCTGGG + Intronic
974290988 4:59930322-59930344 TGAATCTTCCTTGCATCCCTGGG - Intergenic
974899357 4:67978360-67978382 TGAAACTCCCTTGCATCCCGGGG + Intergenic
976188509 4:82467059-82467081 TTGCAGTACCTTGCAGCCCTAGG - Intergenic
976202147 4:82589618-82589640 TTAAGCTCCCTTCCATCTCTTGG + Intergenic
976533971 4:86190067-86190089 TGAAACACCCTTGCATCCCAGGG + Intronic
977273902 4:94951578-94951600 TTGATTTGCCTTGCATCCCAGGG + Intronic
977621670 4:99145083-99145105 TTCAACTCTGTTGCAGCCCTGGG + Intronic
978139438 4:105300884-105300906 TTGAACAGCCTTGCATCCCAGGG - Intergenic
979692705 4:123576800-123576822 CTCAACTTCCTTGCTTCCCTTGG - Intergenic
980512846 4:133816041-133816063 TTGACCATCCTTGCATCCCAGGG - Intergenic
980810571 4:137873393-137873415 TTGAACCATCTTGCATCCCAAGG + Intergenic
980956206 4:139431639-139431661 TGAAACCCCCTTGCATCCCAGGG + Intergenic
981456457 4:144958912-144958934 TTGAACCACCTGGCATCCCAGGG + Intergenic
983297781 4:165888373-165888395 TTAACCTACCTTGCATTCCTGGG + Intronic
985229925 4:187804146-187804168 TGGACCACCCTTGCATCCCTGGG - Intergenic
987598831 5:20038516-20038538 TTGAACCAGCTTGCATCCCAGGG - Intronic
987644978 5:20658488-20658510 TTGAACTCCTTTATATTCCTGGG + Intergenic
988072957 5:26318012-26318034 TTGAACCACCCTGTATCCCTGGG + Intergenic
988165943 5:27590237-27590259 TTGTACTTCCTTGCATTCATGGG + Intergenic
988195785 5:28003825-28003847 TGAAACACCCTTGCATCCCAGGG + Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
990400487 5:55432694-55432716 TGAAACCTCCTTGCATCCCTGGG - Intronic
991226726 5:64281924-64281946 TGGACCTACCTTGCATCCCAGGG + Intronic
991922861 5:71674650-71674672 TTGAACCATCTTGCATCCCAAGG + Intergenic
993456612 5:88134284-88134306 TTAAACCCTCTTTCATCCCTGGG - Intergenic
993663260 5:90664933-90664955 TTGAACCAGCTTGCATCCCAGGG + Intronic
994317764 5:98353227-98353249 TGAAACATCCTTGCATCCCTGGG - Intergenic
994531295 5:100975523-100975545 TGAACCTCCCTTGCATCCCAGGG - Intergenic
995801858 5:116005340-116005362 TTGAACTCCCTGGCATTGCCAGG - Intronic
998876874 5:146609095-146609117 GTGAACTGTCTTGCATCCCTGGG - Intronic
999549222 5:152666331-152666353 TGAATCACCCTTGCATCCCTGGG - Intergenic
1001981393 5:176040307-176040329 GGGACCTCCCCTGCATCCCTGGG - Intergenic
1003842391 6:10135464-10135486 TTAAACAACCTTGCATCCTTAGG - Intronic
1005463812 6:26092801-26092823 TCGAACTCCTTGGCATCCATTGG - Exonic
1006338996 6:33435681-33435703 TTTAACTCACTTTCCTCCCTAGG - Intronic
1007151060 6:39691442-39691464 TTGAAGTTCCTTTCAACCCTAGG + Intronic
1008404394 6:51102514-51102536 TGAAACACCCTTGCATCCCAGGG + Intergenic
1008406623 6:51125247-51125269 TGAAACACCCTTGCATCCCAGGG - Intergenic
1008746290 6:54673504-54673526 TTGAACCAGCTTGCATCCCAGGG - Intergenic
1009332025 6:62435267-62435289 TTGAAGTGCCTTGCATCCAAGGG - Intergenic
1009383042 6:63055885-63055907 TTGAACAGCCTTGCATCCCAGGG - Intergenic
1009946134 6:70343540-70343562 TTAATCACCCTTGCATCCCAGGG + Intergenic
1010125676 6:72428998-72429020 TTGAACCACCTTGCATCCCAGGG + Intergenic
1011922678 6:92600410-92600432 TTGAACAACCTTGCATCCCAGGG - Intergenic
1020615180 7:10451240-10451262 TTGAACTCGCCTGCAGCTCTCGG + Intergenic
1021074844 7:16289501-16289523 TTGAACCATCTTGCATCCCTGGG - Intronic
1021629350 7:22629234-22629256 TAGAAATCACTTGCATTCCTTGG - Intronic
1021699786 7:23306752-23306774 TTGAACCACCTTGCATTCCAGGG + Intronic
1021914824 7:25421014-25421036 TTGATCTCCCTTGGAATCCTTGG - Intergenic
1024718155 7:52104301-52104323 TTAACCTGCCTTGCATCCCAGGG - Intergenic
1026386431 7:69853656-69853678 TTGAAGTTCCTTGCATCCTAAGG + Intronic
1028520399 7:91724032-91724054 TTGAACATCCTTGTATCCCTGGG - Intronic
1030462757 7:109861313-109861335 TTGCACCACCTTGCATCCCAGGG - Intergenic
1030694362 7:112568729-112568751 TTGTGCTCCTTTACATCCCTGGG - Intergenic
1030786460 7:113669678-113669700 TTAAACAACCTTGCATTCCTGGG - Intergenic
