ID: 1089771939

View in Genome Browser
Species Human (GRCh38)
Location 11:120809238-120809260
Sequence GATGAAGAAGTCCCTCCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089771935_1089771939 1 Left 1089771935 11:120809214-120809236 CCATTGCCAGTGCTGACATTTTG 0: 1
1: 0
2: 0
3: 28
4: 246
Right 1089771939 11:120809238-120809260 GATGAAGAAGTCCCTCCATGGGG 0: 1
1: 0
2: 2
3: 11
4: 139
1089771934_1089771939 6 Left 1089771934 11:120809209-120809231 CCAATCCATTGCCAGTGCTGACA 0: 1
1: 0
2: 1
3: 18
4: 125
Right 1089771939 11:120809238-120809260 GATGAAGAAGTCCCTCCATGGGG 0: 1
1: 0
2: 2
3: 11
4: 139
1089771933_1089771939 26 Left 1089771933 11:120809189-120809211 CCTGGGCTTCTAAGGGGTCTCCA 0: 1
1: 0
2: 0
3: 4
4: 165
Right 1089771939 11:120809238-120809260 GATGAAGAAGTCCCTCCATGGGG 0: 1
1: 0
2: 2
3: 11
4: 139
1089771932_1089771939 30 Left 1089771932 11:120809185-120809207 CCAGCCTGGGCTTCTAAGGGGTC 0: 1
1: 0
2: 2
3: 15
4: 159
Right 1089771939 11:120809238-120809260 GATGAAGAAGTCCCTCCATGGGG 0: 1
1: 0
2: 2
3: 11
4: 139
1089771936_1089771939 -5 Left 1089771936 11:120809220-120809242 CCAGTGCTGACATTTTGAGATGA 0: 1
1: 0
2: 2
3: 13
4: 206
Right 1089771939 11:120809238-120809260 GATGAAGAAGTCCCTCCATGGGG 0: 1
1: 0
2: 2
3: 11
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089771939 Original CRISPR GATGAAGAAGTCCCTCCATG GGG Intronic
901663503 1:10813601-10813623 GATGAAGAAGTGACTCCGTTGGG + Intergenic
903280416 1:22247037-22247059 GATGAAGGAGCCCCTCACTGTGG + Intergenic
906965087 1:50448463-50448485 CATCCAGAAGTCACTCCATGTGG - Intronic
907648121 1:56264650-56264672 AATGGAGAGGTGCCTCCATGTGG + Intergenic
914812264 1:151037646-151037668 GATGAAGAATTCCCTAGGTGAGG + Exonic
915599567 1:156913804-156913826 GAGGAACCAGTGCCTCCATGCGG + Intronic
920945476 1:210524537-210524559 GAGCAAGGAGTCCCTCCCTGAGG + Intronic
924708238 1:246515100-246515122 GATGAAGGAATCGCTCCAGGAGG - Intergenic
1063538782 10:6911170-6911192 GATGAAGAAGTGGATCCTTGTGG - Intergenic
1064656446 10:17560663-17560685 GATGGAGAAATCCCTTCATGAGG + Intergenic
1065167388 10:22994143-22994165 GATCCAGAAGTGCCTCCTTGAGG + Intronic
1065932412 10:30491346-30491368 GATGAAGAAATCTCCTCATGTGG + Intergenic
1068357287 10:55925701-55925723 GATGAAGCAGTCACTTCATAGGG - Intergenic
1071943017 10:90609549-90609571 GATGATTAAGTGCCACCATGTGG + Intergenic
1072040882 10:91605317-91605339 GATGAAGAATTTCTTCAATGTGG + Intergenic
1074986478 10:118664329-118664351 GATGCAGAACACCCTCCTTGGGG - Intergenic
1076202652 10:128570690-128570712 GAAGAAGAAATTCCTCCATCAGG - Intergenic
