ID: 1089761763

View in Genome Browser
Species Human (GRCh38)
Location 11:120731608-120731630
Sequence CTCAAACTATTCCAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 3, 1: 13, 2: 51, 3: 190, 4: 473}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089761763_1089761764 8 Left 1089761763 11:120731608-120731630 CCTGTTTTTTGGAATAGTTTGAG 0: 3
1: 13
2: 51
3: 190
4: 473
Right 1089761764 11:120731639-120731661 GTATTAGTTCTTTAAATGTTTGG 0: 115
1: 267
2: 350
3: 498
4: 1644

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089761763 Original CRISPR CTCAAACTATTCCAAAAAAC AGG (reversed) Intronic
900904703 1:5546682-5546704 CTCAAACATTTTCAAAAAATTGG + Intergenic
901110431 1:6789023-6789045 CCCAACCTAGTCCCAAAAACTGG - Intronic
903094567 1:20957996-20958018 CTGAAACTATTCCAAGTGACTGG + Intronic
905073841 1:35251974-35251996 CTCAAACTCTTCTAAAAAATTGG - Intergenic
905983340 1:42252167-42252189 CTGAAACTATTCCAATCAATAGG - Intronic
906134603 1:43488575-43488597 CACAAACTCTTCCAAGAAATAGG - Intergenic
906811597 1:48832561-48832583 CTCAAATTATTGCAAATAAAAGG + Intronic
906836597 1:49089692-49089714 CTGAAACTATTCCAAAAAATTGG + Intronic
907085018 1:51663835-51663857 CTTAAACTATTTCACAAAAGAGG + Intronic
907994341 1:59614095-59614117 CTGAAACTATTCCAATCAATAGG + Intronic
908584285 1:65551259-65551281 CTGAAATTATTCTAAACAACAGG - Intronic
909083954 1:71149878-71149900 CTGAAACTATTCCAATCAATAGG + Intergenic
909372503 1:74900232-74900254 CTGAAACTATTCCAATCAATAGG - Intergenic
909403950 1:75265202-75265224 TTCAAACTATTCCAGAAAATTGG + Intronic
909644104 1:77897106-77897128 CTGAAACTATTCCAATCAATAGG + Intronic
909841695 1:80335589-80335611 CTCAAACCATTCCAAACAATAGG + Intergenic
910407241 1:86901752-86901774 CTAAAATTATACCAAAAAACTGG + Intronic
910597670 1:88996685-88996707 CTCAACAAATTGCAAAAAACTGG + Intergenic
910786235 1:91001132-91001154 CTGAAACTATTCCAATCAATAGG + Intronic
910786673 1:91006488-91006510 CTCAAACTCTTCCAAAAAATAGG + Intronic
911558162 1:99370940-99370962 CTCAAACTCTTTGAAAAAAGGGG + Intergenic
912015629 1:105031333-105031355 CTAACACTAGTCAAAAAAACTGG + Intergenic
912506966 1:110163057-110163079 CTCAAGCTATTCCAAACATGAGG + Intronic
912606693 1:110997988-110998010 CTCAAACTATTCCAAAAAATAGG - Intergenic
912620778 1:111155027-111155049 CTGAAACTATTCCAAAATACTGG - Intronic
913663420 1:121025509-121025531 CTAAAACTATTCCAAAAAATTGG + Intergenic
913959083 1:143325705-143325727 CTCAAACTATTTTGAAAAACAGG + Intergenic
914014811 1:143808777-143808799 CTAAAACTATTCCAAAAAATTGG + Intergenic
914053400 1:144151085-144151107 CTCAAACTATTTTGAAAAACAGG + Intergenic
914125797 1:144815456-144815478 CTCAAACTATTTTGAAAAACAGG - Intergenic
914163010 1:145152430-145152452 CTAAAACTATTCCAAAAAATTGG - Intergenic
914653432 1:149717334-149717356 CTAAAACTATTCCAAAAAATTGG + Intergenic
915043368 1:152987630-152987652 CTCAAACTATTTCAGAAAATTGG + Intergenic
915810795 1:158908107-158908129 CTGAAACTGTTCCAAAAATCTGG + Intergenic
915816045 1:158966323-158966345 CTAAAACTATTCAAAAAACTGGG + Intronic
915860912 1:159443417-159443439 CTAAAATAATTCCAAAAAAAGGG - Intergenic
916178974 1:162067987-162068009 CTCAAACTAATCTAGAAAAAAGG + Intergenic
917449512 1:175135428-175135450 CTCAAACTATTTCAGAAAAGGGG + Intronic
917718584 1:177762977-177762999 CTGAAACTATTCCAATCAATAGG + Intergenic
918021498 1:180697025-180697047 CTCAAGCTATTCCAAAAAACTGG - Intronic
919170578 1:193948925-193948947 CTCAAACTGTTGGGAAAAACAGG - Intergenic
919326565 1:196114660-196114682 ATCAGACTTTTCTAAAAAACAGG + Intergenic
921278968 1:213546677-213546699 CTAAAACTATTCTAAAAATTAGG - Intergenic
921699075 1:218246684-218246706 CTCAGAGTCTTCCAGAAAACTGG - Intergenic
921787811 1:219252827-219252849 CAGAAACCGTTCCAAAAAACTGG - Intergenic
921874617 1:220180678-220180700 CTCAAACTATTTCACAACATTGG + Intronic
922057528 1:222055636-222055658 CTCAAACTAGTGCAATAAAGGGG - Intergenic
922302963 1:224319264-224319286 CTCAAATTATTCCCAAAAAATGG + Intronic
922392311 1:225157325-225157347 CTCAACTAATTCCAAAAAAGTGG + Intronic
923981845 1:239333441-239333463 CTAAAACTTTTCCAAAAATAAGG + Intergenic
924156955 1:241187526-241187548 CTGCAATTATTCCAAACAACTGG - Intronic
924906609 1:248460255-248460277 CTTAAACTCTTTCAAAAACCAGG - Intergenic
924917496 1:248587907-248587929 CTTAAACTCTTTCAAAAACCAGG + Intergenic
1063181959 10:3610596-3610618 CTGAAACTATTTCAAAAATAAGG + Intergenic
1063284330 10:4667410-4667432 CACAAACTCTTCCAAAAAAGTGG - Intergenic
1063340196 10:5255738-5255760 CTGAAACTATTCCAATCAATAGG + Intergenic
1066014892 10:31231444-31231466 CTGAAACTATTCCAAACAATTGG + Intergenic
1066110972 10:32196568-32196590 CTCAAACTCTTTCAAAAAAATGG - Intergenic
1066963028 10:42237859-42237881 CTCAAACTATTTTGAAAAACAGG + Intergenic
1067215922 10:44302791-44302813 CTCAAACTCTTCAAAACAAATGG + Intergenic
1067813589 10:49451780-49451802 CTCAAACTCTTTCAAGAAATAGG - Intergenic
1068055559 10:52008731-52008753 TTGAAACTGTTCCAAAAAACTGG - Intronic
1068058901 10:52041521-52041543 TTCAAACCATTCCAGATAACTGG - Intronic
1068642068 10:59420599-59420621 CTCAAACTCTTCCAAAAAATAGG + Intergenic
1069050871 10:63792211-63792233 CTCAAACTACTGCAAAAAATAGG + Intergenic
1069072318 10:64001923-64001945 CTGAAACTACTCCAAAAAATTGG + Intergenic
1069197957 10:65577070-65577092 CCTAGACTATTCCAAAAAAATGG + Intergenic
1070334581 10:75443732-75443754 CTCAAACACTTACAAAAAATTGG - Intronic
1070632868 10:78100252-78100274 CTGAAACTATTCCAAACAATAGG + Intergenic
1070870881 10:79751568-79751590 TAAAAACTATTCCAAAAAACTGG + Intergenic
1071046802 10:81388482-81388504 CACAAACTCTTCCAAAAATATGG - Intergenic
1071296752 10:84226593-84226615 CTCAAACTTTTCTAAAAATATGG - Intergenic
1071637807 10:87273779-87273801 TAAAAACTATTCCAAAAAACTGG + Intergenic
1071657437 10:87464171-87464193 TAAAAACTATTCCAAAAAACTGG - Intergenic
1072032356 10:91533230-91533252 CTGAAACTATTCCAATCAATAGG + Intergenic
1072311667 10:94162200-94162222 CTGAAACTATTCCAATCAATAGG - Intronic
1072380354 10:94862467-94862489 CTCAAAAGATTCCAAGAAACAGG + Intergenic
1072863080 10:99027558-99027580 TTCAAACTATTCTGAAAAATAGG + Intronic
1074179548 10:111046724-111046746 CTGAAACTATTCCAATCAATAGG + Intergenic
1074331390 10:112514053-112514075 CTCGAACTCTTCCAAAAATGTGG - Intronic
1074357528 10:112799349-112799371 GTCAAAGTTTTCCAAAACACTGG - Intronic
1077757582 11:5050410-5050432 CACAAAATTTTCCAAAAAAAAGG + Intergenic
1077949179 11:6936582-6936604 CTCAAACTCTTCCAAAAAATAGG + Intronic
1078295584 11:10066170-10066192 CCCAAACTCTTCTAAAAAAACGG + Intronic