1033000241 7:137495630-137495652 TTGAACCACCTTGCATCGCAGGG - Intronic
1034433631 7:151052880-151052902 TTGAACCCCCATGAATCTCTAGG + Intergenic
1036554338 8:9844858-9844880 TTAAACACACTTGCATTCCTGGG - Intergenic
1036804167 8:11817189-11817211 TTGAACAGCCTTGCATCCCAGGG + Intronic
1036976547 8:13419533-13419555 TTGAACCACCTGGCATCCCAGGG + Intronic
1038574185 8:28690016-28690038 TTGCACCACATTGCATCCCTGGG + Intronic
1038780929 8:30568013-30568035 TGGAACTCCATTCCAGCCCTGGG - Intronic
1039434475 8:37550288-37550310 TTGAGGTCTCTTGCAACCCTGGG - Intergenic
1040422101 8:47250508-47250530 TTGTATTCCCTTGCATCTCTTGG + Intergenic
1043071091 8:75636756-75636778 TTGAACCAGCTTGCATCCCAGGG + Intergenic
1044253155 8:90027895-90027917 TTGAACACCATTGCATTCCTAGG + Intronic
1045877875 8:107003553-107003575 TGGACCACCCTTGCATCCCAGGG - Intergenic
1046120993 8:109847144-109847166 TGGACCATCCTTGCATCCCTGGG + Intergenic
1046147797 8:110184381-110184403 TTGAACCATCTTGCATCCCTGGG + Intergenic
1047025270 8:120816738-120816760 TTGATCATCTTTGCATCCCTGGG - Intergenic
1047173338 8:122516269-122516291 TTAAACTCTCTTGTATCCATAGG - Intergenic
1048217913 8:132513676-132513698 TGGAAATCCCTGGCATTCCTGGG - Intergenic
1048647038 8:136433301-136433323 TTGGACCACCTTGCATCCGTGGG - Intergenic
1050356452 9:4788083-4788105 TGAACCACCCTTGCATCCCTGGG - Intergenic
1050661107 9:7883748-7883770 TTGAACCGCCTTGCATCCCAGGG - Intronic
1052173686 9:25431694-25431716 TTGAACTAACCTGCATCCCAGGG - Intergenic
1052591041 9:30495748-30495770 TTGAACCTCCTTACATTCCTGGG - Intergenic
1053046440 9:34923185-34923207 TGAAACATCCTTGCATCCCTAGG + Intergenic
1053896746 9:42749037-42749059 TGAAACATCCTTGCATCCCTGGG - Intergenic
1055792187 9:79934860-79934882 CTGAGCTCCCTTTCATCCCTGGG - Intergenic
1055844453 9:80544648-80544670 TGGAAACCCCTTGCATTCCTTGG + Intergenic
1056094591 9:83239792-83239814 TTAAACAACCTTGCATTCCTGGG + Intergenic
1056393560 9:86160774-86160796 TTGAACAGCCTTGCATCCCAGGG - Intergenic
1059721939 9:116968556-116968578 ATCAACTGCCATGCATCCCTTGG + Intronic
1061594182 9:131618319-131618341 CTGAACTCACTGACATCCCTGGG - Intronic
1062603450 9:137331076-137331098 TTGAACCCCCCTGAATCCCTGGG - Intronic
1186653172 X:11583697-11583719 TTGAACCTCCTTGAATTCCTGGG - Intronic
1189355487 X:40307124-40307146 TAGAAGTCACCTGCATCCCTTGG - Intergenic
1190515450 X:51219312-51219334 TTGGACAACCTTGCATCCCAGGG + Intergenic
1190805816 X:53835681-53835703 TAAATCACCCTTGCATCCCTGGG + Intergenic
1190896674 X:54625487-54625509 TCAACCTCCCTTGCATTCCTGGG + Intergenic
1191177740 X:57523415-57523437 TTGAACAACCTTGCATCCCAGGG + Intergenic
1192685186 X:73296836-73296858 TTGAACAACCTTGCATCCCAGGG - Intergenic
1192790256 X:74374995-74375017 TGAACCACCCTTGCATCCCTGGG + Intergenic
1193013901 X:76710549-76710571 TTAAAATCCTTTGCATTCCTTGG + Intergenic
1194229563 X:91305687-91305709 TTCAACCACCTTGCATCCCAGGG - Intergenic
1195156415 X:102127440-102127462 CTGAATTCCCTTGGACCCCTAGG - Exonic
1195781356 X:108468679-108468701 TTGAACCACATTGCATTCCTGGG + Intronic
1195830554 X:109054016-109054038 TGAATCACCCTTGCATCCCTGGG + Intergenic
1196055348 X:111349392-111349414 TTGCACTCCTTTGCTTCCCTTGG - Intronic
1196474427 X:116066216-116066238 TTGAGCTGCCTTGCATCCCAGGG + Intergenic
1197360776 X:125500652-125500674 TGAAACCTCCTTGCATCCCTGGG + Intergenic
1197558374 X:127986377-127986399 TTGAACAACCTTGCATACCAGGG + Intergenic
1197625217 X:128794397-128794419 TTGACCAGCCTTGCATCCCAGGG - Intergenic
1198570878 X:137955440-137955462 TAAACCACCCTTGCATCCCTGGG + Intergenic
1198814171 X:140569375-140569397 TAAATCTACCTTGCATCCCTGGG + Intergenic
1199797063 X:151209441-151209463 TTTATCATCCTTGCATCCCTGGG - Intergenic
1201751928 Y:17442006-17442028 TTGAGCAGCCTTGCATCCCAGGG + Intergenic
1202189376 Y:22224860-22224882 ATCAACTCTCTTGCATCTCTGGG + Intergenic