1078022426 11:7666732-7666754 GTGGATGAAGTTCCTCCATGTGG + Intronic
1079175118 11:18132986-18133008 GAGGCAGCAGTCTCTCCATGAGG - Intronic
1079268729 11:18961231-18961253 GAGGAAGCATTCTCTCCATGAGG + Intergenic
1080150001 11:29041127-29041149 GATGAAGAAGCCCCACAAGGAGG - Intergenic
1081790478 11:45779765-45779787 GGTGAAGAACACCCTCAATGAGG + Intergenic
1083555696 11:63624917-63624939 GATGAAGCAGTCTCTCTCTGTGG + Exonic
1085471688 11:76762611-76762633 GAAGAAGAAGTGACTGCATGAGG - Intergenic
1085562785 11:77487396-77487418 GCAGAAGGAGTCCCTCCCTGTGG - Intergenic
1085702564 11:78757902-78757924 CCTGAAGAAGCCCATCCATGTGG - Intronic
1087738764 11:101863601-101863623 GCTGGAGAAGTGCCTCAATGTGG - Intronic
1089771939 11:120809238-120809260 GATGAAGAAGTCCCTCCATGGGG + Intronic
1090958743 11:131537150-131537172 GATGAAGAAGCTCATCCCTGTGG - Intronic
1091936731 12:4440784-4440806 GATGAAGGACACCCACCATGAGG - Intronic
1092175248 12:6400297-6400319 GATGAGGAAATTCCTCCCTGAGG + Intergenic
1096280135 12:50245646-50245668 GATGATGAATACCCTGCATGGGG + Intronic
1096452348 12:51754749-51754771 TATGTAGAATTCCCTCAATGTGG + Intronic
1097604244 12:61732904-61732926 GAACAAGAAGTCTGTCCATGAGG + Intronic
1099585691 12:84509444-84509466 GAGAAAGGAGTCCCTCCCTGGGG + Intergenic
1104519096 12:129456520-129456542 AATGGAGCTGTCCCTCCATGTGG + Intronic
1108811326 13:54227039-54227061 GAAGAAGGAGTCCTTTCATGTGG + Intergenic
1108835034 13:54533794-54533816 GATGAATGAGTCTCTCCTTGTGG - Intergenic
1110249068 13:73361183-73361205 CATCAAGGAGTCCCTCCATGTGG + Intergenic
1111220271 13:85196098-85196120 AAAGAAAAAGTCCATCCATGAGG + Intergenic
1113829546 13:113284557-113284579 GATGGAGAAGTGGCTTCATGTGG + Intergenic
1116413252 14:44650013-44650035 GCAGAAGAAGTCTCTCCCTGTGG - Intergenic
1120787280 14:88549445-88549467 GATTAAGAAGTCTCCCCTTGGGG - Intronic
1122402600 14:101476192-101476214 GATGATGAATCCCCTCCAGGGGG + Intergenic
1123918548 15:25054793-25054815 GATGAAGAAATCCCTGCTGGGGG - Intergenic
1128229393 15:66024245-66024267 CCAGAACAAGTCCCTCCATGGGG + Intronic
1128944555 15:71811832-71811854 GCTGAAGAAGTGCCTGCAGGCGG + Exonic
1129886770 15:79043674-79043696 GATGAAGAAGTGGCTACCTGGGG + Intronic
1130982052 15:88819386-88819408 GATGTTGAACTCGCTCCATGTGG + Intronic
1131352711 15:91716281-91716303 CATGTAGAACTCACTCCATGGGG + Intergenic
1138100909 16:54251781-54251803 GACCAAGAAGTCACCCCATGTGG + Intronic
1143204955 17:5134882-5134904 GATGATGGAGTCGCTCCAGGAGG + Intronic
1143499614 17:7330928-7330950 GATGCAGAAATCCCCCAATGTGG + Intergenic
1145760635 17:27423556-27423578 GATGAAGGAGTCGCTCCAGAAGG + Intergenic
