ID: 1089768214

View in Genome Browser
Species Human (GRCh38)
Location 11:120783974-120783996
Sequence CCAGCCTCAGGGAGGCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 603
Summary {0: 1, 1: 0, 2: 7, 3: 92, 4: 503}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089768214 Original CRISPR CCAGCCTCAGGGAGGCTGAG GGG Intronic
900080282 1:851569-851591 GCAGACTCTGGGAGGCTGAAGGG + Intergenic
900155419 1:1201736-1201758 TGAGCCCCGGGGAGGCTGAGCGG - Intergenic
900431644 1:2605667-2605689 CCTGCCTCAGCCAGGCTGCGGGG - Intronic
900589376 1:3453018-3453040 CCAGACCCAGGGTGGCTGAACGG + Intergenic
901681906 1:10917941-10917963 CGAGCCTCAGAGAGGTTCAGTGG + Intergenic
901769527 1:11523179-11523201 ACAGCCTCAGGATGGCTGTGAGG + Intronic
901771406 1:11532077-11532099 CCACCCTAAGGGAGGCTGCCAGG - Intronic
902244882 1:15114301-15114323 CCCTGCTCAGGGAGGTTGAGGGG - Intronic
902374622 1:16024527-16024549 TGAGGCTCAGAGAGGCTGAGTGG + Intronic
902379566 1:16046299-16046321 TGAGGCTCAGAGAGGCTGAGTGG + Intronic
902441700 1:16434397-16434419 CCAGCCACTCAGAGGCTGAGGGG - Intronic
902664452 1:17927738-17927760 CCAGCCTGAGGGCAGGTGAGTGG + Intergenic
902754657 1:18541114-18541136 CCAGAGGCAGGGAGGCTGGGGGG - Intergenic
902859236 1:19232928-19232950 ACAGCCTCAGGCAAGGTGAGTGG - Exonic
902928941 1:19716863-19716885 CCAGCCTCAAGGAAGCTGAGCGG + Intronic
903321447 1:22545842-22545864 ACAGCCCCAGGAAGGGTGAGAGG - Intergenic
903542640 1:24105566-24105588 CCAGCCCCAGGCTGGCTGCGGGG + Intronic
904330595 1:29755720-29755742 TCAGCCTGAGGGAGGCTGAAGGG - Intergenic
904349579 1:29896185-29896207 GGAGCCTCAGGGAGACAGAGCGG + Intergenic
904353641 1:29924685-29924707 CCCACCTCTAGGAGGCTGAGAGG - Intergenic
904416077 1:30361875-30361897 TCAGCCTGAGGGAGGCTGAAGGG + Intergenic
904420226 1:30386337-30386359 CCTGGCTCTGGGAGGCTCAGGGG + Intergenic
904432750 1:30475662-30475684 TGAGGCTCGGGGAGGCTGAGTGG + Intergenic
905166824 1:36087930-36087952 CCAGCCTCATGGGGGCTGGGGGG + Intronic
905917338 1:41694953-41694975 CCAGAGTCTGGGAGGTTGAGGGG + Intronic
906193520 1:43914424-43914446 CCCGCCTCTGGAAGTCTGAGGGG - Intronic
906658875 1:47568452-47568474 CCAACCCAAGGCAGGCTGAGGGG - Intergenic
907250269 1:53133471-53133493 TCAGCAGCAGGGAGGCTGGGAGG + Intronic
907444655 1:54499862-54499884 CCAACCTCAGGGGGCCTGAGAGG + Intergenic
909891770 1:81016145-81016167 CCAGCTTCATGGAGGCTGGTAGG - Intergenic
910247323 1:85153560-85153582 CCAGCTTCCAGGAGGCAGAGAGG - Intergenic
911737656 1:101355189-101355211 TCAGCTCCAAGGAGGCTGAGAGG - Intergenic
912557257 1:110525177-110525199 CCTGCCTCAGGCTGGATGAGGGG - Intergenic
913314782 1:117540662-117540684 TGAGCCTCAGAGAGGCTAAGGGG + Intergenic
913513698 1:119584736-119584758 CCAGCTACTGGGAGGCTGAGGGG + Intergenic
913517327 1:119615654-119615676 CCAGCTACTGGGAGGCTGAGGGG + Intergenic
914682379 1:149947873-149947895 CAAGCCACAGGGAGGTAGAGTGG + Intronic
914958447 1:152185422-152185444 TGAGCTTCAGGGAGACTGAGGGG + Intergenic
915136271 1:153733849-153733871 CAACACTCTGGGAGGCTGAGGGG - Intronic
915282137 1:154829831-154829853 CCAGCCTCGGGAAGGGTGTGGGG - Intronic
915470893 1:156125209-156125231 ACAGGCTCAAGTAGGCTGAGGGG + Intronic
915474910 1:156147588-156147610 GCAGCCTCAGGGATCTTGAGGGG + Intronic
915513615 1:156400564-156400586 CCAACCTCAGAGAGGGGGAGAGG - Intergenic
915524491 1:156467606-156467628 TCTTCATCAGGGAGGCTGAGAGG + Exonic
915581025 1:156813612-156813634 CCAGCCACACGGAGTCAGAGGGG - Intronic
915581189 1:156814282-156814304 TCACCCACAGGGAGGCAGAGAGG - Exonic
915638691 1:157204461-157204483 CCAGCATCAAGGAGCCTGGGAGG - Intergenic
916762675 1:167831440-167831462 CAACGCTTAGGGAGGCTGAGGGG - Intronic
917497730 1:175556623-175556645 GGAGAGTCAGGGAGGCTGAGAGG - Intronic
917722457 1:177798664-177798686 GGAGCCTCAGGGCAGCTGAGAGG - Intergenic
919762135 1:201104808-201104830 CCAGCCTAGGCCAGGCTGAGGGG - Intronic
919779674 1:201213811-201213833 CCAGCCTGTGAGAGGCTCAGAGG + Intronic
921179995 1:212624698-212624720 CCGGCCTCTGGGAGGCTCTGAGG + Exonic
921182679 1:212644197-212644219 CCCGCCTCAGCGATGCTGGGAGG - Intergenic
921319794 1:213927636-213927658 ACAGGCTCAGGGAGGCCAAGAGG - Intergenic
921668428 1:217900456-217900478 CCAGACTTTGGGAGGCTGAGGGG + Intergenic
922641414 1:227235638-227235660 CAGCCCTCAAGGAGGCTGAGAGG - Intronic
922766811 1:228160313-228160335 CAGGCCTAAGGGAGGCTGGGGGG - Intergenic
923276975 1:232405015-232405037 GCAGCCAGAGGGAGGCAGAGTGG - Intronic
923345439 1:233047037-233047059 CTGGCCTCTGGGAGACTGAGTGG + Intronic
923402122 1:233625476-233625498 CTAGCCTGGGGGAGGATGAGGGG + Intronic
924415022 1:243849940-243849962 CCCGCCTGAGGGAGGCAGGGAGG + Intronic
1063062186 10:2567621-2567643 ACAGCCTGTGGGTGGCTGAGTGG + Intergenic
1064018926 10:11793960-11793982 CCAGGATCAGGGAGGCTGCAGGG + Intergenic
1064442846 10:15370057-15370079 CAAGCCTCAGGGTGGGTGTGGGG + Intronic
1064489045 10:15830705-15830727 CCACCTTCAGGGAGAATGAGGGG + Intronic
1066048916 10:31617908-31617930 CAAGCCGCAGAGAGGCTGAGTGG - Intergenic
1066646706 10:37617865-37617887 CCAGCCTCCTGGAGCATGAGAGG - Intergenic
1067001432 10:42617707-42617729 CCAGCGTTAGGAAGGCAGAGAGG - Intronic
1067115669 10:43433834-43433856 CCAGCTACCGGGAGGCTGAGAGG + Intergenic
1069431638 10:68340830-68340852 CCAGCCTCAGAGAGACAGAGTGG - Intronic
1069661132 10:70124124-70124146 TCAGAGTCAGGGAGGCTGGGAGG + Intronic
