ID: 1089762744

View in Genome Browser
Species Human (GRCh38)
Location 11:120740373-120740395
Sequence TTCCCTCACCCCCGCATGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089762737_1089762744 10 Left 1089762737 11:120740340-120740362 CCTTTTGCGGTGGCAGTAGCTCC 0: 1
1: 0
2: 1
3: 5
4: 73
Right 1089762744 11:120740373-120740395 TTCCCTCACCCCCGCATGAGTGG 0: 1
1: 0
2: 0
3: 13
4: 109
1089762736_1089762744 14 Left 1089762736 11:120740336-120740358 CCAGCCTTTTGCGGTGGCAGTAG 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1089762744 11:120740373-120740395 TTCCCTCACCCCCGCATGAGTGG 0: 1
1: 0
2: 0
3: 13
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089762744 Original CRISPR TTCCCTCACCCCCGCATGAG TGG Intronic
900724729 1:4208498-4208520 TGCCCTGACCCCCGCAGGAAAGG - Intergenic
900974314 1:6007754-6007776 TGCCCTTACCCCCGAAGGAGGGG + Intronic
901663940 1:10815919-10815941 TTCCCTGACACCCACAGGAGGGG + Intergenic
904160485 1:28518866-28518888 GTCCCCCAGCCCCGCAAGAGAGG - Intronic
904477603 1:30775106-30775128 TTCCCTCACCCCAGGCTGGGTGG - Intergenic
904814384 1:33183973-33183995 TTTCCCCACCCCCTCATTAGGGG - Intergenic
905171732 1:36113777-36113799 ATCCCTCACCCCTGCAAGTGAGG + Intronic
905175140 1:36130668-36130690 CTCCATCACCCCTGCCTGAGAGG - Intergenic
917033145 1:170717251-170717273 TTCCCTTACTCCCACATCAGGGG + Intronic
922012092 1:221599139-221599161 TTCGCTCACCACTGCGTGAGAGG + Intergenic
922970232 1:229729788-229729810 CTCCCTCACCCTTCCATGAGGGG + Intergenic
1069833889 10:71296729-71296751 TTCCCTCACCTCTGCCAGAGTGG - Exonic
1069833900 10:71296779-71296801 TTCCCTCACCTCCGCCAGTGTGG - Intronic
1069833912 10:71296829-71296851 TTCCCTCACCTCCGCCAGCGTGG - Intronic
1069833924 10:71296879-71296901 TTCCCTCACCTCCGCCAGCGTGG - Intronic
1069833936 10:71296929-71296951 TTCCCTCACCTCCGCCAGCGTGG - Intronic
1069833948 10:71296978-71297000 TTCCCTCACCTCCACCAGAGTGG - Intronic
1071415358 10:85436164-85436186 TTCCTTCACCCCAGCATGCCAGG - Intergenic
1072426206 10:95332927-95332949 CTCCCCCACCCCTGCATGAGTGG - Intronic
1075711574 10:124533635-124533657 CTCCCTTACCCCCGTGTGAGTGG + Intronic
1077554737 11:3220510-3220532 TAACCTCACCCCAGCATGGGGGG - Intergenic
1083882251 11:65554353-65554375 TGCCCTCTCCCCTGCATGAATGG - Exonic
1089374187 11:117982966-117982988 TTGCCACACCCCCAGATGAGTGG - Intergenic
1089390300 11:118097433-118097455 TACCCTCACCTCCACATGACTGG - Intronic
1089762744 11:120740373-120740395 TTCCCTCACCCCCGCATGAGTGG + Intronic
1092242451 12:6843547-6843569 TTCCCTGAACCCCTCAGGAGGGG - Intronic
1092538465 12:9405956-9405978 TTCCCTCCCCCCCGCGTTAGGGG - Intergenic
1092679986 12:10968615-10968637 TTCCCTTACCCCTTCATGGGAGG + Intronic
1100513320 12:95299315-95299337 GTCGCTCATCCCAGCATGAGGGG - Intronic
1100632266 12:96400546-96400568 TTACCCCACCCCCGCCTGAGCGG + Exonic
1101431769 12:104632911-104632933 TTCCCTCACCCCCTCCAGGGAGG - Intronic
1102609508 12:114099177-114099199 TGCCCTCCCCCTCCCATGAGGGG - Intergenic
1102731370 12:115113765-115113787 TTACCCCACCCCCCCATGACAGG - Intergenic
1106079325 13:26487533-26487555 TGCACTGACCTCCGCATGAGAGG - Intergenic
