ID: 1089763374

View in Genome Browser
Species Human (GRCh38)
Location 11:120745134-120745156
Sequence GTGACCAGGATGAAAACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089763374_1089763383 18 Left 1089763374 11:120745134-120745156 CCTCCAGTTTTCATCCTGGTCAC 0: 1
1: 0
2: 2
3: 18
4: 176
Right 1089763383 11:120745175-120745197 GGAGACAGAGGAGGTGACTCCGG 0: 1
1: 1
2: 3
3: 54
4: 518
1089763374_1089763380 -3 Left 1089763374 11:120745134-120745156 CCTCCAGTTTTCATCCTGGTCAC 0: 1
1: 0
2: 2
3: 18
4: 176
Right 1089763380 11:120745154-120745176 CACAGTTGGAGGGAAAACAGTGG 0: 1
1: 0
2: 2
3: 27
4: 273
1089763374_1089763382 9 Left 1089763374 11:120745134-120745156 CCTCCAGTTTTCATCCTGGTCAC 0: 1
1: 0
2: 2
3: 18
4: 176
Right 1089763382 11:120745166-120745188 GAAAACAGTGGAGACAGAGGAGG 0: 1
1: 0
2: 3
3: 65
4: 533
1089763374_1089763381 6 Left 1089763374 11:120745134-120745156 CCTCCAGTTTTCATCCTGGTCAC 0: 1
1: 0
2: 2
3: 18
4: 176
Right 1089763381 11:120745163-120745185 AGGGAAAACAGTGGAGACAGAGG 0: 1
1: 0
2: 5
3: 57
4: 589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089763374 Original CRISPR GTGACCAGGATGAAAACTGG AGG (reversed) Intronic
900984825 1:6067033-6067055 GTGCCCAGGATGGAAAAGGGAGG + Intronic
901504674 1:9676975-9676997 GTGACCAGGACAATGACTGGTGG + Intronic
901583549 1:10266506-10266528 TTGACCAGCATGAAAGCTGGTGG - Intronic
902684499 1:18067135-18067157 GAAACCAGTATGCAAACTGGTGG - Intergenic
904002966 1:27349223-27349245 GTGACGAGGGTGAACACAGGTGG - Intronic
904886528 1:33742662-33742684 GGGCCCAGGATTGAAACTGGAGG + Intronic
904949361 1:34223844-34223866 GTGTCCAGGAAGAAAACTGGAGG - Intergenic
906460076 1:46030202-46030224 GAGAGCAGGAAGAGAACTGGCGG - Exonic
909331940 1:74424152-74424174 GTTACCCAGATAAAAACTGGGGG - Intronic
909351442 1:74657942-74657964 GTGACCAGAATGGAAACTTCTGG + Intronic
912251620 1:108017904-108017926 TTGAGCAGGATGGAAACTAGGGG + Intergenic
913346012 1:117811917-117811939 TTGACCTGGATGAAAACTGTTGG - Intergenic
919330730 1:196167508-196167530 ATAACATGGATGAAAACTGGAGG + Intergenic
919844062 1:201629824-201629846 GTGCCCAGGTTGAAAAATGAAGG + Intronic
919988269 1:202690986-202691008 GTGAGTAGGACGAGAACTGGAGG - Intronic
921303089 1:213769165-213769187 GTAATTAGGATGAAAACTGAAGG + Intergenic
924822113 1:247503462-247503484 ATGACCAGGATGACAACAGAAGG + Intergenic
1062815785 10:499021-499043 GTGCCTTGCATGAAAACTGGTGG - Intronic
1065919970 10:30384652-30384674 GTGATCAGAAAGAACACTGGGGG + Intergenic
1067665398 10:48273645-48273667 TGGACCTGCATGAAAACTGGCGG - Intronic
1067757323 10:49014995-49015017 GTGACAAGGATGTAAACTGTTGG - Exonic
1069943266 10:71969659-71969681 GTGACCAGGACGGAAGTTGGGGG + Intronic
1070920968 10:80186261-80186283 ATGCCCAGGATGAGAACTGTGGG + Intronic
1071070800 10:81691214-81691236 GTGACCAGGAGTAAAACTGCTGG + Intergenic
1073885796 10:108038252-108038274 GGGCTCTGGATGAAAACTGGAGG + Intergenic
1075458652 10:122601262-122601284 GTGCTCAGGATGAGCACTGGAGG + Intronic