1069723239 10:70562563-70562585 CCAGCCTCTGGGAGCCGGAAAGG - Intronic
1069797689 10:71063689-71063711 CCGGCCTCCAGGAGGCAGAGAGG + Intergenic
1069837697 10:71319532-71319554 CCAGTCTCAGGGAGGAGGAGGGG - Intronic
1070314395 10:75296245-75296267 CCAGCCCCTGGGAGGATGGGTGG + Intergenic
1070793284 10:79202547-79202569 CCAGCACCAGAGGGGCTGAGTGG - Intronic
1071600517 10:86956619-86956641 TGAGGCTCAGAGAGGCTGAGGGG - Intronic
1071603334 10:86969544-86969566 CCAGCCCCGGGGGGGCTGACAGG - Intronic
1072530480 10:96313967-96313989 GCAGCCACAGGGAGGCTGTCAGG - Intronic
1073177343 10:101564620-101564642 CAATCCCCAGGGAGCCTGAGAGG - Intergenic
1073328407 10:102656001-102656023 CCAGCCTGGGGGAGGCTCAGGGG + Intronic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1074295517 10:112183843-112183865 CGAGCCTCAGGGAGCGTGAGCGG + Intronic
1074403790 10:113163781-113163803 TCAGCCTCTGGGAGGCAGGGAGG + Intronic
1075348094 10:121699147-121699169 CCTGCCTCCGTCAGGCTGAGAGG + Intergenic
1076323075 10:129598158-129598180 CCAGCCTCAGGGTGGGTGCATGG + Intronic
1076486250 10:130820393-130820415 CCAGTGTCAGTGAGGGTGAGAGG + Intergenic
1076603168 10:131672187-131672209 CCTGCCTCAAGGAGGCCGAATGG + Intergenic
1076687380 10:132204216-132204238 CCAGCCTCAGGGGAGGTGGGAGG + Intronic
1076788947 10:132766855-132766877 GCGGCCTCAGGGAGCCTGGGTGG + Intronic
1076831098 10:132994689-132994711 GCTGCCTCAGGGAAGCTGAGTGG + Intergenic
1076831450 10:132996433-132996455 CCAGCATCAGGCATGCTGCGGGG - Intergenic
1077137796 11:1009962-1009984 CCAGCTGCGGGGAGGCTGGGAGG - Intronic
1077143145 11:1033691-1033713 CCAGCCTCTGGGAGTCAGGGTGG - Intronic
1077169658 11:1160563-1160585 CCAGATGCAGGGTGGCTGAGGGG - Intronic
1077183081 11:1225007-1225029 CCAACCCCATGGAGGCTGGGAGG - Intronic
1077251528 11:1562979-1563001 CCAGCCTGAGGGCGACTGTGGGG - Intronic
1077474788 11:2781249-2781271 CGAGGCTCAGAGAGGCTGAGTGG + Intronic
1077562636 11:3273555-3273577 CTCGCCTCAGGGAGGCTGGCAGG - Intergenic
1077568529 11:3319374-3319396 CTCGCCTCAGGGAGGCTGGCAGG - Intergenic
1078355377 11:10628495-10628517 CCAGGGTCAGGAAGGCTGGGTGG - Intronic
1079223834 11:18588444-18588466 GCGGCCCCAGGGAGGCTGAGGGG - Intronic
1080327436 11:31093684-31093706 CCAGGCTCAGGAAAGCTGAGGGG + Intronic
1080428309 11:32175890-32175912 CCAGCCCCAGAGAGGCCCAGAGG + Intergenic
1081456443 11:43227934-43227956 CCAGCCTTATGGAGGATGTGGGG + Intergenic
1081716261 11:45252543-45252565 TCAGCGTCAGGGTGGCTGTGGGG + Exonic
1082167580 11:48965889-48965911 CCAGGCTCAGGGAGTGTGGGAGG - Intergenic
1082235973 11:49820761-49820783 CCAGGCTCAGGGAGTGTGGGAGG + Intergenic
1082239434 11:49855317-49855339 CCAGGCTCAGGGAGTGTGGGAGG + Intergenic
1082657209 11:55869844-55869866 CCAGGCTCAGGGAGTGTGGGAGG - Intergenic
1082952350 11:58830929-58830951 CGAGCCTGTGGGAGGCAGAGGGG - Intergenic
1083571798 11:63765156-63765178 CGGCCCTCCGGGAGGCTGAGAGG + Exonic
1083783655 11:64931631-64931653 CCCGCCAGAGGGAGGCTGGGAGG + Intronic
1083820646 11:65169566-65169588 ACGGCCTCAGGGAGCCTGGGAGG + Intergenic
1083899471 11:65636648-65636670 CCAGCCTCAGGGAGCCCCAAAGG + Exonic
1084005834 11:66323047-66323069 CCAGCCTCTGTGGGGGTGAGGGG + Intergenic
1084087722 11:66862228-66862250 CCCCCAACAGGGAGGCTGAGAGG + Intronic
1084172441 11:67407002-67407024 CCTTCCTCAGTGAGGGTGAGTGG + Exonic
1084383594 11:68828674-68828696 ACAGCCTCAGGAAGGCTGAAGGG - Intronic
1084394376 11:68899125-68899147 TCAGCCTCAGGTAGGTGGAGGGG + Intronic
1084507871 11:69580783-69580805 GGAACCTCAGGGAGGCTGACTGG - Intergenic
1084772088 11:71349822-71349844 CCAGCCCGAGAGAGGCCGAGGGG + Intergenic
1085323782 11:75591478-75591500 CCAGCCTCACGGAGGAGGTGGGG - Intronic
1086159911 11:83710409-83710431 CCAGCATTTGGGAGGCTGAGCGG - Intronic
1087605844 11:100376937-100376959 CAAGCCTCAGAGAGGTTGGGGGG + Intergenic
1087718509 11:101636258-101636280 CTAGTACCAGGGAGGCTGAGTGG + Intronic
1089048788 11:115527844-115527866 GCAGCCTGTGGGAGGCAGAGGGG - Intergenic
1089063503 11:115644992-115645014 CCAGCCTCAGGGCTCCTGAAGGG + Intergenic
1089093055 11:115894434-115894456 CCAGCCACATGGAGCCAGAGTGG + Intergenic
1089128091 11:116191435-116191457 CCAGCCCCAGGGAAGCCCAGTGG + Intergenic
1089537245 11:119168496-119168518 CGCGCCTCAGGGAGGCCCAGGGG + Intronic
1089746784 11:120623254-120623276 CCAGCTACTTGGAGGCTGAGCGG - Intronic
1089768214 11:120783974-120783996 CCAGCCTCAGGGAGGCTGAGGGG + Intronic
1089770233 11:120797229-120797251 CGAGCCACAGTGAGGCTGGGAGG - Intronic
1090069520 11:123531543-123531565 CAAGCCTCAGGAAGGCCGGGAGG - Intronic
1090438589 11:126708033-126708055 CCTGCTTCAGGGATGCGGAGGGG - Intronic
1090604177 11:128404424-128404446 CCCGCCTTAGGGGAGCTGAGAGG + Intergenic
1090991099 11:131817669-131817691 CCATCCTCATGGAAGCTCAGAGG - Intronic
1091225109 11:133952311-133952333 ACACCCTCAGGGAGACAGAGAGG + Intronic
1091587175 12:1822916-1822938 CCAACCCCAGGAAGGCTGAGAGG - Intronic
1092025121 12:5233350-5233372 TCAGCCTCATGGAAGCTGTGCGG + Intergenic
1092092401 12:5813661-5813683 CAGGCCTCAGAGAGGTTGAGAGG - Intronic
1092194082 12:6538660-6538682 GCAGCCCCAGGGAGGCTGACAGG + Intronic
1092428601 12:8392168-8392190 CCACCCTCAGGGCTGCTGTGGGG - Intergenic
1092429681 12:8398312-8398334 CCACCCTCAGGGCTGCTGTGGGG - Intergenic
1092782090 12:11996648-11996670 CCAACCTCAGGGAGGGGGAGTGG - Intergenic