1108178458 13:47818506-47818528 CCCCCTCATCCCTGCATGAGGGG + Intergenic
1108694817 13:52893760-52893782 TTCCCTACTCCCGGCATGAGGGG - Intergenic
1113440790 13:110326586-110326608 TTCACTCACCCCAGCATGCTGGG + Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1114884207 14:26827494-26827516 TCCCCTTACCACCTCATGAGGGG + Intergenic
1120019322 14:79510481-79510503 TTGCCTCACTCCTGCATGACAGG + Intronic
1120524876 14:85566273-85566295 TTCCCTGACCCACGCATGTGTGG - Intronic
1122721755 14:103726186-103726208 TGCCCTGACCCCCGCCTGTGAGG - Intronic
1123477327 15:20599015-20599037 CACCCTCACCCCCGCATGGGAGG - Intergenic
1123640689 15:22401367-22401389 CACCCTCACCCCCGCATGGGAGG + Intergenic
1128778455 15:70341863-70341885 TTTCCTCATCTCCGAATGAGAGG + Intergenic
1132002488 15:98194053-98194075 TTCCCTGACCTCCCCAGGAGAGG + Intergenic
1132223531 15:100123418-100123440 TTCCCTCACCCTCTCCTGTGAGG + Intronic
1132478755 16:155202-155224 TTCCCTCTGCCCTGGATGAGGGG - Intronic
1133530237 16:6648423-6648445 TTCCCTCATCCGCACATAAGGGG - Intronic
1135836571 16:25831167-25831189 TTCCCTCACCACCCCATCAAGGG + Intronic
1140048146 16:71456325-71456347 TTCCCTTACCCCTGAATTAGAGG + Intronic
1143587109 17:7855802-7855824 TGCCCCCACCCCTGCCTGAGCGG + Exonic
1143674456 17:8421797-8421819 TACCCTCACCCTCCCAGGAGAGG + Intronic
1145941397 17:28745035-28745057 TTCCCACACCCGGGCCTGAGGGG - Intronic
1148724715 17:49780414-49780436 TGCCCTTACCCCAGCATGTGTGG - Intronic
1151372804 17:73659577-73659599 TTCCCTTAGCCCCGCATGGCAGG + Intergenic
1152868274 17:82736919-82736941 TTCCCTCCCACCCCCACGAGGGG + Intronic
1153541367 18:6159398-6159420 TTGCCTCACCTCTGGATGAGAGG + Intronic
1157816134 18:50730568-50730590 TTGCCTCACCCCTGCATGGTCGG + Exonic
1158333421 18:56388145-56388167 TGCCATCACCCCGGAATGAGTGG + Intergenic
1158991863 18:62876952-62876974 TTCCCTCTTTCTCGCATGAGAGG - Intronic
1160362741 18:78297480-78297502 TTCCCTCATCCCTTCCTGAGAGG + Intergenic
1161041502 19:2113061-2113083 TGCCCTCACGCCTGCCTGAGAGG + Intronic
1163303298 19:16461722-16461744 TTTCCTCACCCTCTGATGAGCGG + Intronic
1164679465 19:30124083-30124105 TCCCCACACCCCCGCTGGAGGGG - Intergenic
925367137 2:3318194-3318216 CTCCCTCAACCCCACATGTGTGG - Intronic
926115530 2:10210632-10210654 TTCCCCCACTCCGGCATGAGAGG - Exonic
926435829 2:12836545-12836567 TTCCCTCCCACCCGCCTGAGAGG - Intergenic
932851760 2:75194427-75194449 TTCCCTCACCCCACCTGGAGGGG - Intronic
935175983 2:100649029-100649051 TTCCCTGACCCCTTCATGGGTGG - Intergenic
942108475 2:172656835-172656857 TTCCCCCACCCACACATGAGGGG + Intergenic
1170730912 20:18974051-18974073 TTCCCTCTCCCCAGAGTGAGTGG + Intergenic
1171146282 20:22786454-22786476 TTCCCTCACACCCAGATAAGAGG + Intergenic
1171492771 20:25532859-25532881 TCCCCTCACCCCAGGAAGAGGGG + Intronic
1173160188 20:40646681-40646703 TCCCCCCACCCCCCGATGAGTGG - Intergenic
1174178955 20:48662929-48662951 TACCCTCACCCACAAATGAGAGG + Intronic
1182128916 22:27836421-27836443 TTCCCCCAAACCCGCATGACTGG + Intergenic
1182909586 22:33971013-33971035 TTCCCTAACCCCATCATGAGCGG - Intergenic