1079270457 11:18980414-18980436 GTCAACCTAATACAAAAAACAGG - Intergenic
1079814293 11:25036010-25036032 CTGAAACTATTCCAAAAAGCTGG - Intronic
1080083962 11:28256238-28256260 CTCAAACTATTCTAAGAAAGAGG - Intronic
1080212850 11:29807150-29807172 TTCTAACTATTACAAAAAGCAGG + Intergenic
1080357253 11:31464391-31464413 CTCAAACTATTCCAAAAAACTGG + Intronic
1080914501 11:36642454-36642476 CTGAAACTATTCCAATGAATAGG + Intronic
1081904041 11:46655096-46655118 CTCAAAAAAAACCAAAAAACAGG + Intronic
1082316045 11:50723693-50723715 CTGAAACTATTCCAATCAATAGG + Intergenic
1082558037 11:54586267-54586289 ATCAAACTACTCCAAGCAACAGG - Intergenic
1082865152 11:57892965-57892987 CTCAAACTATTCCAGAAAATTGG - Intergenic
1082917738 11:58456511-58456533 CTCAAACTATTCCAAAAGATTGG + Intergenic
1084490121 11:69473753-69473775 TACAAACTATCCCAAAACACAGG - Intergenic
1085797047 11:79551487-79551509 ATAAAACTATTTCCAAAAACAGG + Intergenic
1086230397 11:84562515-84562537 CACAAACAATTCCAAAATACAGG - Intronic
1086393057 11:86385633-86385655 CTCACACCATTCCACAACACAGG - Intronic
1086430704 11:86733177-86733199 CACAAACTCTTCCAAAAAATAGG + Intergenic
1086923953 11:92619401-92619423 CACAAACTCTTCCAAAATATAGG - Intronic
1087442356 11:98202507-98202529 CTGAAACTATTCCAATCAATTGG + Intergenic
1087485167 11:98751433-98751455 CTGAAACTATTCCAAACAATAGG + Intergenic
1087719164 11:101642485-101642507 CTGAAACTATTCCAATCAATAGG + Intronic
1087887863 11:103501137-103501159 CTTAAAACATTCTAAAAAACTGG + Intergenic
1088601824 11:111486470-111486492 TTCATACTATTCTAAAAAATTGG + Intronic
1089262215 11:117231222-117231244 CTCAAAGCATTCCAGAAAAATGG + Intronic
1089761763 11:120731608-120731630 CTCAAACTATTCCAAAAAACAGG - Intronic
1090316526 11:125794888-125794910 CTCAAACTATTCTGAGAAATAGG - Intergenic
1090323953 11:125868965-125868987 CTCAAACTAAACAAAAACACAGG - Intergenic
1090814049 11:130274904-130274926 TACAAACTCTTCCAAAAAACGGG - Intronic
1091598153 12:1894332-1894354 CTCAAGTTATTCCAAAATATTGG + Intronic
1091716306 12:2779060-2779082 CTCCAACTTTTCCCAAAATCTGG - Intergenic
1091810661 12:3394755-3394777 CTGAAACTATTCCAATCAATAGG - Intronic
1091824573 12:3501744-3501766 CTGAAACTATTCCAATCAATAGG - Intronic
1091943496 12:4512337-4512359 CTGAAACTATTCCAATCAATAGG + Intronic
1092085427 12:5754458-5754480 CTTAAAGTCTTCCAAAAAACAGG - Intronic
1092325251 12:7524428-7524450 CTGAAACTATTCCAAGCAATTGG - Intergenic
1093285043 12:17248697-17248719 CTCAAACTTGTCCAAACAATTGG + Intergenic
1093992576 12:25606876-25606898 CTGAAACTATTCCAATCAATAGG - Intronic
1094873223 12:34611050-34611072 CTGAAACTATTCCAATCAATAGG - Intergenic
1095228272 12:39702531-39702553 CTGAAACTATTCCAATCAATAGG + Intronic
1095275542 12:40278375-40278397 CACAAACAATTGCAATAAACTGG - Intronic
1095298395 12:40553479-40553501 ATGAAACTATTCCAAAAAATTGG - Intronic
1095367654 12:41427261-41427283 GTGAAAATATTCCAAAAAACAGG - Intronic
1095664730 12:44784477-44784499 CTGAAACTGTTCCAAACAAAAGG + Intronic
1095698846 12:45170460-45170482 CTCAAAATATTTGGAAAAACTGG + Intergenic
1095780449 12:46053226-46053248 CTGCAACTATTCTAAAAAATGGG + Intergenic
1096013310 12:48242576-48242598 CTTAAAGTATTCCATAAACCAGG - Intergenic
1096346682 12:50853923-50853945 CTAAAACTATTCAAAAAAATTGG + Intronic
1097418866 12:59348922-59348944 CTGAAACTATTCCAAACAATAGG - Intergenic
1097753194 12:63380547-63380569 CTGAAACTATTCCAAACAATAGG + Intergenic
1098053568 12:66479517-66479539 CTGAAACTATTCCAAACAGTAGG + Intronic
1098634237 12:72761503-72761525 CTCAAACTGTTCCAAAATCTTGG + Intergenic
1099158774 12:79213291-79213313 CAAAAACTCCTCCAAAAAACAGG + Intronic
1099849842 12:88079483-88079505 ATCAAGCTATTACAAAAAACAGG + Intronic
1100048626 12:90415801-90415823 CTCAAAATATGCCAGAAAACTGG - Intergenic
1101028748 12:100639367-100639389 CTGAAACTATTCCAATCAATAGG - Intergenic
1101482656 12:105115591-105115613 CTCAATCAATACCAAAAAAGGGG - Intronic
1102958682 12:117076951-117076973 CACAAACCTTTCCAAAACACGGG + Intronic
1104262299 12:127195456-127195478 CTGAAATTATTCCAAAAAAGAGG + Intergenic
1107187543 13:37541953-37541975 CTGAAACTATGCCAAAAATTGGG - Intergenic
1107857936 13:44633909-44633931 CTCAAAAGAAACCAAAAAACAGG + Intergenic
1108099643 13:46940823-46940845 CTCAAACTGTTGAAAAAAATAGG + Intergenic
1108130541 13:47294967-47294989 CTGAAACTATTCCAAACAATTGG - Intergenic
1108135743 13:47356324-47356346 CTCAAACACTTCCAAAAAATTGG - Intergenic
1108137513 13:47381714-47381736 CTGAAACTATTCCAATCAATAGG + Intergenic
1108168343 13:47715737-47715759 CTGAAACTATTCCAATCAATAGG + Intergenic
1108175201 13:47785349-47785371 CTGAAACTATTCCAATCAATAGG + Intergenic
1108376264 13:49816787-49816809 CTCAAAATAATCCAGAAAAGTGG - Intergenic
1109120980 13:58456931-58456953 CTAAACCTATTCCAAAAATAGGG + Intergenic
1109272352 13:60268578-60268600 CTTAAACTATTCCTAACACCAGG - Intergenic
1109346560 13:61121708-61121730 CTCAAACTTTTCCAAAAATTTGG + Intergenic
1109523693 13:63545991-63546013 CTTAAACTATTCCTAACACCTGG - Intergenic
1109961215 13:69634512-69634534 CTCAAACTATTCCAAAAAATTGG - Intergenic
1110088580 13:71414504-71414526 TTCAAACTATTCCAAAAAAATGG - Intergenic
1110677800 13:78270659-78270681 CTCATACTCTTCCAAAAACTTGG - Intergenic
1110856619 13:80303770-80303792 TTCAAACTATTCCAGAACACAGG - Intergenic
1110985377 13:81960628-81960650 CTGAAACTATTCCAAAACAATGG + Intergenic
1111226573 13:85280906-85280928 CTCAAACTCTTGCAATAAATTGG - Intergenic
1111337120 13:86839066-86839088 CTTAAACTATTCCTAACACCAGG + Intergenic
1111344460 13:86932448-86932470 CTCAATGTAATCCAAAAAACTGG - Intergenic
1111513054 13:89291321-89291343 CTTAAAACATTCCAAAAAATTGG - Intergenic
1111783293 13:92755927-92755949 CTGAAACTATTCCAATCAATAGG + Intronic
1112860710 13:103826818-103826840 CTGAAACTATTCCAAATAATAGG - Intergenic
1113169810 13:107487823-107487845 CTGAAACTATTCCAAAAAATGGG - Intronic
1113663523 13:112124377-112124399 CACACACTCTTCCAGAAAACAGG - Intergenic
1113954716 13:114091753-114091775 TTCAAACTAATCCAAACAAATGG - Intronic
1114126050 14:19727165-19727187 CTGAAACTATTCCCAAAAATGGG - Intronic
1115765842 14:36623070-36623092 CACAAACTCTTCCAAAAAATAGG - Intergenic
1116022877 14:39482992-39483014 CTGAAACTATTCCAATCAATAGG + Intergenic
1116106657 14:40516369-40516391 CTCAAACTATTTCAAAAAACAGG + Intergenic
1116193251 14:41687003-41687025 CTGAAACTATTCCAAACAATTGG - Intronic
1116230349 14:42207446-42207468 CTGAAACTATTCCAATCAATAGG - Intergenic
1116274558 14:42814459-42814481 CTCAAACTCTTCCAAAAAAATGG - Intergenic
1116318209 14:43425459-43425481 CTGAAACTATTCCAAACAATAGG + Intergenic