1095360067 12:41326591-41326613 CCAGCCTCAGCAAGGGCGAGAGG + Intronic
1095464435 12:42475842-42475864 CCAGCATTTGGGAGGCTGGGGGG + Intronic
1095954636 12:47799042-47799064 TGAGCCTGAGGGAGGCTGAGGGG - Intronic
1096669303 12:53188991-53189013 TCACCTTCAGGGAGGATGAGTGG + Exonic
1097175258 12:57138893-57138915 CAAGGGTCAGGGAGGCTGAGAGG - Intronic
1097961129 12:65532869-65532891 CCAGCCTCACGGACTCTGATCGG + Intergenic
1098164303 12:67677826-67677848 CCTGCCTCAGGGATGTTGTGAGG + Intergenic
1098881114 12:75918676-75918698 CAAGCCTCGGGGAGGGTAAGGGG - Intergenic
1100078828 12:90823857-90823879 CCAGCCGTTGGGAGGCTAAGGGG - Intergenic
1100368407 12:93942892-93942914 CTAGCCTCAGGGAGAATGAGAGG - Intergenic
1100386470 12:94109017-94109039 GCAGCCTCAGGGAGGATGCCAGG + Intergenic
1101781772 12:107844237-107844259 CCAGCATCAGAGACGCTGGGTGG + Intergenic
1102020347 12:109677936-109677958 TGAGGCTCAGGGAAGCTGAGTGG + Intergenic
1102030700 12:109738536-109738558 CCACCCCCAGGAAGGCTGCGAGG + Intronic
1102501561 12:113356662-113356684 CCAGCTACTGGGAGGCCGAGGGG - Intronic
1102559973 12:113754923-113754945 CCATCTCCTGGGAGGCTGAGTGG - Intergenic
1102869964 12:116406476-116406498 CAACACTCTGGGAGGCTGAGTGG - Intergenic
1103102357 12:118189727-118189749 ACAGGCTCAGGGAGGGCGAGAGG + Intronic
1103455131 12:121059556-121059578 CCAGCCCCAGGGAGACTGGAAGG - Intergenic
1103564355 12:121808077-121808099 CCAGTCCTAGGGAGGCTGTGTGG - Intronic
1103832309 12:123789630-123789652 AGTGCTTCAGGGAGGCTGAGGGG - Intronic
1103960960 12:124609178-124609200 CAAGCCTCAGGGCTGCCGAGGGG - Intergenic
1104437131 12:128765404-128765426 TAAGCCTCTGGGAGTCTGAGTGG - Intergenic
1104518172 12:129447106-129447128 CCAGTGTCAGGGAAGATGAGAGG - Intronic
1104792759 12:131494096-131494118 CCAGGCTCAGGACGGCAGAGGGG - Intergenic
1105069869 12:133227824-133227846 CCAACCCCAGCAAGGCTGAGAGG - Exonic
1105356695 13:19665450-19665472 ACAGCCACGGGGAGGGTGAGAGG - Intronic
1106982335 13:35302217-35302239 CCAGCCCCCTGGAGCCTGAGAGG - Intronic
1107520124 13:41171970-41171992 CCCGTCTCAGGGAGGGGGAGAGG + Intergenic
1108615622 13:52129088-52129110 CCGGCCGCAGGGAGGCGCAGCGG - Intergenic
1110817321 13:79876396-79876418 GCTTCCTCAGGGAGGCTCAGAGG - Intergenic
1110863299 13:80367456-80367478 CTTGCCTCAGGGAGAATGAGGGG + Intergenic
1112046368 13:95602066-95602088 CCAGCCTCAGGAACACTCAGCGG + Intronic
1113416221 13:110130748-110130770 CCAGCCTCAGGGCTGCAGAGAGG + Intergenic
1113462400 13:110491357-110491379 CCTGCCTGAGGAAGGCTGTGTGG - Intronic
1113572759 13:111370447-111370469 CCAGCCACAGGGCTGCTCAGAGG - Intergenic
1113869402 13:113548991-113549013 CCAGGGTCAGGGAAGCTGTGGGG + Intronic
1114415149 14:22537916-22537938 CCAGCCTCAGGGAAGATCAGGGG - Intergenic
1114416217 14:22546297-22546319 TCAGCCCCTGGGATGCTGAGTGG - Intergenic
1114887236 14:26868989-26869011 CAAGCCTCAGGAAGGATGAAAGG - Intergenic
1117334382 14:54744396-54744418 CCAGCCACAGGGAGGCTGTGCGG - Intronic
1117628521 14:57665261-57665283 CAGGCCTCAGGGAGGATGGGCGG - Intronic
1118827236 14:69395063-69395085 TCATCCTCTGGGAGGCTGAGAGG + Intronic
1118983264 14:70732866-70732888 GCAGCGTCAGGGAGGCAGAGGGG + Exonic
1119217521 14:72880519-72880541 GCAGCCAAAGGTAGGCTGAGAGG + Intronic
1119406557 14:74402808-74402830 CCAGCATCAGGGCAGCTGCGGGG + Intergenic
1119752339 14:77088508-77088530 CCAGCCCCAGGGAGTCTGGATGG - Intergenic
1119764747 14:77181443-77181465 CATGCCTCAGGGAGGGCGAGGGG + Intronic
1119895526 14:78216530-78216552 CCAGCCACAGGGAAGCTCAGGGG - Intergenic
1121014418 14:90539584-90539606 CCTGCCTCAGTGAGCCAGAGAGG + Exonic
1121246124 14:92462056-92462078 ACAGGCTCAGAGAGGCTGCGGGG + Intronic
1121642982 14:95498813-95498835 CCAGCCTGGGGGGGACTGAGAGG - Intergenic
1121675152 14:95746482-95746504 CCTGCCTAAGGGAGGATGAGAGG - Intergenic
1121738344 14:96234397-96234419 GGAGCCTGAGGGAGGGTGAGAGG - Intronic
1122027185 14:98886585-98886607 CCAGCCTCAGGGAGCCTGTCTGG - Intergenic
1122200930 14:100122113-100122135 CCCGCCTCAGCCAGGATGAGTGG + Intronic
1122321710 14:100859497-100859519 CCAGCCTCAGGGAGGGCATGGGG - Intergenic
1122373093 14:101240081-101240103 CAAGCGTCAGGGAGGCCGAGTGG - Intergenic
1123026329 14:105425970-105425992 CCCGCCCCAGGGAGGCTGCCGGG - Intronic
1123057101 14:105575749-105575771 GAAGCCCCAAGGAGGCTGAGCGG + Intergenic
1123081145 14:105696142-105696164 GAAGCCCCAAGGAGGCTGAGCGG - Intergenic
1123995690 15:25716409-25716431 CCAGCCTCAGGTAGGCAGGTGGG - Intronic
1124007460 15:25806174-25806196 GCTGCCTCAGGGTGGCAGAGAGG - Intronic
1124140209 15:27070881-27070903 CCAGCCACAGGGAGGCTCTGAGG - Intronic
1124372661 15:29112201-29112223 CCAGGCACATGGAGGCTGAGGGG - Intronic
1124427242 15:29571872-29571894 CCAGCGTTAGGGAGTCTGAAGGG + Intergenic
1124613143 15:31222936-31222958 GCTGCCTCAGGGTGGCAGAGAGG + Intergenic
1126783716 15:52159817-52159839 CCAGGGTCAGGGAGCCAGAGGGG + Intronic
1127878659 15:63135603-63135625 CCAGCTACTTGGAGGCTGAGCGG + Intronic
1128229606 15:66025370-66025392 CCTGCCTCAGGCTGACTGAGGGG - Intronic
1128567343 15:68710232-68710254 ACTGCATCTGGGAGGCTGAGGGG - Intronic
1128784378 15:70384029-70384051 CCAGCTTCTGGGAGGAAGAGAGG - Intergenic
1128799799 15:70490197-70490219 CAAGCCTCAGGGACGGTGACAGG - Intergenic
1129694537 15:77733175-77733197 CCATCCTGTGGGTGGCTGAGTGG - Intronic