1145798401 17:27668739-27668761 GATGAAGGAGTCACTCCAGGAGG - Intergenic
1146160687 17:30557872-30557894 GATGAAGGAGTCGCTCCAGGAGG + Exonic
1146523971 17:33550094-33550116 GATAAATCAGGCCCTCCATGAGG + Intronic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150936187 17:69638162-69638184 AATGACAAAGTCCCTCCCTGGGG - Intergenic
1153814888 18:8783646-8783668 GAAGTACAAGTCCCTCTATGGGG + Exonic
1155607693 18:27626162-27626184 GATGAATAAATCCATTCATGAGG - Intergenic
1156479869 18:37429599-37429621 GAAGAAGCAGTCCCTGCATGAGG - Intronic
1156855195 18:41773880-41773902 AATGAAGAAGTCCATCCACGAGG + Intergenic
1157498591 18:48173468-48173490 GGAGAAGCAGTCCATCCATGAGG - Intronic
1157905647 18:51567551-51567573 GAGGAAGAACACCTTCCATGGGG - Intergenic
1159701133 18:71629291-71629313 TATGAAGAAGTGTCTCAATGTGG - Intergenic
1159746635 18:72243662-72243684 GATGAGGAAGTACCCTCATGTGG + Intergenic
1161850990 19:6737983-6738005 GAAGAGGAAGTCCGTCCTTGGGG - Intronic
1162803427 19:13123564-13123586 AATGAAGAAGGCCTTCCTTGGGG + Intronic
1167327195 19:48834013-48834035 AATGAATAAGTCCCTCAAAGTGG - Intronic
925629592 2:5876997-5877019 GATGAAGAAGGGCCTGCATCGGG + Intergenic
927526984 2:23753177-23753199 GATCAACAAGTTCTTCCATGTGG + Intronic
929600973 2:43204324-43204346 GATGGAGGAGTCACTGCATGGGG - Intergenic
929824699 2:45301038-45301060 GATGAATCAGGTCCTCCATGAGG + Intergenic
929944538 2:46360671-46360693 CATGAAGAAGTCCCGCTCTGTGG - Exonic
930180204 2:48348326-48348348 CATGAAGAAGTCCTTCATTGGGG - Intronic
930802621 2:55458678-55458700 GATGAAAAAATGCCTACATGGGG + Intergenic
934724786 2:96608956-96608978 GAAGAAGAAGCCCCGCGATGTGG - Exonic
936631286 2:114205738-114205760 TATGAAGAAGTTTCACCATGGGG - Intergenic
938680381 2:133683798-133683820 GATGCGGAATTCCCTCCCTGGGG - Intergenic
938742831 2:134248864-134248886 AATGAAGCAGTTCCTCCAGGTGG - Intronic
940245803 2:151614491-151614513 GATGATGTGGTCCATCCATGTGG - Exonic
945257931 2:207817951-207817973 GGCGAAGTAGTCCATCCATGAGG + Intergenic
948853495 2:240719588-240719610 CATGGAGCTGTCCCTCCATGTGG + Intronic
1171156397 20:22878559-22878581 GATGAAGCAGTCATTCCTTGGGG - Intergenic
1178743307 21:35223592-35223614 TATGGGGAAGTCCCTCCATGAGG - Intronic
1184414829 22:44346207-44346229 GATGGAAATGTCCCTCCCTGAGG - Intergenic
1185017592 22:48353710-48353732 GATGGAGAAGCCCCAGCATGTGG - Intergenic
950972715 3:17204607-17204629 GAGGAAGAAGACCCAGCATGAGG + Intronic
953072550 3:39536119-39536141 GATGAAGAAATTGCTCCATGAGG - Intergenic
960791278 3:121433887-121433909 GTTGAAGAACTCTCTCCCTGAGG - Intronic
962144087 3:132821747-132821769 GCTGAAAAAGTAACTCCATGGGG - Intergenic