1116532070 14:45984378-45984400 CTCAAACTCTTCCAATATATTGG - Intergenic
1116549754 14:46221931-46221953 CTAAAAGTATTGCAAAAAACAGG + Intergenic
1116579569 14:46622082-46622104 CTGAAACTATTTCAAACAATAGG + Intergenic
1116840130 14:49811962-49811984 CACAAACTCTTCCAAAAAATAGG - Intronic
1117086994 14:52211726-52211748 CTGAAACTATTCCAATCAATAGG + Intergenic
1117188654 14:53268953-53268975 CTGAAACTATTCCAATCAATAGG - Intergenic
1117502774 14:56370536-56370558 CTAAAACTATTCCAAAAAATTGG - Intergenic
1119111476 14:71978807-71978829 CTGAAACTATTCCAATCAATAGG - Intronic
1120515148 14:85461799-85461821 CTATAAATATTCCAAAAAGCAGG - Intergenic
1121068411 14:90992660-90992682 CACAAACTCTTTCAGAAAACAGG - Intronic
1121506248 14:94479680-94479702 CTCATACTATTTAAAAAATCTGG + Intronic
1121965761 14:98303565-98303587 CTAAAACTATTCAAAAAATTCGG - Intergenic
1202929330 14_KI270725v1_random:24481-24503 CTCAAACTATTTTGAAAAACAGG - Intergenic
1123422965 15:20146737-20146759 CTCAAACTATTTTGAAAAACAGG + Intergenic
1123442037 15:20299576-20299598 CTCAAACTATTTTGAAAAACAGG - Intergenic
1123502905 15:20907232-20907254 CTTAAACTATTTCAAAACAGAGG + Intergenic
1123532191 15:21153277-21153299 CTCAAACTATTTTGAAAAACAGG + Intergenic
1123560152 15:21480894-21480916 CTTAAACTATTTCAAAACAGAGG + Intergenic
1123596393 15:21918198-21918220 CTTAAACTATTTCAAAACAGAGG + Intergenic
1123757624 15:23409103-23409125 CTCAATCTATTCTGAAAAACTGG - Intergenic
1125272903 15:37959302-37959324 TTCAAACTATTCCAAAACACAGG + Intronic
1126520357 15:49586125-49586147 TTCAAACTATTACAAACTACAGG + Intronic
1127094973 15:55503372-55503394 CTGAAACTATTCCAATCAATCGG + Intronic
1127111293 15:55673974-55673996 CTCAAACAATTCCACCAAAGTGG + Intronic
1127712725 15:61616532-61616554 TTCAAACTCTTCCAAAAATGTGG + Intergenic
1127763086 15:62159861-62159883 CTCAAGCTATTCTCAAAAAATGG + Intergenic
1128956015 15:71946236-71946258 CTTCAACTCTTTCAAAAAACAGG - Intronic
1129639000 15:77354614-77354636 TTCCAACCATGCCAAAAAACAGG + Intronic
1129749545 15:78051614-78051636 ATCAAAATGTTCCAAACAACTGG + Intronic
1130126725 15:81100128-81100150 CCCAGACTATACCAAAAACCTGG - Intronic
1131563515 15:93464546-93464568 CACAAACTAGTCCATAACACTGG + Intergenic
1131634041 15:94210826-94210848 CTGAAACTATTCCAATCAATAGG - Intergenic
1131711798 15:95063596-95063618 CTCTAAGTATTCCATAAAACTGG + Intergenic
1131894278 15:97008571-97008593 CTCAAACCACTCCAGAAGACAGG - Intergenic
1202968500 15_KI270727v1_random:208058-208080 CTTAAACTATTTCAAAACAGAGG + Intergenic
1133180757 16:4052432-4052454 CTCAAATTATTCCGGAAAAAAGG + Intronic
1135296867 16:21287309-21287331 CTCAAACTCTACCAAAAAATAGG - Intronic
1136015297 16:27395353-27395375 CTCAAACTCCTCCACAAAACAGG + Intergenic
1136633135 16:31501176-31501198 GTAAAACTATTCAAAAAAGCAGG + Intronic
1136676316 16:31910295-31910317 CTCAAAAACTTCCAAAACACAGG - Intronic
1136719176 16:32305941-32305963 CTCAAACTATTTTGAAAAACAGG + Intergenic
1136724196 16:32344301-32344323 CTCAAACTATTTTGAAAAACAGG + Intergenic
1136837547 16:33512205-33512227 CTCAAACTATTTTGAAAAACAGG + Intergenic
1136842529 16:33550345-33550367 CTCAAACTATTTTGAAAAACAGG + Intergenic
1136861783 16:33708603-33708625 CTCAAACTATTTTGAAAAACAGG - Intergenic
1137068024 16:35870388-35870410 CTCAAATTCTTCAAAAAAAGAGG + Intergenic
1137317862 16:47346856-47346878 CTCAGAGTATTCCAGAAAACTGG + Intronic
1137625934 16:49908612-49908634 CTCAAACTCCTCCAAGAAGCAGG - Intergenic
1138020504 16:53475510-53475532 CTCAAACTACTACAAAAAGCAGG - Intronic
1140883731 16:79223957-79223979 CTGAAACTATTGCAAACAATAGG + Intergenic
1140950405 16:79811481-79811503 CTCAAAATTTACCAAAAAACCGG + Intergenic
1141052121 16:80777792-80777814 CATAAGCTATTCCTAAAAACAGG + Intronic
1141363099 16:83415363-83415385 CTCAAACTCTTCCGAACAGCTGG + Intronic
1203002236 16_KI270728v1_random:173464-173486 CTCAAACTATTTTGAAAAACAGG - Intergenic
1203007255 16_KI270728v1_random:211830-211852 CTCAAACTATTTTGAAAAACAGG - Intergenic
1203123279 16_KI270728v1_random:1556787-1556809 CTCAAACTATTTTGAAAAACAGG - Intergenic
1203133839 16_KI270728v1_random:1709870-1709892 CTCAAACTATTTTGAAAAACAGG - Intergenic
1203147730 16_KI270728v1_random:1812483-1812505 CTCAAACTATTTTGAAAAACAGG + Intergenic
1203152694 16_KI270728v1_random:1850642-1850664 CTCAAACTATTTTGAAAAACAGG + Intergenic
1143828312 17:9630728-9630750 CTCAAAAAATTACAAAAATCGGG - Intronic
1144361142 17:14494595-14494617 CACAAACATTTCCAAAAAATTGG - Intergenic
1146303765 17:31713576-31713598 TGCAAACGATTCCAAAGAACGGG + Intergenic
1149675133 17:58453136-58453158 CTTAAACTATTCCAAAAAATTGG + Intronic
1151666524 17:75548497-75548519 CTCAAAGTATGCCAAAGAAGTGG + Intronic
1152553771 17:81042980-81043002 CTCAAGCAATTCCAAGAAGCTGG + Intronic
1203158601 17_GL000205v2_random:28555-28577 CACATACTATTCCAGAACACTGG - Intergenic
1153268050 18:3290841-3290863 CTCAAACTATTCTGAAAAATAGG - Intergenic
1153435753 18:5066427-5066449 CTCTCACTGTTCCAAAAAATAGG + Intergenic
1153563755 18:6398677-6398699 CTCACACTATTCCAAAACCCAGG + Intronic
1153657479 18:7296619-7296641 AACAAACTTTTCCAAAAAATAGG - Intergenic
1153827241 18:8886610-8886632 CTGAAACTATTTCAATCAACAGG - Intergenic
1154171925 18:12058716-12058738 CTCACACTACTTTAAAAAACAGG + Intergenic
1154230827 18:12554588-12554610 CTCAAACTATTCTGAAAAATAGG + Intronic
1154407869 18:14111869-14111891 CTTAAACTATTCCAAAACAGAGG + Intronic
1155175994 18:23301678-23301700 CTTAAACTATTCCAAAGAGAAGG + Intronic
1155418125 18:25623391-25623413 ATGAAACTCTTCCAGAAAACTGG - Intergenic
1156296265 18:35794186-35794208 CTGAAACTATTCCAATCAATAGG + Intergenic
1156606859 18:38676680-38676702 TTGACACTATTCCAAAAAATAGG - Intergenic
1156791029 18:40975491-40975513 CACAAGCTAATCCAAAAAACTGG - Intergenic
1156896453 18:42252243-42252265 CTAAAAGTATTCCAAAAAATTGG - Intergenic
1157178517 18:45474421-45474443 CTGAAACTATTCCAAACAGTAGG - Intronic
1157507090 18:48234746-48234768 AATAAACTATTCCCAAAAACTGG - Intronic
1158804908 18:60958916-60958938 CTTAAACTCTTACAAAAAAATGG - Intergenic
1158863793 18:61618224-61618246 CACAAACTATTATAAAAACCTGG + Intergenic
1159200662 18:65179844-65179866 CTTAAACTTTTCCAAGAGACAGG - Intergenic
1159679570 18:71331137-71331159 CTAAAACTATTCCCAAAATTTGG + Intergenic
1159858893 18:73622555-73622577 CTGAAACGATTCCAAAAAAATGG + Intergenic
1159868212 18:73730750-73730772 CTCAAAGTATACCAAGAAAGGGG - Intergenic
1162243228 19:9375388-9375410 CTCAAACTCTTCCAAAAAAATGG - Intronic
1162687933 19:12402976-12402998 CTCAAACTATTCCAAAACAGAGG - Intronic