1129821117 15:78602644-78602666 CAAGCCTCAGGGACCCTGGGTGG - Intronic
1131373284 15:91902479-91902501 GCAGCCTCAGGGTAGCTGAGGGG + Intronic
1132216030 15:100062273-100062295 ACAGCCTCAAGGAGGCAGGGTGG + Intronic
1132483532 16:178162-178184 CCAGCCTCAGGGGAGCTGAGTGG - Intergenic
1132614453 16:833261-833283 CCAGGCTGCGTGAGGCTGAGTGG + Intergenic
1132795510 16:1719584-1719606 CAATACTCTGGGAGGCTGAGGGG + Intronic
1132796511 16:1726424-1726446 CCACACTTTGGGAGGCTGAGGGG + Intronic
1132827892 16:1914079-1914101 GCAGCCACAGGGAGACTGGGAGG + Intronic
1133008644 16:2898133-2898155 TCAGCCCCAGGGAGGCTGTGGGG - Intronic
1133278489 16:4652025-4652047 CCAGCCGCAGGGAGTCTTTGCGG - Exonic
1133282735 16:4676362-4676384 TGAGCCTCAGGGTGGCTGTGTGG + Intronic
1133287428 16:4697136-4697158 CCAGGCTCAGGAGGGCTGGGTGG + Intronic
1134402175 16:13920324-13920346 CCAGCACCAGGCAGGCTGGGTGG - Exonic
1135134261 16:19876096-19876118 CCAGCCCCAGGGTGGCTGGGAGG + Intronic
1135547351 16:23375137-23375159 CCAGCCTCCTGGAGGCTGCCTGG + Intronic
1135586776 16:23677928-23677950 CCAGCATTTGGGAGGCCGAGGGG + Intronic
1136092245 16:27928822-27928844 CCAGCCAGAGGAAGGCTAAGGGG + Intronic
1136228561 16:28874093-28874115 CCAGCCCGAGGCAGGGTGAGGGG + Exonic
1137683893 16:50372839-50372861 CCAGCCTCATGCAGCCTGTGTGG + Intergenic
1138431739 16:56973254-56973276 CCAGCTTCAGGGAGATTGGGAGG - Intronic
1138827073 16:60333580-60333602 CAGGTCTCAGGGAGGCAGAGTGG - Intergenic
1139292150 16:65868762-65868784 ACAGCCCCAAGGAGGCTGATAGG - Intergenic
1139377317 16:66508309-66508331 CTAGCCTTAGGAAAGCTGAGGGG + Exonic
1139429526 16:66903764-66903786 CCAGCCTCTGGGGGCCTGGGCGG - Intergenic
1139431313 16:66912402-66912424 ACATCCTCAGGGAGGCTTATAGG + Exonic
1139513673 16:67441129-67441151 CCAGGGTCAGGGAGGCTGGTGGG + Intronic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1139698404 16:68691940-68691962 CCATCCTCAGGGAGGGGGTGGGG - Intronic
1140475836 16:75238876-75238898 CCTGCCTTTGGGAGGCTGGGAGG - Intronic
1141703496 16:85652865-85652887 CGTGGCTCAGGGAGGCAGAGCGG + Intronic
1142047000 16:87931942-87931964 CCAGCCTCAGAGAGGCTCTTTGG - Intronic
1142408415 16:89903883-89903905 CCAGCCCCAAGGAGGCTGCCAGG - Intronic
1142559647 17:802614-802636 CCAGCCCCAGGGAGGCTGCGCGG - Intronic
1142611827 17:1112703-1112725 ACAGCATCATGGAGGGTGAGGGG + Intronic
1142677113 17:1520725-1520747 GCAGCCTCGGGGAGGCTGGAGGG - Intronic
1143080240 17:4376227-4376249 CAACACTCTGGGAGGCTGAGAGG - Intergenic
1143389997 17:6554763-6554785 GCAGCCTCAAGGTGGCTTAGAGG - Intronic
1143634564 17:8156914-8156936 CCAGCTTCAGGGAGCCTCGGTGG - Intronic
1143871370 17:9959316-9959338 CCACCCTCAGGGAACCTGAATGG - Intronic
1144649459 17:16998114-16998136 CCAGCCTCTGAGAGTCAGAGGGG - Intergenic
1144944176 17:18961402-18961424 CCAGGCACAGGGAGGCTCGGAGG - Intronic
1145413707 17:22695281-22695303 CAAGCCGGAGGGAGGCGGAGGGG - Intergenic
1145909483 17:28534277-28534299 CCAGGCTCAGGAAGCCAGAGCGG - Intronic
1145958769 17:28873250-28873272 CCAGCCTCAGGAAGAGAGAGTGG - Intergenic
1146454389 17:32997702-32997724 CCATCCTCAGGGAGGCCTGGAGG + Exonic
1146936052 17:36813312-36813334 TGAGGCTTAGGGAGGCTGAGAGG + Intergenic
1147185045 17:38708645-38708667 CCAGACTTTGGGAGGCTGAGGGG + Intronic
1147384085 17:40071604-40071626 CCTGCCCCAAGGAGGCCGAGGGG - Intronic
1147931982 17:43987452-43987474 TCAGTAGCAGGGAGGCTGAGAGG - Intronic
1148586482 17:48784807-48784829 CAAGGCCCAGGGAGGCTCAGTGG + Intronic
1148602461 17:48904802-48904824 CCAGCACTTGGGAGGCTGAGTGG + Intergenic
1148664234 17:49362345-49362367 CCAGCGGCCGGGATGCTGAGGGG - Intronic
1149398740 17:56271853-56271875 ACAGCCTCAGGGAGGGTAAACGG - Intronic
1149681268 17:58508915-58508937 ACAGCCACAGGAAGGCTGTGAGG + Intronic
1150132266 17:62675554-62675576 CCAGCCCCAGCGTGGCTGATTGG - Intronic
1150285519 17:63951688-63951710 TCAGCCTCGGGGAGGCTGACGGG - Exonic
1150322830 17:64230696-64230718 CCAGGCTCAGGGAGGTGAAGTGG - Intronic
1150323490 17:64236448-64236470 CCAGCTACCTGGAGGCTGAGTGG + Intronic
1150338129 17:64344711-64344733 CCACCCACAGGAAGGCAGAGAGG + Intronic
1150633532 17:66897236-66897258 CCATTCCCAGGGAGGCTGGGAGG + Intergenic
1151193542 17:72415769-72415791 CCTCCCTCTGGGAGGGTGAGAGG + Intergenic
1151369544 17:73639298-73639320 CCAGGCCCAGGGAGTCTGAGGGG + Intronic
1151933639 17:77248252-77248274 CCAGCACCAGGGAGCATGAGTGG - Intergenic
1152057555 17:78042379-78042401 ACAGGCTCAGAGAGGCTAAGTGG - Intronic
1152088301 17:78233327-78233349 CCTGCCTGAGGGACTCTGAGGGG + Intronic
1152239096 17:79152296-79152318 CCATCCTCAGTGAAGCTGAGAGG + Intronic
1152262493 17:79274659-79274681 CCAGCCTCTTGGGGGATGAGGGG - Intronic
1152330048 17:79667528-79667550 ACCGACCCAGGGAGGCTGAGCGG - Intergenic
1152397790 17:80045200-80045222 GCAGCCACATGGAGGCTGAAGGG - Intronic
1152901196 17:82941994-82942016 CCTGCCGGAAGGAGGCTGAGAGG - Intronic
1153599425 18:6764587-6764609 GCTGCCTCAGGGAGGCTGGCAGG - Intronic
1153813809 18:8775895-8775917 CCAGCCTCCTAGAGGCTCAGGGG + Intronic
1153846728 18:9056882-9056904 CAAGACTCAGGGAGTCTAAGTGG - Intergenic
1153926588 18:9840006-9840028 CCAGCTCCAGTCAGGCTGAGTGG - Intronic
1155676349 18:28434002-28434024 ACAGCCACAGGGAGCCTAAGTGG - Intergenic
1156140094 18:34098370-34098392 CCAGCCACATGGAGAGTGAGAGG + Intronic
1156852552 18:41745311-41745333 CCAGCCTCAATAAGGCTGGGTGG + Intergenic