1075459283 10:122605321-122605343 GTGCTCAGGATGAGCACTGGAGG + Intronic
1075459915 10:122609380-122609402 GTGCTCAGGATGAGCACTGGAGG + Intronic
1075460547 10:122613439-122613461 GTGCTCAGGATGAGCACTGGAGG + Intronic
1075756659 10:124817648-124817670 GTGGTCAGGGTGAAAACTGCAGG - Intronic
1081226673 11:40532527-40532549 GTGGCCAGGATGGAAATTGTGGG + Intronic
1081291762 11:41334989-41335011 GGGACCAGACTGAAAACTGATGG - Intronic
1081687142 11:45050805-45050827 GTGACCAACGTGAAAAGTGGAGG + Intergenic
1081862375 11:46340600-46340622 ATGAGCAGGAGGAAACCTGGAGG - Intronic
1082965609 11:58963781-58963803 GAGGCCAGGAAGAAAAGTGGCGG - Intronic
1086941406 11:92801921-92801943 GTGCACATAATGAAAACTGGGGG - Intronic
1087866518 11:103234395-103234417 ATGAGCAGGATGAAAATGGGTGG + Intronic
1089763374 11:120745134-120745156 GTGACCAGGATGAAAACTGGAGG - Intronic
1090499004 11:127243460-127243482 GTGAAAAGGAAGAAAGCTGGAGG + Intergenic
1093836213 12:23832186-23832208 GTGACCAGTGTGAAACCAGGAGG - Intronic
1094008640 12:25783107-25783129 GTGACCAGGAGGAAACCTGCAGG - Intergenic
1094579637 12:31722578-31722600 ATGATCAGGATGAAAAGGGGAGG + Intronic
1099140453 12:78967781-78967803 GTGCCGAGGATAAAAACTTGGGG + Intronic
1099908889 12:88805785-88805807 GTGAGCACAATGCAAACTGGGGG + Intergenic
1100152711 12:91760164-91760186 ATGAACATGTTGAAAACTGGAGG + Intergenic
1102392540 12:112561091-112561113 GTAAACAGGATGAAAAATTGTGG - Intergenic
1102955326 12:117054957-117054979 GTGACCGGGATGGAGCCTGGAGG - Intronic
1103211363 12:119169239-119169261 GGGAGCAGGAGGAAGACTGGAGG - Intergenic
1105506020 13:21010375-21010397 GTGACCAGGTGGAGGACTGGGGG - Intronic
1106448924 13:29862397-29862419 GAGACCAGAATGAACACTGTAGG - Intergenic
1109698933 13:65999548-65999570 GTGAGCAGGCAGAAAACAGGAGG - Intergenic
1112669001 13:101613489-101613511 GTGGCCAAGATGAAGTCTGGGGG + Intronic
1116271099 14:42768072-42768094 GTGACCACCAAGAAAACTGAAGG + Intergenic
1118063762 14:62168310-62168332 GTGACCAGGAAGGAAAGTGAGGG + Intergenic
1119599604 14:75966621-75966643 GTGAGCATGATGAAGCCTGGAGG + Intronic
1119745498 14:77040834-77040856 GGGAGCAGGAAGAAAGCTGGGGG - Intergenic
1120389269 14:83885147-83885169 GTGAACAGCATGAGAACTGGAGG + Intergenic
1124448035 15:29756789-29756811 GGGGCCAGGATTAAAACTGTTGG - Intronic
1125442906 15:39722483-39722505 ATCACGAGGCTGAAAACTGGTGG - Intronic
1126201139 15:45987436-45987458 GTGACCCCGATGAAAACTACAGG - Intergenic
1127252328 15:57253338-57253360 GTGACCAGCAGGCAAACTGGTGG - Exonic
1130516749 15:84631577-84631599 GTGACCTGGTTGAAAAGTAGAGG - Intergenic
1132666009 16:1081635-1081657 GTGAACAGGGTGAAAAATGATGG + Intergenic
1132824820 16:1899063-1899085 GTGGCCAGGATCAGAACTGGAGG + Intergenic
1136022299 16:27447928-27447950 GTGACCAGTCAGACAACTGGTGG - Intronic
1138199910 16:55080887-55080909 ATGACCAAGATGAGAACTGGAGG + Intergenic
1140880818 16:79196648-79196670 GTGTACAGGATGAGAACTGGAGG - Intronic
1144077074 17:11729135-11729157 CTGAGCAGTAGGAAAACTGGTGG + Intronic