1162794628 19:13080204-13080226 TCCAAACTATTGCAAAAAAAAGG + Intronic
1163264658 19:16212145-16212167 CTGAAATGATTCCAAAAAAACGG - Intronic
1163739989 19:19005605-19005627 CTCAAACTACTACAAAAAAGGGG + Intronic
1163838813 19:19593162-19593184 CTCAAGCGATTCCAAAGTACTGG + Intronic
1163955282 19:20632740-20632762 ATCAAACTATTCCAAGCTACAGG - Intronic
1163972397 19:20811272-20811294 CTGAAACTATTCCAATCAATGGG + Intronic
1163978560 19:20876286-20876308 CACAAACTATTCCACCAAAGTGG + Intergenic
1164450128 19:28354734-28354756 CTCAAACTTTTCCAAAACACTGG + Intergenic
1164664071 19:30011634-30011656 AACAAACAATTCCAAAAAAAAGG - Intronic
1165298357 19:34947732-34947754 CAGAAACTCTTCCAAAAAAGTGG + Intergenic
1166585690 19:43946198-43946220 CTGAAACTATTTCAAGAAACAGG - Intergenic
1167407306 19:49320958-49320980 CTCAAACTTTTCCAAAAAATTGG + Intronic
1202692798 1_KI270712v1_random:103508-103530 CTCAAACTATTTTGAAAAACAGG + Intergenic
925506516 2:4571320-4571342 CTCAACATTTTCCAAAAAATTGG - Intergenic
926824309 2:16887379-16887401 CACAAATTCTTCCAAAAAATAGG - Intergenic
926852876 2:17220261-17220283 TTAAAACTTTTCCAAAAGACAGG + Intergenic
927138907 2:20116372-20116394 CTCCAGCTAATCCATAAAACGGG + Intergenic
928070669 2:28212155-28212177 CTCAAGCTATTCCAACTAACAGG - Intronic
928988754 2:37208244-37208266 CTGAAACTATTCCAAAAGATAGG + Intronic
929401351 2:41585544-41585566 TTGAAACTATACCAAAAAATTGG + Intergenic
929785376 2:44986442-44986464 CACACAGTATTCCAAAGAACAGG + Intergenic
929845706 2:45523775-45523797 CACAAACTCTTCCAAAAAACAGG + Intronic
930380874 2:50626257-50626279 CTCAAAAAATTTAAAAAAACAGG + Intronic
930940334 2:57005093-57005115 GTCAAAAAATTACAAAAAACAGG - Intergenic
931204342 2:60132737-60132759 CTGAAACTATTCCAATCAATAGG - Intergenic
931506166 2:62929182-62929204 CTCAAACGTTTCCAAAACATTGG + Intronic
931534017 2:63251883-63251905 CTGAAACTATTCCAAAAATCAGG + Intronic
931600437 2:63997245-63997267 CTCAAACTAGTCTGAAAAATAGG - Intronic
932789175 2:74638409-74638431 CTCAAACAATAAAAAAAAACTGG - Intronic
933078261 2:77956093-77956115 CACAAACTAGTCCAAAAAATAGG + Intergenic
933540297 2:83632116-83632138 CACAAACTCTTTCAAAAAAACGG - Intergenic
933617830 2:84501571-84501593 CTCAAACTATTCCAAAAACTAGG - Intergenic
933953604 2:87350462-87350484 CTCAAACTATTTTGAAAAACAGG - Intergenic
934111090 2:88743581-88743603 CTGAAACTATTCCAAAAGATGGG - Intronic
934237809 2:90246710-90246732 CTCAAACTATTTTGAAAAACAGG - Intergenic
934275392 2:91570021-91570043 CTCAAACTATTTTGAAAAACAGG + Intergenic
934321941 2:91979259-91979281 CTCAAACTATTTTGAAAAACAGG - Intergenic
934460226 2:94210042-94210064 CTCAAACTATTTTGAAAAACAGG - Intergenic
934996311 2:98964210-98964232 CTGAAACTATTCCAAAAATTGGG - Intergenic
936747613 2:115597472-115597494 CTAAAAATATTCCGCAAAACAGG + Intronic
936920175 2:117680516-117680538 CTCTGACTACTCCAAACAACTGG + Intergenic
937121543 2:119442801-119442823 CCCACACAGTTCCAAAAAACGGG + Intronic
937188625 2:120070428-120070450 CTGAAACTATTACAAACAATAGG + Intronic
938425657 2:131184678-131184700 CTGAAACTATTCCAAAAAGAGGG + Intronic
938975388 2:136472288-136472310 CTGAAACTATTCCAATCAATAGG + Intergenic
939018131 2:136925711-136925733 CTTAAACTCTTCCAAAGAATTGG - Intronic
939246598 2:139633072-139633094 CACAAACTATTCTAAAAAGTTGG - Intergenic
939783790 2:146482926-146482948 ATCAATATATTCAAAAAAACAGG + Intergenic
939834816 2:147116474-147116496 CACAAACTCTTTCAAGAAACTGG - Intergenic
939848630 2:147277886-147277908 CTCAAAGTTTTCCAAGAAAGGGG + Intergenic
941019804 2:160396168-160396190 ATCAAACCATTTCAAAACACAGG - Intronic
941135879 2:161717836-161717858 CTGAAACTATTCCAAACAATTGG - Intronic
941438996 2:165509918-165509940 CTCAAGCTCTTCAAAAAATCAGG - Intronic
941749947 2:169124520-169124542 CTGAAATGATTCCAAAAAAGAGG + Intergenic
942010980 2:171762031-171762053 CTCAAACTACTGGAAGAAACTGG + Intergenic
942350403 2:175046591-175046613 TTCAAACTATTCCAGAAAATGGG - Intergenic
942796656 2:179828754-179828776 CTGAAAATATTTCACAAAACTGG + Intronic
943557511 2:189423812-189423834 CTCAAACTCTTCCAAAAAATTGG + Intergenic
943681673 2:190774791-190774813 CTGAAACTATTCCAATCAATAGG - Intergenic
943963875 2:194305460-194305482 CTCATAAAATTTCAAAAAACAGG + Intergenic
943964548 2:194316607-194316629 CTCAAACTCATACAAAAAATTGG - Intergenic
944393277 2:199242132-199242154 CTGAAACTATTCCAATCAACAGG - Intergenic
944456138 2:199896709-199896731 TTAAAACTATCCCATAAAACTGG + Intergenic
944737444 2:202580435-202580457 CTGAAACTGTTCCAAAAAATCGG - Intergenic
945385680 2:209197498-209197520 TTCAAACTTTTCCAAAACATTGG + Intergenic
945490487 2:210448952-210448974 CTGAAACTATTCCAAACAACAGG + Intronic
945736014 2:213601296-213601318 CTCCATCTCTTCCAAAACACTGG - Intronic
945754153 2:213825800-213825822 CTAAAACTATCCCAAGAAATAGG - Intronic
945757939 2:213873103-213873125 CACAAATTCTTCCAAAAAATAGG - Intronic
947322213 2:228933010-228933032 CTGAAACTATTCCAAACAATAGG - Intronic
1169231916 20:3895510-3895532 CTCAAAACATTTCAAAAAATAGG + Intronic
1169980927 20:11383134-11383156 CTAAAACTATTCCAAACAATTGG + Intergenic
1170576573 20:17667147-17667169 CACAAACTATGCCAAAGAATAGG - Intronic
1170675836 20:18479954-18479976 CTTAAACTGTTCCAAAATATAGG + Intronic
1170992537 20:21316390-21316412 ATAAAACTCTTCCGAAAAACAGG - Intronic
1171225495 20:23438946-23438968 CTGAAATTATTCCAAAATAAAGG - Intergenic
1171362219 20:24595541-24595563 CTGAAACTATTACAAAAAAGTGG - Intronic
1171424389 20:25040520-25040542 ATCAAACTCCTCCAAAGAACAGG + Intronic
1172689210 20:36778874-36778896 CTCAAACCATTCCCAAGAAGAGG - Exonic
1173064247 20:39694939-39694961 CTCAAATGATTCCAAGAAACTGG - Intergenic
1173100874 20:40087292-40087314 CTCAAATTATTCCCACAAATGGG + Intergenic
1173191288 20:40877980-40878002 TTTAAAATATTCCAACAAACTGG + Intergenic
1173712184 20:45168620-45168642 CTGAAACTATTCCAAAAAACTGG + Intergenic
1174604405 20:51750478-51750500 CCCAAAAAATTCCAGAAAACAGG + Intronic
1175014299 20:55772235-55772257 TTCAAACTATTCCAAATCTCAGG + Intergenic
1176591351 21:8653080-8653102 CTCAAACTATTTTGAAAAACAGG - Intergenic
1176776166 21:13135360-13135382 CTGAAACTATTCCAATCAATAGG + Intergenic
1177482735 21:21712697-21712719 ATCACACAATTCCAGAAAACTGG + Intergenic
1177541321 21:22497077-22497099 CTAAAACTATTCCAAACAACAGG + Intergenic
1177621887 21:23606311-23606333 CTGAAACTATTCCAAAAAATTGG + Intergenic
1178017236 21:28362311-28362333 CTCAGACTCTTTAAAAAAACTGG - Intergenic
1180274200 22:10630191-10630213 CTCAAACTATTTTGAAAAACAGG - Intergenic
1180548688 22:16525186-16525208 CTCAAACTATTTTGAAAAACAGG - Intergenic