1158478865 18:57803338-57803360 CCAGCCCCAGCGAGGCTCGGCGG - Intergenic
1159358326 18:67365967-67365989 CCAGCCTCAGGGGGCTTGATTGG + Intergenic
1160514485 18:79470896-79470918 CCCGCCCCAGGGAGGGTGAAGGG - Intronic
1160528854 18:79552176-79552198 CCAGGCCCAGGGAGGCTGGAGGG - Intergenic
1160865849 19:1255639-1255661 CCTGCAGCAGGGAGGCTGAGGGG - Exonic
1161087468 19:2341625-2341647 GCTGCCTCAGGAAGGCTGGGAGG - Intronic
1161121435 19:2529031-2529053 CCAGCCTCAGGGCAGGTCAGGGG - Intronic
1161477436 19:4494321-4494343 CCGACCGCGGGGAGGCTGAGCGG + Exonic
1161498099 19:4598279-4598301 CAGGGCTCAAGGAGGCTGAGTGG + Intergenic
1161612124 19:5248945-5248967 CCAGCCCCTGGGAGGCTGAAAGG - Intronic
1161635593 19:5386923-5386945 CCAGCATTTGGGAGGCTGAGCGG - Intergenic
1161795819 19:6386135-6386157 CCACACTTAGGGAGGCTGAGGGG + Intronic
1161851243 19:6739202-6739224 CCGGCCACAGGGCGGATGAGAGG - Intronic
1162086964 19:8254916-8254938 TAAGGCTCAGGGAGGCTGGGAGG - Intronic
1162147707 19:8623057-8623079 CCAGCCTCTGGGTGGCAGAGTGG - Intergenic
1162149313 19:8633635-8633657 CCATCCTCAGGGCGGCTGGAGGG - Intergenic
1162311415 19:9909672-9909694 CCAACGTCGGGGAGGCTGAGGGG - Intronic
1162401383 19:10448823-10448845 CTGGACCCAGGGAGGCTGAGAGG - Intronic
1162431588 19:10631990-10632012 CCACCCTCAGCCAGGCTTAGAGG - Intronic
1162635132 19:11962166-11962188 CCAGCACTTGGGAGGCTGAGGGG + Intronic
1163331390 19:16640599-16640621 GGAGTCTCAGGGAGCCTGAGAGG + Intronic
1163692183 19:18743962-18743984 TCAGCCTGAGTGGGGCTGAGGGG + Intronic
1164396223 19:27866126-27866148 CCAACCTCAGGCATTCTGAGTGG + Intergenic
1164940600 19:32250252-32250274 CCAGCCTCCTGGAGGCCCAGTGG - Intergenic
1165159708 19:33808764-33808786 CCAGGCCAAGGGAGGCTGGGTGG + Intronic
1165843189 19:38801814-38801836 CCACCCTCTGGAAGGCCGAGAGG + Exonic
1166102973 19:40582297-40582319 CCTGCCTCATGGAGGAGGAGAGG - Intronic
1166274565 19:41743766-41743788 CCAGATTAAGGGAGACTGAGAGG - Intronic
1166565240 19:43760984-43761006 CCAGCCTTTGGGAGGCTGATGGG - Intergenic
1166939866 19:46356056-46356078 CCAGCCTCAGGGAGTATGCGGGG - Intronic
1167573183 19:50303355-50303377 CTAGCCTCCTGGAGGATGAGAGG - Intronic
1167756170 19:51415094-51415116 GCAGCTTCGGGGAGTCTGAGGGG + Exonic
1168126385 19:54285797-54285819 CCAGGCCCAGGGAGGGTGTGGGG + Intergenic
1168175510 19:54625067-54625089 CCAGGCCCAGGGAGGGTGTGGGG - Intronic
925210603 2:2042689-2042711 CCAACCTCAGGGTGGGTGACAGG - Intronic
925247717 2:2399220-2399242 CAGGCCTCAGGGAGTCTGTGTGG + Intergenic
925617122 2:5754244-5754266 CCAGCCTCAGGCAAGCCCAGGGG + Intergenic
926136834 2:10342498-10342520 CCAGCCTGGGGGAGGGTGGGAGG + Intronic
926197174 2:10771117-10771139 CCCTCCTCAGGGAGCCTGCGTGG - Intronic
926707441 2:15846658-15846680 AGAGGCTCAGGGAGGCTGAGGGG + Intergenic
927156263 2:20223532-20223554 CCATCCCCAGGGATGCAGAGGGG - Intronic
927461661 2:23304576-23304598 CCAGGCTCAGGGAGCCTGCATGG + Intergenic
927462794 2:23313458-23313480 TCAGCCACAGGAAGGCTGATTGG + Intergenic
928498218 2:31857823-31857845 CCTGCCTTTGGGAGGCGGAGCGG + Intergenic
928498386 2:31859833-31859855 CCAGCTTAAGGGAGGCGAAGTGG + Intergenic
928557579 2:32444125-32444147 CCAGAGTCTGGGAGGGTGAGTGG + Intronic
929596608 2:43180086-43180108 CCTGGCTCAGGGATGCAGAGTGG - Intergenic
930088362 2:47514343-47514365 CCAGGCTCCTGGAGGCTGACGGG - Intronic
931230546 2:60371077-60371099 GAAGCCTAAGGGAGGGTGAGTGG - Intergenic
931275423 2:60739956-60739978 CCAGCATTTGGGAGGCTGAGTGG - Intergenic
931667782 2:64622743-64622765 CCAGCCTCAGGGGAGTGGAGGGG + Intergenic
931892477 2:66689210-66689232 TCAGACGCAGGGAGGTTGAGAGG - Intergenic
932376541 2:71241085-71241107 CCACCTACAGGGAGGCTGAGGGG - Intergenic
932577265 2:72969642-72969664 CCAGCATTTTGGAGGCTGAGGGG - Intronic
933970862 2:87468757-87468779 CCATCCTCAGGGGGTCCGAGTGG + Intergenic
934708654 2:96501729-96501751 CCAGCTTCCTGCAGGCTGAGTGG - Intronic
934942959 2:98515680-98515702 CCAGCTCCGGGGAGCCTGAGAGG + Intronic
936322864 2:111481432-111481454 CCATCCTCAGGGGGTCCGAGTGG - Intergenic
936398520 2:112148720-112148742 CTAGCCTCCTGGAGGATGAGAGG - Intronic
938069754 2:128302170-128302192 GCTGCCTCAGGGAGTCTGAGAGG + Intronic
938115080 2:128597107-128597129 CCAGCCTCAGGGAGCTCCAGTGG + Intergenic
943459857 2:188158869-188158891 CAGCCCTTAGGGAGGCTGAGGGG - Intergenic
943579733 2:189671319-189671341 CCAACCTCTGGGAGGGAGAGTGG + Intergenic
944736768 2:202574239-202574261 TGAGCCACAGGGAGGCAGAGAGG - Intergenic
944789039 2:203105103-203105125 CCAGACTTTGGGAGGCTGAGGGG - Intronic
945046907 2:205789649-205789671 CCGGCCTCTGGGAGGCAGAGGGG - Intronic
946173390 2:217908584-217908606 CCGGCGTCAGGGAGGAGGAGTGG + Intronic
946235919 2:218324172-218324194 TCAGCCCCAGGGACACTGAGAGG + Intronic
947771675 2:232675401-232675423 CCAGCCTCCCTGAGGCTGAGAGG + Intronic
948064286 2:235065104-235065126 CCAGCCCAAGGCAGGCAGAGGGG + Intergenic
948377481 2:237531010-237531032 CCAGGCTCAGGGAAGCTGCAGGG + Intronic
948405859 2:237718409-237718431 CCATCCACAGGAAGGCAGAGGGG - Intronic
948786050 2:240353480-240353502 CCACTCTCAGGGAGGTTCAGAGG + Intergenic
948855874 2:240730330-240730352 CAAGACCCAGGGAGGCTGAGAGG + Intronic
1169771035 20:9200742-9200764 TCAGCCTCAAGAAGACTGAGAGG - Intronic
1170263669 20:14441251-14441273 CCAGCCTCCTGGAGGATGAGAGG + Intronic
1170591735 20:17776704-17776726 CCAGCCCCATGGTGGCTCAGAGG + Intergenic