1184878273 22:47289167-47289189 TTCCCTCACCACCCCATTGGAGG - Intergenic
1185128859 22:49026088-49026110 TTCCCCCACCCTGGCATTAGCGG + Intergenic
1185136477 22:49076247-49076269 TTCCCTCACCACCTCCTGCGGGG - Intergenic
950555006 3:13690045-13690067 TTCCCTCCCCCAGGCAGGAGGGG - Intergenic
952486080 3:33811371-33811393 TTCCCCCACCCCTTCATCAGGGG - Intronic
953657445 3:44864859-44864881 TTCAATCTCCCCTGCATGAGTGG - Intronic
954563445 3:51578553-51578575 TTCCTTGACCCCCTCATGGGTGG + Intronic
961551474 3:127672654-127672676 CTCCCTCACTCCCGCCCGAGGGG + Exonic
961825382 3:129596543-129596565 TTCCCTCCCCCCAGCAGGAGGGG + Intronic
968753666 4:2403311-2403333 TTCCCACGCCCCCACTTGAGTGG - Intronic
972532932 4:39977165-39977187 CTCCCTCACCCCCGCGGGAGGGG + Intronic
975503849 4:75116983-75117005 TTCCCTCTCCTCTCCATGAGTGG - Intergenic
979846800 4:125523320-125523342 TTCTCTGACCCCCTCGTGAGGGG - Intergenic
982281063 4:153684208-153684230 TTCCCGCACCCCAGAAGGAGGGG + Intergenic
982388601 4:154839262-154839284 TTCCCTCAGCCCCCCATCACTGG - Intergenic
987794012 5:22605377-22605399 TTCCATCAGTCCCTCATGAGAGG + Intronic
991666649 5:69006139-69006161 TTCCCTCATCCCAGCCTGAAAGG - Intergenic
997346749 5:133197752-133197774 TTCCCTCTCCCACATATGAGTGG - Exonic
1000305945 5:159994790-159994812 TTCTCTCACCCCTGCAGGATAGG - Intergenic
1003861212 6:10323479-10323501 TTCTGTCATCCCCGCATTAGTGG + Intergenic
1007254476 6:40519060-40519082 TTCCCTGACCCCTGCAGAAGGGG - Intronic
1007691222 6:43702860-43702882 TTCCGTCACCTCCCAATGAGGGG + Intergenic
1009416175 6:63418909-63418931 TTCCCTCTTCACAGCATGAGGGG + Intergenic
1012610282 6:101209657-101209679 TTCCCTCACACCCTAAGGAGTGG - Intergenic
1016183032 6:141170778-141170800 TTCCCTGACCCCGTCATGGGTGG + Intergenic
1017288378 6:152705003-152705025 TTCCCTCACCCCCAAATCACTGG + Intronic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018502643 6:164427887-164427909 TTCCCTCAGCACTGCATAAGGGG - Intergenic
1022531984 7:31072698-31072720 TGCCCCCACCCCGGCCTGAGAGG + Intronic
1026988379 7:74569135-74569157 TTCCCTGACCCCCCGATGTGTGG - Intronic
1035764980 8:2098587-2098609 GTCCCCTACCCCCGCAGGAGTGG + Intronic
1036656963 8:10683063-10683085 TTCCTGCACCCCTGGATGAGTGG - Intronic
1037465991 8:19161224-19161246 TTCCCTCACCCCTGCAAGCACGG - Intergenic
1037773430 8:21816958-21816980 GACCCTCACCCAAGCATGAGAGG + Intergenic
1044274489 8:90284231-90284253 TTCCCTGACCCCTTCATGTGTGG - Intergenic
1049775619 8:144402782-144402804 TGCCGTCAGCCCCACATGAGTGG - Intronic
1057462435 9:95275330-95275352 TTCCCTCTCCCCTGCCCGAGTGG - Intronic
1060683061 9:125582886-125582908 TTCCCTCACCCAGGAATGATTGG + Intronic
1061544525 9:131296796-131296818 GTCCCTCGCACCAGCATGAGGGG + Intronic
1062058678 9:134482909-134482931 TCTCCTCACCCTCTCATGAGAGG + Intergenic
1062631541 9:137465283-137465305 TCCCCTCTCCTCAGCATGAGGGG + Intronic
1186127025 X:6425613-6425635 TTCCCTGACCCCTTCATGGGTGG + Intergenic
1186546685 X:10457295-10457317 CACCCTCACCCACGCATGTGTGG + Intronic
1187324565 X:18274390-18274412 TTCCCTGACCCCTTCATGGGTGG - Intronic
1198233808 X:134717581-134717603 TTTCCTCACCCCCACATGTGTGG - Intronic