1181356024 22:22296710-22296732 CTCAAACTATTTTGAAAAACAGG + Intergenic
1182167900 22:28194883-28194905 CTGAAACTATTCCAATCAATAGG + Intronic
1182169505 22:28212726-28212748 CTGAAACTATTCCAATCAATAGG + Intronic
1183876959 22:40790839-40790861 ATCAAAGTATTACAAATAACTGG + Intronic
949114578 3:304285-304307 CTGAAACTATTCCAAACAACAGG - Intronic
949631117 3:5927966-5927988 CTCAAACATTACCAAACAACTGG + Intergenic
950844629 3:16002667-16002689 CTGCAAAAATTCCAAAAAACAGG - Intergenic
951068682 3:18299151-18299173 CTCAAGCTATTCCAAAAAATTGG + Intronic
951491782 3:23278939-23278961 ATCAAATTATTAAAAAAAACTGG - Intronic
951654964 3:24996002-24996024 TTCAAACTATTACAAAATATTGG - Intergenic
952066083 3:29572812-29572834 CTCAAACAATTCTGAAAAATAGG - Intronic
952519493 3:34142338-34142360 CTCAAACTGTTCAAAAGAAAAGG - Intergenic
952836062 3:37603234-37603256 GTGAAAATATTCCAAAAAAATGG + Intronic
953431240 3:42842318-42842340 CTGATAATATTCCATAAAACAGG + Intronic
954871726 3:53772465-53772487 ATCAAACCATTCCAGAACACTGG - Intronic
955134426 3:56201896-56201918 CTGAAACTGATCCAGAAAACAGG - Intronic
956317797 3:67958250-67958272 CTCAAACTATTCCAAAAAAGTGG + Intergenic
956476438 3:69625733-69625755 CTCAAACTATTCCAAAAAATAGG + Intergenic
956862706 3:73340218-73340240 CTAAAACTCTTCCATAAACCAGG + Intergenic
956925307 3:73980641-73980663 CTCAAACTATACCCAAGAAAGGG + Intergenic
957116367 3:76031909-76031931 CTGAAACTATTCCAATCAATAGG - Intronic
957165331 3:76665046-76665068 CTCAAAATATTGGAAAAAAATGG - Intronic
957166930 3:76686525-76686547 CTCAAACTATTTTTAAAAACTGG - Intronic
957482567 3:80817131-80817153 CTGAACCTATTCCAAAAAAATGG + Intergenic
957628576 3:82687794-82687816 CTGAAACTATTACAAAATAGAGG - Intergenic
957721318 3:84003600-84003622 CTGAAACTATTCCAAAAGACAGG - Intergenic
958005701 3:87808161-87808183 CTCAAACTATTCCAAAAAATTGG - Intergenic
958264791 3:91425383-91425405 CTCTAACTATTCATACAAACTGG + Intergenic
958789936 3:98640265-98640287 CTGAAGCTATTCCAAAAGATAGG - Intergenic
959268237 3:104171265-104171287 CAAATACAATTCCAAAAAACAGG + Intergenic
959306952 3:104679505-104679527 CTCAAACTATTCTGAAAAAGAGG + Intergenic
959341987 3:105143466-105143488 CTCAAGGTATTCAAAAAAAAAGG - Intergenic
960276899 3:115738919-115738941 CTAAAACTATTCCAAACAATTGG - Intergenic
961229659 3:125292596-125292618 CTGAAACTGTTACAAAATACAGG - Intronic
962038397 3:131678971-131678993 CTGAAACTATTTCAAAAAATTGG - Intronic
962634050 3:137311335-137311357 CTCAAACTGTTAGAAAAAAAAGG - Intergenic
963689582 3:148481731-148481753 CTGAAACTATTCCAATCAATAGG + Intergenic
963777531 3:149454094-149454116 TTAAAACTATTCCCAAAAAAAGG + Intergenic
963929190 3:150984463-150984485 CTCAAACTTTTTCCAAAAAATGG - Intergenic
964269830 3:154943950-154943972 CTCAAACTATTTTAAAACAGAGG + Intergenic
964499123 3:157328895-157328917 CTCAGATTCTTCCACAAAACTGG - Intronic
964519528 3:157548718-157548740 CTAAAACTCTTCAAAAAAACTGG - Intronic
964528395 3:157640669-157640691 TTCTAACTATTCTAAATAACAGG + Intronic
964803805 3:160584750-160584772 CTCAAACTCTTCAAAAAAAAAGG + Intergenic
965016520 3:163165515-163165537 CTCAATCTATTCTGAAAAATAGG - Intergenic
965161311 3:165136925-165136947 CTGAAACTATTCCAATCAATAGG - Intergenic
965217317 3:165879980-165880002 CTGAAACTATTCCAATCAATAGG - Intergenic
965223900 3:165962451-165962473 CTGAAACTATTCCAATCAATAGG + Intergenic
965283173 3:166780521-166780543 CTAAAATTATTTCAAAAAAATGG - Intergenic
965782158 3:172297306-172297328 TTGAAACTATTCCAAATAAAAGG - Intronic
967203582 3:187098466-187098488 CTGAAACTATTCCAAAAGATAGG + Intergenic
967696624 3:192539693-192539715 CTAAAACTATTCAGAAAAATAGG - Intronic
968004555 3:195231934-195231956 CTCAAACTATTCTGAAAAATAGG - Intronic
968580416 4:1388973-1388995 CACAAACTCTTCCAAAAAATAGG - Intergenic
970991157 4:22214985-22215007 CCAAAACTATTCCAAACAATAGG + Intergenic
971466845 4:26972784-26972806 CTGAAACTATTCCAATCAACAGG - Intronic
971543763 4:27857854-27857876 CCCAAATTATTCAAAAAAATTGG - Intergenic
971587930 4:28429329-28429351 CTCAAACTATTTTAAAAAATTGG - Intergenic
971616150 4:28792845-28792867 CTCAGACTATTTCATAAAACAGG + Intergenic
971656765 4:29357019-29357041 CTCAAACTCCTCCAAAATATTGG - Intergenic
971679362 4:29676738-29676760 CTGAAACTATTGCAAATAATAGG + Intergenic
971720666 4:30241337-30241359 CTGAAACTATTCTAAAAGATAGG - Intergenic
971907976 4:32753307-32753329 CTTATACATTTCCAAAAAACAGG - Intergenic
971940631 4:33210643-33210665 GTTAAAATATTTCAAAAAACTGG - Intergenic
971981888 4:33762351-33762373 CTCAAAATATTCAAAAACAATGG + Intergenic
972125734 4:35762182-35762204 CTGAAACCATTCAAAAAATCAGG + Intergenic
972755898 4:42045669-42045691 CTGAAACTATTCCAAACAATAGG + Intronic
972843918 4:42964709-42964731 CTAAAACTATACCAGCAAACAGG - Intronic
972856862 4:43118020-43118042 CGCAAACTCTCCCAAAAAAATGG + Intergenic
972880748 4:43418797-43418819 CTTAAACTATTCCTAACACCAGG - Intergenic
972902958 4:43707955-43707977 CTCAAACTTATCCACAAAATTGG + Intergenic
972961649 4:44460510-44460532 GACAAACCATCCCAAAAAACAGG - Intergenic
973083797 4:46029158-46029180 ATGAAACAATTCCAAAAAAGTGG + Intergenic
973731867 4:53830573-53830595 CTCAACTTATTGCCAAAAACAGG - Intronic
973897714 4:55432034-55432056 AACAAACTATTCCAAATCACTGG + Exonic
973967380 4:56177561-56177583 CTCAAACTGTTGCAACAAATTGG - Intronic
974265904 4:59585484-59585506 CTGAAACTATTACAAATAATAGG + Intergenic
974342225 4:60628898-60628920 CTGAAACTATTCCAAACAATAGG - Intergenic
974966292 4:68764530-68764552 CTGAAGCTATTTCAAAAAATTGG + Intergenic
975297896 4:72754980-72755002 CTGAAACTATTCCAGAAAATTGG + Intergenic
976016739 4:80564128-80564150 CTCAACCTATTATAAAAAATAGG + Intronic
976325576 4:83767613-83767635 CTGAAAATAATCCAAAAAAGAGG - Intergenic
976363486 4:84207192-84207214 CTAAAATTATTCCAAACAATAGG + Intergenic
976490418 4:85664055-85664077 CTGAAACTATTCCAATCAATAGG - Intronic
977060435 4:92252572-92252594 TTGAAACTATTCCAAACAATTGG - Intergenic
977176291 4:93824384-93824406 CTCAAAGTATTCAGAAAAAATGG - Intergenic
977199868 4:94102492-94102514 CTGAAACTATTCCAATCAATAGG + Intergenic
977351298 4:95891310-95891332 CTCAAATTTTTCCAAAATAGTGG + Intergenic
977634820 4:99285216-99285238 ATCAAACTATAACAAAAAACAGG - Intronic
977994780 4:103488348-103488370 CTGAAGCTATTCCAAATAATAGG + Intergenic
978085565 4:104648529-104648551 CCCAAACTATTCCAAAAAATAGG + Intergenic
978922126 4:114197036-114197058 CTCAAACTATTCTGAAAAATAGG - Intergenic
979291942 4:118988135-118988157 CTCTAGCTATTCAAATAAACAGG - Intronic