1171487630 20:25495752-25495774 CCAGGCTCAGGCAGGGAGAGGGG - Intronic
1172178847 20:32988435-32988457 CCAGACAAAGGGAGGCTGTGAGG - Intronic
1172272168 20:33660717-33660739 CCAGCCACAGCTAGGCTGGGTGG + Intronic
1172331331 20:34077918-34077940 CGAGGCTCAGAAAGGCTGAGTGG + Intronic
1172759333 20:37311066-37311088 CTGGCCTCAGGGAGCCTGAGTGG + Intronic
1172766217 20:37352477-37352499 CCAGGCTCAGGGAGGCTGGATGG - Intronic
1172894527 20:38291237-38291259 GCTGACTCAGGGAGGCTGGGAGG + Intronic
1174079866 20:47963019-47963041 CCAGGCTCAGGGAGTAGGAGGGG - Intergenic
1174449587 20:50611010-50611032 CCTTCCTCAGGGATGGTGAGGGG - Intronic
1174483249 20:50845603-50845625 CCTGCCTCAGGGGGGCAGTGGGG - Intronic
1175224630 20:57437849-57437871 CCAGCTGCAAGGAGGCTGAAAGG + Intergenic
1175678731 20:60968947-60968969 CCAGCCCCCGGGAGCCTGGGCGG - Intergenic
1175778412 20:61667205-61667227 CCACCCTCAGGAAGGCTGAGAGG + Intronic
1176081643 20:63276362-63276384 GCAGCCGCAGGGAGGCTGAGTGG - Intronic
1178492948 21:33065092-33065114 CTACCTTCAGGGAGGCTCAGAGG + Intergenic
1178630987 21:34261419-34261441 TCAGTCTCAGGTGGGCTGAGAGG - Intergenic
1178781663 21:35609111-35609133 CCAGCCTCATGCCTGCTGAGGGG + Intronic
1178968510 21:37147972-37147994 CCACACTTTGGGAGGCTGAGGGG - Intronic
1179080494 21:38166325-38166347 CTGGCTTCAGGGAGGGTGAGGGG - Intronic
1179788286 21:43741573-43741595 GCAGCCTCAGGGAGAGTGGGCGG + Intronic
1180130994 21:45827032-45827054 GGAGCATCAGGGAGGCTGATGGG + Intronic
1180883251 22:19221559-19221581 CCAGATTCAGGAAGGCTGTGAGG - Exonic
1180903179 22:19389457-19389479 GCAGCTTCTGGGAGGCTGTGGGG + Intronic
1180998021 22:19975132-19975154 CCAGCCGCAGGAGGGCTGTGGGG - Intronic
1181025599 22:20125670-20125692 CCAGCCACAAGGCGGCTGAGCGG - Intronic
1181447030 22:22985029-22985051 ACAGCATGAGGCAGGCTGAGAGG + Intergenic
1181742307 22:24931097-24931119 CCATCCTCAGTGATGCTGAGGGG - Intergenic
1181808761 22:25391036-25391058 CCAGGGTGAGGGAAGCTGAGCGG + Intronic
1182418836 22:30238761-30238783 CCAGCCTCCTGGAGACTGGGCGG + Intergenic
1183326859 22:37199083-37199105 CGAGACTCAGGGACACTGAGGGG + Intronic
1183788239 22:40044549-40044571 GCGGCCTCTGGGATGCTGAGGGG + Intergenic
1183932028 22:41240780-41240802 CCAGCCTCTGAGAGGCCCAGAGG + Intronic
1184565431 22:45288992-45289014 CCACCCACAGGGAGGCGGTGGGG - Intronic
1185035579 22:48475045-48475067 CCGGCCTGTGGGAGGCAGAGGGG - Intergenic
1185035595 22:48475083-48475105 CCAGCCTGCGGGAGGCAGAGGGG - Intergenic
1185272196 22:49934783-49934805 GCAGCCCCAGGGAGGCGGGGAGG - Intergenic
949914902 3:8952721-8952743 CCAACCTCAGGGTTGCTGTGAGG - Intronic
950088176 3:10276138-10276160 CCTGCCTCAGGGTGGTTGTGAGG + Intronic
950313383 3:11978601-11978623 CCAGCATCATGGAGGCTTGGTGG + Intergenic
950562659 3:13743954-13743976 CCAAGCTCAGGGAGGTGGAGGGG - Intergenic
950577093 3:13838485-13838507 CCAGGCTCAGAGAGGTTAAGTGG - Intronic
950615056 3:14151577-14151599 CAAGACTCCGGGAAGCTGAGTGG - Intronic
950631059 3:14282253-14282275 CCAGGATGAGGGAGGCTGAGGGG - Intergenic
951251999 3:20404597-20404619 CCAGTCTCATGGTGGCTCAGTGG + Intergenic
951583890 3:24195664-24195686 TCAGCCAGAGGGAGGCTCAGTGG - Intronic
951695611 3:25442955-25442977 CAAACTTCAGGGAGGCAGAGAGG + Intronic
951700973 3:25496548-25496570 CCAGCCTCAGGGAGCCCAATAGG - Intronic
952884178 3:38002668-38002690 CCAGCCTCAGATAGGCCGATGGG + Intronic
953065795 3:39469554-39469576 CCAGACTAAAGGAGGCTGAGGGG - Intronic
953458514 3:43062878-43062900 CCAGCCTCATGGGGGATGAACGG - Intergenic
954313190 3:49786186-49786208 CCAGCATCTGGGAGGCTCGGCGG + Exonic
954373414 3:50182170-50182192 CATGCCCCAGGGAGCCTGAGCGG + Intronic
954374675 3:50188021-50188043 CCAGCCCCAGGGAGGCTCCAGGG + Exonic
955960648 3:64337931-64337953 CCTGCATGAAGGAGGCTGAGAGG + Intronic
962284559 3:134075324-134075346 GCTGCATCAGTGAGGCTGAGAGG + Intronic
962844352 3:139261782-139261804 CCAGACTCAGGGAGGGTAAGTGG + Intronic
964089879 3:152862820-152862842 GCAGCCTGAGGGAGGTGGAGTGG + Intergenic
967272261 3:187741465-187741487 CCAGGCGCAGTGAGCCTGAGTGG - Intronic
967946030 3:194804963-194804985 CTTGCCCCAGGGATGCTGAGTGG - Intergenic
968146260 3:196301462-196301484 CAACACTCTGGGAGGCTGAGCGG + Intronic
968215184 3:196883386-196883408 CCAGTCTTATGGAAGCTGAGTGG + Intronic
968626827 4:1629562-1629584 GCAGCCACAGGCAGGATGAGGGG - Intronic
968647146 4:1746667-1746689 CCAGCCTCAGGGGGGCCTGGGGG + Intergenic
968746642 4:2363943-2363965 CCACCGTCAGGCAGGGTGAGTGG - Intronic
969103879 4:4790562-4790584 CTAGGCTCAGAGAGGCTGGGCGG + Intergenic
969348187 4:6582100-6582122 CCCGCCTCAGAGGTGCTGAGAGG + Intronic
969666303 4:8559270-8559292 CCAGCCTCAAGGAGCCCGAGAGG + Intronic
970638764 4:18039890-18039912 CCAGCTGCTGGGAGGCTGAGTGG + Intergenic
971413920 4:26405123-26405145 CCTACCACAGGGTGGCTGAGGGG - Intronic
971490362 4:27205793-27205815 CCAGCTTCAGTGAGGCTGAAAGG + Intergenic
972762641 4:42122003-42122025 CAGCCCTCAGGGAGGCTGGGTGG + Intronic
973533379 4:51855551-51855573 CAAGGGTCATGGAGGCTGAGGGG + Intronic
973927511 4:55754279-55754301 CCAGTATCAGGGTGACTGAGAGG - Intergenic
975808533 4:78139185-78139207 CCAGCCTTGGGCAGGCTGACAGG + Intronic
976821020 4:89207115-89207137 GCAGCCACTGGGAGGGTGAGTGG - Intergenic
978796232 4:112710759-112710781 CCAGCATCATGGTTGCTGAGAGG + Intergenic
982079282 4:151771933-151771955 CCTGCCTGAGAGAGGCTGAAGGG - Intergenic