1145793486 17:27642600-27642622 CTTACCAGGATGGAAACTGAGGG - Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148601370 17:48896690-48896712 GTGACCAGAATGAAAATAGATGG - Intergenic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1153503492 18:5771558-5771580 GTGGCGAGGATGAAACCGGGAGG - Intergenic
1153856695 18:9155620-9155642 CTGACCAAGATTAAAACTGTTGG - Intronic
1154132721 18:11750771-11750793 GTGGGCAGGAGGAAAACTGGTGG + Intronic
1156257056 18:35408858-35408880 GAGACCAGGACCAAAACTGTGGG - Intergenic
1156829182 18:41469793-41469815 GGGGCCAGGAAGAAAACTGAGGG + Intergenic
1158023371 18:52869473-52869495 GTGACCAGAGTGGAAACTTGTGG - Intronic
1159200313 18:65175042-65175064 GTGTCCAGGGAGAAACCTGGTGG + Intergenic
1162757040 19:12866726-12866748 GAGAGCAGGAAGAGAACTGGCGG - Exonic
1162922551 19:13912252-13912274 GTGTCCAGGATGGGAAATGGGGG + Intronic
1163581073 19:18139088-18139110 GGGAGCAGGAGGAGAACTGGGGG - Exonic
1164753242 19:30671256-30671278 GTGTCCAGTCTGAAATCTGGAGG + Intronic
1164783763 19:30913355-30913377 GTGATCAGGATGGGATCTGGGGG + Intergenic
1167570085 19:50281528-50281550 GTGACCAAGGTGTAAGCTGGTGG - Intronic
1168137113 19:54359391-54359413 GTGACCAGGATGAAGCCATGAGG - Intronic
1168160963 19:54509694-54509716 GTGACCAGGATGAAGCCATGAGG + Intronic
925208357 2:2026364-2026386 GTGCCCAGGAGGGAGACTGGAGG + Intronic
925560376 2:5185515-5185537 GTGGCCCTGATGAACACTGGAGG + Intergenic
930736818 2:54788013-54788035 TTGACCATGATGAAACCTGATGG + Intronic
931286496 2:60836168-60836190 GTGACTTGAACGAAAACTGGTGG - Intergenic
933586470 2:84185069-84185091 GTGATTAGGAAGAAATCTGGTGG - Intergenic
935958222 2:108399546-108399568 GAGACCAGGATGAACACTTCTGG - Intergenic
939965524 2:148606790-148606812 GTGCCCAGGAGGAAAATTTGAGG - Intergenic
942552710 2:177135965-177135987 GTGGGCAGTATGAAAACAGGTGG - Intergenic
943593498 2:189827849-189827871 GGGAGAAGGAGGAAAACTGGAGG + Intronic
945954968 2:216078136-216078158 CTGACTAGAAAGAAAACTGGAGG + Intronic
1169063340 20:2677515-2677537 CTGATCAGGATGAAAACAGGTGG + Intergenic
1170130229 20:13011243-13011265 GTCCCAAGGATCAAAACTGGTGG - Intronic
1170399553 20:15966286-15966308 GTGACCATGGAGAAAGCTGGGGG - Intronic
1171408220 20:24928158-24928180 GTGGTCAGGATGAAAGTTGGGGG + Intergenic
1171557699 20:26092929-26092951 ATGACCAAGATGAACACTTGTGG - Intergenic
1179115348 21:38486304-38486326 GTGACCAGGCTGAATACTGTAGG - Intronic
1179724544 21:43334504-43334526 GTGCCCAGGCTGGAAGCTGGGGG - Intergenic
1181731260 22:24848592-24848614 CTGACCAGGCTGTAGACTGGGGG - Intronic
1183624966 22:38996298-38996320 GTGTCCAGGATGAGAACTTCAGG + Intergenic
1184239075 22:43202332-43202354 GTGACCAGGAGGAACCCTAGAGG + Exonic
1185348489 22:50321109-50321131 GTCACCCGGAGGAAGACTGGGGG + Intronic
950122105 3:10488742-10488764 GGGACCAGGGTGGAGACTGGAGG - Intronic
950177517 3:10885711-10885733 GTGCCAAGCATGAAAACTTGGGG + Intronic
950195349 3:11005610-11005632 GTGATGAGGAGGAAAACAGGAGG - Intronic