979658685 4:123226754-123226776 CTGAAACTATTCCAATCAACAGG - Intronic
980336200 4:131476749-131476771 CTGAAACTATTCCAAACAACAGG + Intergenic
980893522 4:138839339-138839361 ATCATTCTATTCCATAAAACCGG + Intergenic
981285208 4:143009617-143009639 CTCAAACTCTTCCAAAATAATGG - Intergenic
981758137 4:148163396-148163418 CTCATACTTTTCTGAAAAACAGG + Intronic
981996392 4:150979919-150979941 CTCAAATTATTCCGAAAAATAGG + Intronic
982131122 4:152229483-152229505 CTCAAACCGTTTCAAACAACAGG - Intergenic
982439688 4:155421407-155421429 CTTAAACTATTCCTAACACCAGG + Intergenic
982531794 4:156554438-156554460 CTCAAACTCTAGCAAAAAATTGG - Intergenic
983730564 4:170988406-170988428 CTGAAACTCTTCCAAAATATCGG - Intergenic
983912426 4:173255052-173255074 CTGAAATTATTTTAAAAAACAGG + Intronic
984101191 4:175488422-175488444 CTGGAACTATTCCAAACAATAGG + Intergenic
984340201 4:178447348-178447370 CTGAAACTATTCCAATCAATAGG - Intergenic
984404835 4:179314592-179314614 GTCAAACTATTGGAGAAAACTGG - Intergenic
984792382 4:183626541-183626563 CTTAAAATATTCAAAAAAACAGG - Intergenic
985059295 4:186059823-186059845 GTCAAACCTTTCCAAAAAATGGG - Intergenic
987537935 5:19212084-19212106 CTCAAACTATTCTGAAAAACAGG + Intergenic
987631790 5:20482380-20482402 CTCAAACTATTACAAAAAGTAGG + Intronic
987674541 5:21058659-21058681 CAGAAACTATTCCAAAGAATCGG - Intergenic
987955335 5:24731328-24731350 CTCACACTAAAACAAAAAACGGG - Intergenic
988219172 5:28319064-28319086 CAAAAACTATTGCACAAAACAGG - Intergenic
988308757 5:29529556-29529578 CAAAAACAATTCCAAAAATCTGG + Intergenic
988392062 5:30647144-30647166 CTCATACTATTCCACATAATTGG - Intergenic
989186340 5:38630546-38630568 ATCAAACTACTCCAAACTACAGG - Intergenic
989789204 5:45374596-45374618 CTTAAACTATTCCAAAAACTTGG + Intronic
990858762 5:60302212-60302234 CTGAAACTATTCCAAAAAAAAGG - Intronic
990894440 5:60682887-60682909 ATCAAATTATTCCAAAAAAATGG + Intronic
991323788 5:65406690-65406712 CTGACACTATTCCAATCAACAGG - Intronic
991545914 5:67781203-67781225 ATCAAACTACTCCAAACTACAGG + Intergenic
992029368 5:72705637-72705659 CACAAACTCTTCCAGAAAATTGG - Intergenic
992733979 5:79700462-79700484 CTCAAACCATGCCTTAAAACTGG + Intronic
992756799 5:79914548-79914570 CTGAAACTATTCCAATCAATAGG + Intergenic
992757051 5:79917289-79917311 CTGAAACTATTCCTGAAAATTGG + Intergenic
993185226 5:84609332-84609354 TGCAAACTATTCCTAATAACAGG + Intergenic
993205778 5:84876607-84876629 CTCAAACTGTTCCAAAAAATAGG + Intergenic
994015375 5:94958867-94958889 CTAAAACTATTCCAAACAATAGG + Intronic
994057549 5:95435380-95435402 CTCAAATTATTCCAAAAAGCAGG - Intronic
994150503 5:96442148-96442170 ATCAAACTATTCCACATAAGTGG - Intergenic
994330555 5:98500797-98500819 CCCAAACTGTTGCAAAAAGCAGG - Intergenic
994434575 5:99710940-99710962 CTGAAACTATTCCAATCAATAGG - Intergenic
994707893 5:103228185-103228207 CTAAAACTATTCTGAAAAACTGG + Intergenic
995089761 5:108160655-108160677 CTAAAACTAGACCTAAAAACAGG + Intronic
995230672 5:109758096-109758118 GTCAAACTTTTCCAAAAGAGCGG + Intronic
996121302 5:119675317-119675339 CTCAAACTATTCCAAAAAATTGG - Intergenic
996130281 5:119773126-119773148 CTGAAACTATTCCGAACAATAGG + Intergenic
996274142 5:121644154-121644176 TTGAAACTATTCCAAAAATTTGG + Intergenic
996454728 5:123667661-123667683 CTGAAAGTACTCTAAAAAACTGG + Intergenic
996945683 5:129064370-129064392 CTCAATCTTTTCCACAAATCAGG - Intergenic
997061432 5:130508622-130508644 CTCTAACTCTTCCAAACAAATGG - Intergenic
998529791 5:142873971-142873993 CTCAAACTTTTCAAAGAAGCTGG - Intronic
998626611 5:143853248-143853270 ATCAAACTACTCCAAGCAACAGG + Intergenic
998927102 5:147138511-147138533 CTGAAACTATTCCAAACAATAGG - Intergenic
999350788 5:150869523-150869545 TTGAAACTATTCCAAAAGATAGG - Intronic
999455492 5:151713116-151713138 CTCAAACTATTCCAAAAAACAGG - Intergenic
999567127 5:152876820-152876842 TGGAAACTTTTCCAAAAAACTGG + Intergenic
1000808058 5:165822215-165822237 CTAAAACAATCCCAAAAAAGAGG - Intergenic
1001268914 5:170296292-170296314 CACAAAATATGGCAAAAAACAGG + Intronic
1001883410 5:175265469-175265491 CACAAACTATACAAAGAAACAGG + Intergenic
1001950162 5:175810825-175810847 CTCAAAGAATTCTAATAAACTGG + Intronic
1002013162 5:176301039-176301061 CTCAGACTTTTGCAAAAAACCGG + Intronic
1003394017 6:5737573-5737595 CTCACACTATTCCAGAAAGCAGG - Intronic
1003601793 6:7524474-7524496 CTCATACTATTCAAAAACATGGG + Intergenic
1004749589 6:18548071-18548093 CTGAAACTATTCCAATCAATAGG - Intergenic
1004983747 6:21057066-21057088 CTGAAACTATTCCAAACAACTGG - Intronic
1005208188 6:23429220-23429242 ATGAAACTATTCCAAACAATAGG - Intergenic
1005362725 6:25046951-25046973 CTGAAACTATTCCAAAAAACTGG + Intergenic
1005416637 6:25606747-25606769 CTAAAACTATTCACAAAAACAGG - Intronic
1006278991 6:33031459-33031481 CACAAGCGATTCCAAAAGACGGG - Intergenic
1008069647 6:47086427-47086449 CCCAAATTAGTCCAAAATACTGG + Intergenic
1008619961 6:53262138-53262160 CTCAAATTTCTCCAAAAAAATGG - Intergenic
1008641708 6:53469869-53469891 CTGAAACTACTCCAAAAAATAGG - Intergenic
1008990595 6:57597277-57597299 CTCTAACTATTCATACAAACTGG - Intronic
1009179170 6:60495823-60495845 CTCTAACTATTCATACAAACTGG - Intergenic
1009558460 6:65206482-65206504 CTGCAACTATTCCAAAAATTTGG + Intronic
1009748370 6:67849787-67849809 CTTAAAACATTCCAAAAAATTGG + Intergenic
1009800884 6:68534755-68534777 TTCAAACTATTCCGAGAAAGGGG - Intergenic
1010151978 6:72743777-72743799 TTAATACTACTCCAAAAAACAGG - Intronic
1010304106 6:74297710-74297732 TTCAAACTCTTCCAAAAAAGTGG + Intergenic
1010426486 6:75733932-75733954 CTCCAACTATTCCAACAACTGGG - Intergenic
1010466200 6:76169230-76169252 CTATAACTATTCCAAAACACAGG + Intergenic
1010654804 6:78499688-78499710 CAGAAATTATTACAAAAAACTGG - Intergenic
1011252036 6:85381725-85381747 TTCAAACAATTCAAGAAAACTGG + Intergenic
1011361770 6:86533691-86533713 TTCAAAATATTCCAAAAATAAGG - Intergenic
1011377329 6:86703638-86703660 CTGAAACTATTCCAAACAGTTGG - Intergenic
1011433261 6:87310704-87310726 CTCAATCAAAGCCAAAAAACAGG + Intronic
1011876964 6:91973676-91973698 CTGAAACTATTCCAATCAATAGG + Intergenic
1012001419 6:93659784-93659806 CTCAAAATATTCCAAAACTAGGG - Intergenic
1012220332 6:96641240-96641262 CTGAAACTATTCCAATCAATAGG + Intergenic
1012253381 6:97005025-97005047 CTAAAACTATTCAAAAACATTGG - Intronic
1012673963 6:102091657-102091679 CTGAAACTATTCCAATCAATAGG + Intergenic
1012783428 6:103591923-103591945 CGGAAACTATTCCAATCAACAGG - Intergenic
1012795924 6:103761292-103761314 TTCAAACTCTTCCAAAAGATTGG + Intergenic
1012813531 6:103991188-103991210 CAGAAACTAATCCAAAAAAGTGG + Intergenic