982296463 4:153834195-153834217 CCAGCCCCAAGGTGTCTGAGAGG - Intergenic
985015521 4:185629807-185629829 CCAGCAGTTGGGAGGCTGAGGGG - Intronic
985520941 5:373693-373715 CCAGGCTCAGGGAGGGCGGGGGG + Intronic
985548361 5:521026-521048 TCTGCCTCAGGCAGGGTGAGGGG - Intronic
985550941 5:533360-533382 GCAGCCTCAAAGAGCCTGAGAGG + Intergenic
985995386 5:3594711-3594733 CCAGGCTCAGGGAGGCGAGGAGG + Intergenic
986299714 5:6468306-6468328 CCAGCTCCAGGGAGGATGACCGG - Intronic
987033147 5:13994159-13994181 CCAGCCGGTGGGTGGCTGAGAGG - Intergenic
991710600 5:69404825-69404847 CCAGCTACTTGGAGGCTGAGTGG + Intronic
992388993 5:76313050-76313072 CCAGGCCCAGCTAGGCTGAGTGG - Intronic
992738418 5:79746935-79746957 ACAACCTCAGGGAAGCTGAGGGG + Intronic
992772445 5:80060871-80060893 CCAGCCCAAGGAAGGCTGAAAGG + Intronic
993192203 5:84696704-84696726 CAAGCCCCAGGCAGGCTCAGAGG - Intergenic
996928275 5:128855357-128855379 CCAAGCTTAGGGAGCCTGAGTGG - Intronic
997160743 5:131606799-131606821 CTAGCCTTAGGGAGGCAGAAAGG + Intronic
997962346 5:138332018-138332040 CCAGCGTTAGGCAGGCTGCGGGG + Intronic
998093440 5:139383897-139383919 CCTGCCTCAGGGACCCTGAGGGG - Intronic
998108145 5:139481536-139481558 CCAGCTGCAGGGAGGCTAGGTGG + Exonic
998477998 5:142437496-142437518 CCAAGCTCAGGGAGGTTCAGTGG - Intergenic
998877874 5:146618748-146618770 CCAGCATCAGGAATGCTGGGAGG - Intronic
999206146 5:149849524-149849546 CCAGGCTCAGGGAACCTGAGTGG - Exonic
999654079 5:153795658-153795680 CGAGCCTCAGAGAGGCTTGGAGG + Intronic
1000157238 5:158563856-158563878 CCAGCCACAGGGAGCGTGAGGGG - Intergenic
1000608866 5:163354029-163354051 TCAGTCTCATGGAGGCTCAGAGG + Intergenic
1001316632 5:170646125-170646147 CCAGGCTCAGATAGGCTGATTGG + Intronic
1001407528 5:171486392-171486414 AGAGCCTCAGAGAGGCTAAGTGG + Intergenic
1001524349 5:172418169-172418191 CCAGGCTCAGAGAGGTTAAGTGG - Intronic
1001568687 5:172716450-172716472 TCATGCTCAGGGAGGCTGGGAGG + Intergenic
1001582178 5:172806320-172806342 CCAGCCTCTGGGAAGCTGTGTGG + Intergenic
1001945658 5:175775409-175775431 AAAGTTTCAGGGAGGCTGAGGGG - Intergenic
1001961758 5:175883903-175883925 TCAGGTTCAGGGGGGCTGAGGGG - Exonic
1002430360 5:179199711-179199733 CCAGACTCAGGGAGGCTGGGAGG - Intronic
1002561990 5:180088784-180088806 CCAGCCTCCGGGGAGCGGAGAGG - Intergenic
1002917168 6:1538641-1538663 CCAGATTCAGAGATGCTGAGGGG + Intergenic
1003130419 6:3390688-3390710 CCAGGCTCAGAGATGCTGAGTGG - Intronic
1003523158 6:6875881-6875903 CCAGCCTGAGGAAGGAAGAGGGG + Intergenic
1004740798 6:18458658-18458680 ACAGACTCACAGAGGCTGAGTGG - Intronic
1004813985 6:19292477-19292499 GCAGGCTCAGAGAAGCTGAGTGG - Intergenic
1006105390 6:31713372-31713394 CCAGCAGCAGGGAAGTTGAGGGG + Intronic
1006193426 6:32223074-32223096 CCACCCTCAGGGCTGCTGTGTGG - Exonic
1006273351 6:32981123-32981145 CCCTCCCCATGGAGGCTGAGGGG - Exonic
1006387064 6:33737142-33737164 CCACCCTCAGGGAGAGTAAGAGG - Intronic
1006419834 6:33925977-33925999 GCAGAGGCAGGGAGGCTGAGGGG - Intergenic
1006435759 6:34025438-34025460 CGAGCCTGAGGGCAGCTGAGGGG + Intronic
1006499906 6:34451560-34451582 CAAGGCTCAGGGAAGCTAAGTGG - Intergenic
1006984903 6:38169669-38169691 ACAGCCTTGGGGAGGCTGAGGGG + Exonic
1007313781 6:40967889-40967911 CCAGCCTCAGGTAGGGATAGTGG - Intergenic
1007705695 6:43789822-43789844 CCATCCCCAGGGTGGCTAAGAGG - Intergenic
1007729449 6:43937077-43937099 GGAGCCTCAGGGTGGCAGAGTGG - Intergenic
1008042882 6:46820500-46820522 CCTGCCTCAGGGAGGCAGATGGG + Intronic
1008298417 6:49805486-49805508 CCAGCTCCAGGGAGTCTGGGTGG + Intergenic
1008974131 6:57404149-57404171 CTAGCCTCAGAAAGGTTGAGCGG + Intronic
1009163020 6:60305672-60305694 CTAGCCTCAGAAAGGTTGAGCGG + Intergenic
1010188889 6:73174637-73174659 GCAGCTTCAGGGAGGGTGGGAGG - Intronic
1013437643 6:110127777-110127799 GCTGTCTCAGGGAGGCAGAGAGG - Intronic
1013878082 6:114858410-114858432 CAAGACTCAGAGAGGCAGAGGGG - Intergenic
1015465325 6:133542718-133542740 CCACCCCCAGGCAGGATGAGGGG - Intergenic
1015707504 6:136104048-136104070 CTGTCCTCAGGGAGGGTGAGGGG + Intronic
1015942260 6:138464190-138464212 GCAGCCTGACAGAGGCTGAGAGG + Intronic
1016896721 6:149060834-149060856 ACAGCTTCAGGGGAGCTGAGTGG - Intronic
1018791982 6:167155690-167155712 GCAGCTCCAGGGAGGCTGAGGGG + Intronic
1018806943 6:167269105-167269127 GCAGCCGTAGCGAGGCTGAGAGG + Intergenic
1018905107 6:168071484-168071506 GCAGCGCCAGGGAGGTTGAGGGG + Intronic
1018935098 6:168269139-168269161 CCAGCCCCAGGGACAGTGAGAGG + Intergenic
1019197790 6:170291922-170291944 CCAGGCGGAGGGAGGCCGAGGGG - Intergenic
1019365946 7:632883-632905 CCAGGCTCAGGAGGGCTGACGGG - Intronic
1019500579 7:1362504-1362526 CCCGCCCAAGGGACGCTGAGGGG + Intergenic
1019516554 7:1442689-1442711 CGAGCTGCAGGGAGGCAGAGGGG - Intronic
1019576497 7:1740163-1740185 CCTGCCTCAGGGAGACACAGAGG - Intronic
1019702492 7:2480693-2480715 CCGTCCTGAGGGAGGCAGAGAGG - Intergenic
1019708751 7:2508837-2508859 TCAGGCCCAGGGAGGCTGAGAGG + Intergenic
1026893354 7:73996058-73996080 GCTGCCTCAGGGGGGCTGATGGG + Intergenic
1027269108 7:76510622-76510644 CCAGCACCCGGGAGGCTCAGGGG - Exonic
1028187333 7:87802277-87802299 CCAGCTACTGGGAGGCTGAGAGG + Intronic
1028292553 7:89084232-89084254 CCAGTCTCAGGGAGTGGGAGTGG + Intronic
1032121698 7:129161786-129161808 CCAGGCTGAAGGAGGCAGAGGGG - Intronic