950566184 3:13771028-13771050 GTGAGCAGGAGGGAGACTGGAGG - Intergenic
952053750 3:29418316-29418338 GGGTCCAGGATAGAAACTGGTGG + Intronic
953544742 3:43856162-43856184 GGGACCTGGAAGATAACTGGGGG - Intergenic
955473081 3:59306840-59306862 GTTACCTGGATGAAAACAAGTGG + Intergenic
958463173 3:94424872-94424894 GTCAGCAGGAGGAAACCTGGGGG + Intergenic
958999170 3:100941573-100941595 CTGACCAAGGTGGAAACTGGTGG - Intronic
961779656 3:129314334-129314356 GTGACCAGGACGAAGTGTGGTGG - Intergenic
963416684 3:145004351-145004373 GTGACATGGATGAAAATTGGAGG - Intergenic
964324558 3:155532501-155532523 GTGACTAGGGAGAAATCTGGGGG + Intronic
964806685 3:160617851-160617873 GTGACCAGCATGAAAGCCAGGGG + Intergenic
965394038 3:168140315-168140337 TTGAACAGGATCAAATCTGGAGG + Intergenic
965840124 3:172895261-172895283 GGGACCAGGAGGAAAACAGATGG - Intronic
968972514 4:3803423-3803445 ATGATTAGGATGAAAACAGGAGG + Intergenic
969334659 4:6500646-6500668 GTGACCAGGAAGGAAAGAGGGGG + Intronic
971265400 4:25092371-25092393 GGGAACAGGAAGAAAACAGGAGG - Intergenic
972006667 4:34118249-34118271 ATGTCCAGGATAAAAACTGTTGG - Intergenic
972847010 4:43002906-43002928 GTGTCAAGGAAGAAACCTGGTGG + Intronic
975769598 4:77707104-77707126 GAGACCTGGAGGGAAACTGGAGG + Intergenic
976600448 4:86933815-86933837 GTGTCCCTGATGAAACCTGGTGG - Intronic
977900280 4:102414685-102414707 GTGGCCAGGTTTAATACTGGTGG - Intronic
978671736 4:111256328-111256350 TTGCCCAGGCTGAAGACTGGTGG + Intergenic
979716432 4:123844395-123844417 GTGGCCAGGATGAGCACTTGTGG + Intergenic
980641859 4:135590728-135590750 GTGGCAGTGATGAAAACTGGTGG - Intergenic
981885177 4:149665811-149665833 GTGGCCAGGATAAAAGCAGGTGG + Intergenic
983443589 4:167819897-167819919 GGCAACAGGAGGAAAACTGGTGG - Intergenic
988525744 5:31985652-31985674 TTGACCAGGATGAAGGGTGGTGG - Intronic
990791714 5:59488089-59488111 GTGACCGGGGTGAAAACTGAGGG - Intronic
990810362 5:59715720-59715742 ATGACCAGGATGGAAACGGATGG + Intronic
993611659 5:90061649-90061671 GAGACCAGGAAGAAAACTGATGG + Intergenic
993799750 5:92318429-92318451 GTGTCAAGGAAGAAACCTGGTGG + Intergenic
994218242 5:97163460-97163482 GTGTCCATCATGAAAACTGATGG + Intronic
994814977 5:104574349-104574371 CTGAACAGAATGAAAACAGGTGG - Intergenic
995538901 5:113165170-113165192 CAGACCAGAATGAAATCTGGTGG + Intronic
999169175 5:149578890-149578912 GTGACTAGGGTGAAAGATGGTGG + Intronic
1002569148 5:180130196-180130218 GTGACCTGGATGAGTACTGTTGG + Intronic
1002991290 6:2241417-2241439 GTGAGAAGGATGAGATCTGGGGG + Intronic
1003251511 6:4432686-4432708 ATGACCAGTATGGAAAATGGGGG - Intergenic
1003264997 6:4557937-4557959 GAGGCCAGGATGGACACTGGAGG + Intergenic
1003622080 6:7709226-7709248 CTGGCAAGGATGAAGACTGGAGG - Intergenic
1003959605 6:11196772-11196794 GGGACCAGGATGCAAAATGCTGG + Intronic
1005671449 6:28110045-28110067 GTGTCCAGGGAGAAACCTGGTGG + Intergenic
1014753223 6:125275931-125275953 GTGCCATGGATGAACACTGGAGG - Exonic