1013895597 6:115084164-115084186 CTGAAACTATTCCAATCAATAGG + Intergenic
1013964530 6:115938924-115938946 CTGAAACTATTCCAAACAATAGG + Exonic
1014058127 6:117040311-117040333 CTGAAACTATTCCAAACAATAGG - Intergenic
1014643927 6:123950345-123950367 CTCAAACTGTTTTAAAAAATTGG - Intronic
1014658503 6:124136453-124136475 CTGAAACTATTCCAAAAGATGGG + Intronic
1014703563 6:124719217-124719239 CCCAACCTATTCCATAAAATTGG + Intronic
1015032473 6:128612159-128612181 CTCTAACTCTTCCAGAAAATTGG - Intergenic
1015900140 6:138056556-138056578 CTAAAACTATTCCAAAAGATAGG + Intergenic
1015981411 6:138843316-138843338 CTCAGAGTATTCCGAAAGACAGG - Intronic
1016133938 6:140514300-140514322 ATCAAACTCTTCCAGAAAATAGG - Intergenic
1016457976 6:144250865-144250887 CTCAAACTATTCAATAACACTGG + Intergenic
1016612299 6:146004538-146004560 CTCAAACTATTTTGAAAAATAGG + Intergenic
1016660822 6:146577564-146577586 CTAAAACTACTCAAAAAAATAGG + Intergenic
1016726655 6:147378173-147378195 CACAAACTCTTCCAAAAGATAGG + Intronic
1017846516 6:158263114-158263136 CTAAAAATATTCTAACAAACTGG - Intronic
1018214207 6:161511059-161511081 CTCAAACTATAACAAAGGACAGG + Intronic
1018883344 6:167907324-167907346 CTGAAAGTATTCCTAAAAAAGGG + Intronic
1019087645 6:169495867-169495889 CTCCAACTTTTCCAAAAACTGGG + Intronic
1019940722 7:4287369-4287391 CTAAAACTTTTAGAAAAAACAGG - Intergenic
1020546321 7:9536486-9536508 CTGAAACTATCCCAAAATACTGG - Intergenic
1021050504 7:15978127-15978149 CTCAATCAATTCCTAAAAGCTGG - Intergenic
1021305491 7:19026489-19026511 CTAAAACTACACCAAAAAACTGG + Intronic
1021465740 7:20941624-20941646 CTCAAACTTTTCCAAAAAAATGG + Intergenic
1022061422 7:26799823-26799845 CTTAAAACATTCAAAAAAACAGG + Intronic
1022323909 7:29312763-29312785 CTCAGACTATTCCCAAATAATGG + Intronic
1024106435 7:46092414-46092436 CTGAAACTATTCCAGAAAATTGG - Intergenic
1024621864 7:51166551-51166573 TTCAAACTATTCCAAAAAACAGG + Intronic
1024722663 7:52155283-52155305 ATCAAATTATTGCCAAAAACAGG + Intergenic
1025547525 7:62195962-62195984 CTGAAACTATTCCAATCAACAGG - Intergenic
1025616214 7:63119690-63119712 CCCAAACTCTTCCAAAGAATTGG + Intergenic
1026249403 7:68655910-68655932 CACAAACTTTTTGAAAAAACAGG + Intergenic
1028013370 7:85677486-85677508 CTGAAACTATTCCAATCAATAGG - Intergenic
1028300385 7:89192600-89192622 CTGAAACTATTCCAGAAAATTGG + Intronic
1028306491 7:89271613-89271635 CTGAAACTATTCCAATCAATAGG - Intronic
1029901257 7:104042355-104042377 CACAAACTCTTCCAAGAAATAGG - Intergenic
1030245495 7:107380756-107380778 CCGAAACTATTCCAAACAATAGG + Intronic
1031658130 7:124384070-124384092 CTGAAACTGTTCTGAAAAACAGG + Intergenic
1031954829 7:127931848-127931870 CTTAAAATATTCCATAAACCAGG - Intronic
1032966682 7:137105776-137105798 CTGAAACTATTGCAAACAACAGG + Intergenic
1033525957 7:142213770-142213792 CTGAAACTATTCCAAACAAGAGG + Intronic
1033726169 7:144120758-144120780 CTGAAACTATTCCAATCAATAGG + Intergenic
1033872277 7:145769556-145769578 TTCAAACTATTAAAAAAAACTGG - Intergenic
1035554845 8:559341-559363 CTGAAACTATTCCAAACAATTGG + Intergenic
1035959070 8:4116799-4116821 CTAAAACTACTCTAAAAAATAGG + Intronic
1036730879 8:11263398-11263420 CACAAACTTTTCCAAAAAACGGG - Intergenic
1037377278 8:18244476-18244498 CTTAAACTATGCTAAAAATCAGG - Intergenic
1037428071 8:18778997-18779019 CTCAAACTATTCCGAAAAATTGG - Intronic
1037656911 8:20892067-20892089 CTCAAACTACCCCATAAAAATGG - Intergenic
1037939012 8:22936553-22936575 CTCAAACTCTTCCAAAACATTGG + Intronic
1038238974 8:25790671-25790693 CTCAAACTCTTCCAAAGAGGAGG - Intergenic
1039289587 8:36079477-36079499 CTGAAACTACTCCAAAAAATTGG + Intergenic
1039678724 8:39704157-39704179 CTGAAACTATTCCATAAAATTGG + Intronic
1039994134 8:42516826-42516848 CTCTAACTAACCCACAAAACAGG + Intronic
1040684740 8:49858265-49858287 CTCAATTTCTTCCAAAAAATTGG - Intergenic
1040774646 8:51026694-51026716 TTCAAACTCTTCCAGAAAAGAGG - Intergenic
1041630241 8:60079436-60079458 CTGAAACTATTCCAAACAATAGG - Intergenic
1041771498 8:61477343-61477365 CTGAAACTATTCCAATCAATAGG - Intronic
1041823563 8:62066362-62066384 CTCAAACTATTCAGAAAAATAGG + Intergenic
1041843553 8:62299872-62299894 CTAAAACTATGCCAGGAAACTGG - Intronic
1041885611 8:62804210-62804232 CTGAAACTATTCCAATCAATAGG + Intronic
1041886489 8:62815317-62815339 CTGAAACTATTCCAATCAATAGG + Intronic
1041933762 8:63314798-63314820 CTTAAACTATGCCAAAGACCTGG + Intergenic
1041996339 8:64064006-64064028 CTCAAACTCTTCAAAAAAGTTGG + Intergenic
1042038361 8:64563340-64563362 CTGAAACTATTCCAAACAATAGG - Intergenic
1042070480 8:64927985-64928007 CTGAAACTATTCCAAACAATTGG - Intergenic
1042675258 8:71313441-71313463 CTGGAACTATTCCAGAAAGCTGG + Intronic
1042687202 8:71455355-71455377 CTGAAACTATTCCAATCAATAGG + Intronic
1042901174 8:73729455-73729477 CTCAAACTCTTCCAAAAAATTGG - Intronic
1043840446 8:85096875-85096897 CTAAAACTTTTCAAAAAAAATGG + Intergenic
1044007064 8:86950686-86950708 CTCAAACTATTCTGAAAAACAGG - Intronic
1044877016 8:96679466-96679488 CTCAAACTATTCAAAAAAATTGG - Intronic
1045079621 8:98611057-98611079 CTCAAACTGATACAAAGAACTGG + Intronic
1045928471 8:107597958-107597980 CTTAAACTATTCCTAACATCAGG - Intergenic
1045929703 8:107606987-107607009 CTTAAACTATTCCTAACATCAGG - Intergenic
1046047637 8:108983158-108983180 CTGAAACTATTCCAATCAATAGG - Intergenic
1046113849 8:109761315-109761337 CTCAGACTATTCTGAAAAACAGG - Intergenic
1046763337 8:118043822-118043844 CCAAATCTATGCCAAAAAACAGG + Intronic
1047083290 8:121488644-121488666 CTCAAACCATTCCAAAATAATGG + Intergenic
1048626637 8:136192744-136192766 CTGAAACTATTCCAATCAATAGG - Intergenic
1048713768 8:137243961-137243983 CTGAAACTATTCCAATCAATAGG + Intergenic
1050109960 9:2204548-2204570 GTCAAAGTATACCAAAAAACAGG + Intergenic
1050141236 9:2518135-2518157 CTGAAACTATTCCAAACAATAGG - Intergenic
1050517283 9:6458051-6458073 CTGAAACTATTCCAAACAACAGG - Intronic
1050857003 9:10371791-10371813 CCCAAAATATTCCAAGAAAATGG - Intronic
1050927691 9:11286466-11286488 CTGAAACTATTCCAATCAATAGG + Intergenic
1051793874 9:20841270-20841292 CTTAAACTATTACAAAAAATAGG - Intronic
1051998721 9:23250364-23250386 CTGAAACAATTCCAAACAATAGG + Intergenic
1052061211 9:23963245-23963267 CTGAAACTATTCCAAACAGTGGG - Intergenic
1052092817 9:24350302-24350324 TTCAAACCATTCCAGAAAATAGG + Intergenic
1052094319 9:24366120-24366142 CTGAAACTATTTCAAAAAACTGG - Intergenic
1052152655 9:25137740-25137762 CCCAAATTATTCCAAAAATTTGG + Intergenic
1052458088 9:28727200-28727222 CCCAAACTATTCCAAAGAATAGG + Intergenic
1052586227 9:30431359-30431381 CTCAAACTATTCCAAAATAGAGG + Intergenic