1032475957 7:132211616-132211638 ACTGCCGCAGGGAGGCTGGGAGG + Intronic
1032962808 7:137059047-137059069 CCAGCACTAGGGAGGCTGAGGGG + Intergenic
1034830676 7:154305075-154305097 CCAGCCCCAGCCCGGCTGAGCGG + Intronic
1034869918 7:154674899-154674921 CCAGACCAAGAGAGGCTGAGGGG + Intronic
1035619064 8:1024161-1024183 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035619098 8:1024271-1024293 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035619118 8:1024326-1024348 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035619138 8:1024381-1024403 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035619158 8:1024436-1024458 CCACCCCCAGGGAGGGTGGGTGG - Intergenic
1035684434 8:1513044-1513066 CCAGCTCCAGGGAGGCTCAGTGG + Intronic
1035684452 8:1513117-1513139 CCAGCTCCAGGGAGGCTCGGTGG + Intronic
1035684469 8:1513190-1513212 CCAGCTCCAGGGAGGCTCAGTGG + Intronic
1035684485 8:1513263-1513285 CCAGCTCCAGGGAGGCTCGGTGG + Intronic
1035684504 8:1513336-1513358 CCAGCTCCAGGGAGGCTCGGTGG + Intronic
1035684521 8:1513409-1513431 CCAGCCCCACGGAGGCTCGGTGG + Intronic
1035688338 8:1542400-1542422 CCAGCATCAGGGTAGGTGAGAGG - Intronic
1036445950 8:8822141-8822163 GCAGCACCAGGCAGGCTGAGAGG + Intronic
1036739695 8:11348780-11348802 CCAGCTTCAGGGTTGCTGTGAGG + Intergenic
1037444362 8:18950034-18950056 CCAGCTTCAGGGAGGTTCTGAGG + Intronic
1038013540 8:23494098-23494120 CCAGCAGCAGGGAGGGTGGGTGG - Intergenic
1038017299 8:23525916-23525938 CCAGATTCATGGATGCTGAGAGG - Intergenic
1038398633 8:27266343-27266365 CCAGGCTCAGGCAGGGTTAGTGG - Intergenic
1038426990 8:27469999-27470021 TGAGGCTCAGTGAGGCTGAGTGG - Intronic
1038461782 8:27723191-27723213 GCAGCATCAGAGGGGCTGAGGGG - Intergenic
1038777318 8:30542836-30542858 CCACCCTCAGAGGGGCTGGGAGG - Intronic
1039921707 8:41897607-41897629 CCAGCCTGCGGCAGGCGGAGGGG + Intergenic
1039954305 8:42195411-42195433 ACAGGTGCAGGGAGGCTGAGAGG - Intronic
1040568646 8:48589134-48589156 ACAGCCACAGGGAGGCCAAGAGG - Intergenic
1040597834 8:48857585-48857607 TCAGGCTCACGGAGGCAGAGTGG + Intergenic
1041195504 8:55397878-55397900 CCACCCTCAGGGATGATGAGTGG - Intronic
1042451877 8:68956892-68956914 CCAGCCCTTGGGAGGCCGAGGGG - Intergenic
1042964656 8:74337566-74337588 TCAGCCTTAGGGAGGAGGAGTGG + Intronic
1043867102 8:85387918-85387940 CAACACTCTGGGAGGCTGAGGGG - Intronic
1045506268 8:102780960-102780982 ACAGCCTCAGGGAGGGTGGGAGG + Intergenic
1045778878 8:105840052-105840074 CCAGCCTAATGAAGGTTGAGAGG - Intergenic
1047364786 8:124201917-124201939 TAAGCTTCAGAGAGGCTGAGGGG + Intergenic
1047406599 8:124590511-124590533 CCAGCCTCGGGGTTACTGAGGGG + Intronic
1047450239 8:124958900-124958922 CCACCCTTTGGGAGGCTGAGAGG - Intergenic
1048204010 8:132401173-132401195 CCAGCCACATAGAGACTGAGCGG + Intronic
1048492170 8:134903792-134903814 CAAGGCTCAGAGAGGTTGAGTGG + Intergenic
1048816501 8:138339454-138339476 CCAGCTTCAGGGAAGAAGAGAGG - Intronic
1049230185 8:141477853-141477875 TCAGCATCAGGGTGGCTGTGAGG + Intergenic
1049776503 8:144408305-144408327 CCAGGCCCAGGGATGGTGAGAGG - Intronic
1049802872 8:144526383-144526405 CCTTCCTGGGGGAGGCTGAGTGG - Exonic
1051348087 9:16170875-16170897 CCAGACTAAGTGAGGTTGAGAGG + Intergenic
1056452209 9:86727252-86727274 CCAGCCTCCTGGAGGATGAGAGG - Intergenic
1056580189 9:87884524-87884546 GGAACCTCATGGAGGCTGAGTGG - Intronic
1057880278 9:98787954-98787976 CCCGCCTCAGGGCTGCTGTGGGG - Intronic
1058133379 9:101278646-101278668 CCAGCATCAGGCAGGCTGGCAGG + Intronic
1058529205 9:105889236-105889258 CCATCCCCATGGAGGCTGGGAGG + Intergenic
1059803687 9:117775703-117775725 CCAGCCACAGGCAGACAGAGAGG - Intergenic
1059964401 9:119599680-119599702 CCAGGCTCAGGGAGGCAGGTAGG - Intergenic
1061262036 9:129485664-129485686 CCAGCGTCAGGGAGGGTAATGGG + Intergenic
1061500310 9:130998053-130998075 GCCGCCCCATGGAGGCTGAGGGG + Intergenic
1061553056 9:131349067-131349089 CAAGCTCCAGGGAGGCTGGGCGG + Intergenic
1062069804 9:134549571-134549593 CCAGCCTCAGGCTGGCACAGAGG - Intergenic
1062080384 9:134620487-134620509 CCAGCCTCAGGGAGGACATGAGG - Intergenic
1062137413 9:134936982-134937004 CCAGCCTCATGGAGGGTGGCAGG + Intergenic
1062344406 9:136108290-136108312 CCAGGCACAGGGATGCTGGGTGG - Intergenic
1062361712 9:136191405-136191427 ACAGACTCAGAGAGGCTGAGCGG + Intergenic
1062417361 9:136458683-136458705 CAACACTCTGGGAGGCTGAGAGG + Intronic
1186552847 X:10524910-10524932 CCAACATCAGAGAGGTTGAGAGG + Intronic
1187274141 X:17803835-17803857 CTGGCCCCAGGGAGGCTGAGGGG + Intronic
1187932930 X:24310856-24310878 CAAGCCTCAGGGAGCTGGAGGGG + Intergenic
1189309821 X:40011336-40011358 CCAGCCCCAGAGAGGCTATGAGG + Intergenic
1190087028 X:47404277-47404299 CCAGCTACAGGGAGGCCGAGGGG - Intronic
1192152350 X:68720096-68720118 CCAGCCCCAGGGAGTCACAGAGG - Intronic
1192184724 X:68939350-68939372 CCAGTCTCATGGAGGATGTGGGG - Intergenic
1192910039 X:75593615-75593637 CCAGCCACAGGGAAGCTCAGGGG + Intergenic
1195257146 X:103101847-103101869 GCAGACTCAGGGAGGCGGCGGGG + Intergenic
1195871301 X:109489295-109489317 CCAGCCTCAGGTCAGCTCAGTGG + Intergenic
1198127415 X:133659617-133659639 CCTCCCTCAAGGAGGCTGTGAGG + Intronic
1200144732 X:153920737-153920759 CCAAGCTCCGGGAGGCCGAGCGG - Exonic
1201537645 Y:15068211-15068233 ACAGTCCCAGGGAGGCTGACCGG - Intergenic
1201735266 Y:17253481-17253503 CCAGCTACTTGGAGGCTGAGTGG - Intergenic