1015215193 6:130741963-130741985 CTCACCAGGATGAGAACTTGAGG + Intergenic
1015470411 6:133599190-133599212 GTGGCCAGAATAAAAACAGGTGG - Intergenic
1015939980 6:138439703-138439725 ATGACCTGGATTAGAACTGGAGG - Intronic
1016639817 6:146335838-146335860 GTGTCCAGGAAGAGACCTGGTGG + Intronic
1017215601 6:151902279-151902301 GAGAGCAAGATCAAAACTGGTGG - Intronic
1019317600 7:396744-396766 GTGAGCAGGATGCATACTGCAGG - Intergenic
1019378787 7:710972-710994 GTAACTAGGCTGAAAACTGTCGG + Intronic
1020880369 7:13754717-13754739 TGGATCAGAATGAAAACTGGTGG + Intergenic
1023624893 7:42106196-42106218 GTGAGCAGCATGGAAACTGCGGG - Intronic
1024151674 7:46578067-46578089 GTGACCAAGATGAAAACTGAAGG + Intergenic
1024272100 7:47650410-47650432 GTCACCTGGATGAAAAATGAGGG - Intergenic
1025144041 7:56489671-56489693 CTGACCAGGATGGAAACTCAGGG - Intergenic
1026664810 7:72332998-72333020 GTGACCAGAATGATAGATGGTGG - Intronic
1027266846 7:76499201-76499223 GTGACCTGGAGGGAAACTGCTGG - Intronic
1027318663 7:76999061-76999083 GTGACCTGGAGGGAAACTGCTGG - Intergenic
1027519252 7:79182898-79182920 GCAACATGGATGAAAACTGGAGG + Intronic
1029116377 7:98239660-98239682 GTGACCAGGATCCAATGTGGGGG + Intronic
1032802613 7:135328851-135328873 ATCACCAGGATGAAGAATGGGGG + Intergenic
1035565438 8:637709-637731 GGGAGCAGGAGGAAAGCTGGGGG + Intronic
1035851521 8:2923773-2923795 GTGACCAAAATGAATACAGGGGG - Intergenic
1036760862 8:11507746-11507768 GTGACCTGGATTAGGACTGGAGG + Intronic
1038039077 8:23709112-23709134 TTGACAAGGATGAAAATTGAAGG - Intergenic
1038298913 8:26323932-26323954 GTGAAAACAATGAAAACTGGAGG - Intronic
1039242024 8:35567599-35567621 GTGACCAGGCTGAAAATCTGAGG - Intronic
1043499116 8:80835935-80835957 TTAACCAGGATGGTAACTGGAGG - Intronic
1044028184 8:87199881-87199903 ATGACCAAGATGAAAACTAGTGG + Intronic
1044241219 8:89891063-89891085 TTCACCAGGAGGCAAACTGGGGG - Intergenic
1044689651 8:94864225-94864247 GTGACAAGGACAAAAATTGGTGG - Intronic
1051488606 9:17635904-17635926 GTGACCAGGCTGATAAATGGAGG - Intronic
1052462059 9:28777385-28777407 GTGCCTAGAATGTAAACTGGTGG - Intergenic
1052681493 9:31698913-31698935 GTGACTAGTTTTAAAACTGGAGG - Intergenic
1054910410 9:70450116-70450138 AAGACCAGTAGGAAAACTGGAGG + Intergenic
1058777699 9:108301139-108301161 GTGACCAGGAGGAAATCATGAGG + Intergenic
1059355983 9:113699798-113699820 TTGACAAAGATGAAATCTGGGGG - Intergenic
1060459929 9:123841842-123841864 GTGACCAGGATGAAGGCAGTAGG + Intronic
1061595986 9:131629335-131629357 GTGACCAGGAAGAACACAGTGGG + Intronic
1061778835 9:132984208-132984230 GTGAGCAGGAGGAGGACTGGGGG - Intronic
1186315023 X:8359917-8359939 ATGACCAGGATGAGGACTTGAGG - Intergenic
1186446195 X:9631236-9631258 GGTACCAGGCTGAATACTGGGGG - Intronic
1186663087 X:11689026-11689048 CTGAGTAGGCTGAAAACTGGAGG - Intergenic
1191202144 X:57795056-57795078 GTGATGAGGAAGAAAACTGTAGG - Intergenic
1195368629 X:104151145-104151167 GTGATAAGGAGGAAACCTGGGGG - Intronic
1200037396 X:153340926-153340948 CTCAGCAGGAAGAAAACTGGAGG - Intronic