1052667681 9:31515920-31515942 CTGAAACTATTCCAAATAATAGG - Intergenic
1052696508 9:31885702-31885724 TTGAAACTATTCCAAATAATAGG - Intergenic
1053690726 9:40585728-40585750 CTCAAATTATTTTGAAAAACAGG - Intergenic
1054274079 9:63051763-63051785 CTCAAATTATTTTGAAAAACAGG + Intergenic
1054301984 9:63386699-63386721 CTCAAATTATTTTGAAAAACAGG - Intergenic
1054400761 9:64713205-64713227 CTCAAATTATTTTGAAAAACAGG - Intergenic
1054434368 9:65197519-65197541 CTCAAATTATTTTGAAAAACAGG - Intergenic
1054496022 9:65824162-65824184 CTCAAATTATTTTGAAAAACAGG + Intergenic
1054764497 9:69032239-69032261 CTACAACTATTCCAACCAACAGG - Intergenic
1055014321 9:71599423-71599445 CTGAAACTATTCCAATCAATAGG + Intergenic
1055367596 9:75561957-75561979 CTGAAACCATTCCAAAAAATTGG - Intergenic
1055444040 9:76365211-76365233 CTCAAACTAATCCCAAAATAGGG - Intergenic
1055911423 9:81356782-81356804 CCCAAACTGTTCCAAAAAATAGG + Intergenic
1056003200 9:82239543-82239565 CTCAAACTATTCCAAACAAGAGG - Intergenic
1056705111 9:88945441-88945463 ATCAAATCATTACAAAAAACAGG - Intergenic
1056994149 9:91440058-91440080 CCTAAACTCTTCCAAAAAATAGG - Intergenic
1057129889 9:92647359-92647381 CTGAAACTCCTTCAAAAAACTGG + Intronic
1058535236 9:105951578-105951600 CACAAACTCCTCCAGAAAACAGG - Intergenic
1059999342 9:119944140-119944162 CTCAAGCTATTTCAAAGAAGAGG - Intergenic
1061456758 9:130703991-130704013 CTGAAACTATTCCCTAATACCGG - Exonic
1203621379 Un_KI270749v1:131844-131866 CTCAAACTATTTTGAAAAACAGG - Intergenic
1186749784 X:12609610-12609632 CTCACTCTCTACCAAAAAACAGG + Intronic
1188197751 X:27259416-27259438 CTCAAACTAGTCAAAGAAAAAGG - Intergenic
1188393379 X:29649195-29649217 CTCAAGCTATTACAAAAAATTGG + Intronic
1188426734 X:30056600-30056622 ATCAAACTATTTTAAAAAACAGG - Intergenic
1188560900 X:31467709-31467731 CTGAAACTATTCTAAACAATAGG - Intronic
1188668544 X:32854782-32854804 CTCAAACTATTGTGAAAAAGAGG + Intronic
1188725213 X:33574460-33574482 CTGAAACTATTACAAAAAATTGG - Intergenic
1189109871 X:38278239-38278261 CTCAAACAAAAGCAAAAAACAGG - Intronic
1189581344 X:42410245-42410267 CTGAAACTATTCCAAAATATTGG - Intergenic
1190040324 X:47066098-47066120 CATAAACTCTTCCAAAAAATTGG + Intergenic
1190800804 X:53786933-53786955 CTGAAACTATTCCAATCAATAGG + Intergenic
1191132981 X:57034599-57034621 CTGAAACTATCCCAAACAATAGG - Intergenic
1191188945 X:57644907-57644929 CTCAAACTAAGTCAAAAAATAGG + Intergenic
1191196380 X:57728025-57728047 CTGAAACTATTCCAATCAATAGG - Intergenic
1191749340 X:64524572-64524594 CTGAAACTACTCCAAAAATTTGG + Intergenic
1191767679 X:64716782-64716804 TTCAAACAATTTCAAAAAAATGG + Intergenic
1192133894 X:68578816-68578838 CTGAAACTATTCCAATCAACAGG - Intergenic
1192293158 X:69818814-69818836 CTGAAACTATTCTAAACAATTGG + Intronic
1192540785 X:71970288-71970310 CACAAACTCTTCCAAAAACGGGG - Intergenic
1192806025 X:74510033-74510055 CACAAACTCTTCCAAAAAATTGG - Intronic
1192857919 X:75033776-75033798 CTGAAACTATTCCAAACAATAGG - Intergenic
1193001079 X:76563139-76563161 CTGAAACTATTCCAATCAATAGG + Intergenic
1193011892 X:76685876-76685898 CTGAAATCATTCCAAAAAATGGG - Intergenic
1193079024 X:77387003-77387025 CTCAAACTATTCCAAAAAATAGG + Intergenic
1193175907 X:78392315-78392337 CTCAAATAATTCCAAAACAGAGG + Intergenic
1193215774 X:78862466-78862488 CCCAAACTATTCCAAACAGCAGG + Intergenic
1193252112 X:79303365-79303387 CTAAAACCATTCCAAAAAAGTGG + Intergenic
1193513792 X:82437773-82437795 CTGAAACTATTTCAAAAGACAGG + Intergenic
1193583999 X:83298380-83298402 CTGAAAGTATTCCAAAACAGAGG + Intergenic
1193661539 X:84264368-84264390 CTGAAACTATTCCAATCAATAGG - Intergenic
1193830604 X:86284645-86284667 CTCAAACAATTCTGAAAAATAGG - Intronic
1193884109 X:86963581-86963603 CCCAAAATATTCCAACAGACAGG - Intergenic
1193908948 X:87278905-87278927 CTGAAACTATTCCAATCAATAGG + Intergenic
1194013883 X:88595849-88595871 CACTAAAGATTCCAAAAAACTGG + Intergenic
1194016895 X:88633778-88633800 CTCAAACTATTCCAAAAAAATGG + Intergenic
1194203862 X:90987095-90987117 CTGAAACTATTCCAAAAAGTAGG + Intergenic
1194437475 X:93885698-93885720 CTGAAACTATTCCAATCAATAGG - Intergenic
1194438827 X:93903512-93903534 CTGAAATTATTGCAAAAGACAGG - Intergenic
1194439083 X:93907157-93907179 CTCAAACTATTCTAAAAAATAGG - Intergenic
1194947146 X:100082770-100082792 CTCACTCCATTCCAAAGAACTGG + Intergenic
1195122462 X:101769323-101769345 ATCAAACTACTGCAAAAAATGGG - Intergenic
1195489113 X:105445767-105445789 CTTAAAACATTCAAAAAAACTGG - Intronic
1195586432 X:106570385-106570407 CTGAAACTATTCCAAGAAATTGG + Intergenic
1195601620 X:106755355-106755377 CTGAAACTATTCTGAAAAAACGG + Intronic
1195629509 X:107040182-107040204 CTCAAACATTTCCAAAATATTGG + Intergenic
1195982997 X:110600419-110600441 CTCAAACTATTCTGAAAAATAGG - Intergenic
1196471857 X:116037399-116037421 CTGCTACGATTCCAAAAAACTGG + Intergenic
1196599656 X:117587195-117587217 CTCAAACTAACTCAAAAAACAGG - Intergenic
1196615173 X:117759724-117759746 CTGAAACTATTCCAATCAATAGG - Intergenic
1197112026 X:122787517-122787539 CACATACCATTCCAAAATACTGG - Intergenic
1197347083 X:125336954-125336976 CTTAAAGTATGTCAAAAAACAGG - Intergenic
1197366505 X:125570307-125570329 CTGAAACTATTCCAAAAAAATGG + Intergenic
1197402979 X:126015373-126015395 CTCAAACTATTACAAAAATAGGG - Intergenic
1197575624 X:128207759-128207781 CTTAAACTATTCCTAACACCAGG + Intergenic
1198579909 X:138051926-138051948 CTGAAACTATTTGAAAAAATTGG + Intergenic
1199841865 X:151657403-151657425 CTGAAACTATTCCAATCAATAGG - Intronic
1200549699 Y:4562544-4562566 CTGAAACTATTCCAAAAAGTAGG + Intergenic
1201189423 Y:11434438-11434460 CTCAAACTATTTTGAAAAACAGG - Intergenic
1201373528 Y:13291185-13291207 CTCAAACTGTTCTGAAAAAGAGG + Intronic
1201467656 Y:14301933-14301955 GTTAAAATATTTCAAAAAACAGG - Intergenic
1201516861 Y:14827133-14827155 CTCAAACTAGTGCTAATAACAGG + Intronic
1201639504 Y:16164408-16164430 CTTAAACTATTCCTAACACCAGG - Intergenic
1201640649 Y:16172897-16172919 CTTAAACTATTCCTAACACCAGG - Intergenic
1201662166 Y:16412429-16412451 CTTAAACTATTCCTAACACCAGG + Intergenic
1201663309 Y:16420916-16420938 CTTAAACTATTCCTAACACCAGG + Intergenic
1201974747 Y:19836646-19836668 CTGAAACTATTCCAATCAATAGG - Intergenic
1201981433 Y:19914247-19914269 CTTAAACTATTCCTAACACCAGG - Intergenic
1201992098 Y:20038386-20038408 TTAAAACTATTTCAAAAAATTGG + Intergenic
1202044159 Y:20720837-20720859 CTGAAACTATTCCAATCAACAGG + Intergenic
1202584215 Y:26407539-26407561 CTCAAACTATTTTGAAAAACAGG + Intergenic
1202600060 Y:26584598-26584620 TTGAAACTATTCCAAAGAACAGG - Intergenic