962313713 3:134344744-134344766 GATGAGGAAGTCCCTCCAGGTGG - Intergenic
964525857 3:157614747-157614769 GCTGAAGAAGTCTCTTCGTGAGG - Intronic
965440260 3:168703967-168703989 GATCAGGTAGTCCCTTCATGAGG - Intergenic
966055119 3:175677615-175677637 GATGAAGGAGTCCCTGGAGGGGG - Intronic
966882435 3:184357922-184357944 AATGAAGGAGTCCCTCCTGGTGG - Intronic
966891167 3:184408691-184408713 GCTTAAGAAATCCCTCCAGGAGG - Intronic
969854183 4:9985815-9985837 GATGAAGATGTCTAACCATGAGG + Intronic
971169640 4:24219845-24219867 CAGGAAGAACTCTCTCCATGGGG - Intergenic
981949637 4:150390649-150390671 GAGGAAGAATTCCTTCCTTGAGG - Intronic
982949373 4:161670496-161670518 AATGAACTAATCCCTCCATGTGG + Intronic
983837096 4:172402373-172402395 CATGAAGAAATCTCTCAATGAGG + Intronic
988736035 5:34022394-34022416 GATAAAGAAGACCCTCCTAGAGG + Intronic
991285553 5:64971702-64971724 GAGGAAGAAGCCCCTCCAGATGG + Exonic
992115384 5:73534222-73534244 AATGATGAAGTCCCTACATGTGG + Intergenic
993517328 5:88854530-88854552 GATGAAGTATTTCCACCATGAGG - Intronic
995191864 5:109326438-109326460 AATGAAGAAGTCCTTCCATGTGG + Intergenic
999841912 5:155437017-155437039 CATGTAGAAGTTCCTTCATGTGG - Intergenic
999872551 5:155767252-155767274 GCTGAGGAGGACCCTCCATGGGG + Intergenic
1001270976 5:170311522-170311544 AATGAAGAAGTCCCTACACTGGG - Intergenic
1003972707 6:11314324-11314346 GATGAAGAAGACTCTCAGTGGGG + Intronic
1004138565 6:12992224-12992246 GAAAATGAAGTCCCTTCATGGGG + Intronic
1005713245 6:28522771-28522793 TGACAAGAAGTCCCTCCATGTGG + Intronic
1008510624 6:52272405-52272427 CATGAAGAAGTACATCCATGTGG - Exonic
1009442459 6:63697153-63697175 GATAAATACCTCCCTCCATGTGG - Intronic
1015632502 6:135245765-135245787 GATGAAGAAGTGGATCCTTGTGG - Intergenic
1017561800 6:155636272-155636294 GATGTAGAGCTCTCTCCATGAGG - Intergenic
1021911535 7:25390119-25390141 CATGAATAAGTCCTTACATGAGG + Intergenic
1021911677 7:25391452-25391474 GATGAAGTAGTGCCACCATCTGG - Intergenic
1024007560 7:45238292-45238314 CACCAAGGAGTCCCTCCATGAGG + Intergenic
1024021605 7:45375869-45375891 GATAAAGAAGTCCCTTTAAGAGG + Intergenic
1028314217 7:89379941-89379963 CCTGAAGAACTCCCTCAATGTGG - Intergenic
1029419181 7:100463590-100463612 GATGGAGAAGACTCTCCAGGTGG - Exonic
1032070874 7:128805945-128805967 GTTGAAGCAGCCCCTCCATGAGG - Intronic
1033330959 7:140416603-140416625 AATGAAGAAGCCCTTCCTTGGGG + Intronic
1034782029 7:153889121-153889143 GAAGAGTAAGCCCCTCCATGCGG - Intronic
1045179575 8:99765622-99765644 GATGCAGAAGTGCCCCCAGGGGG + Intronic
1052833438 9:33233659-33233681 GCTGAAGTCATCCCTCCATGGGG - Intronic
1055931550 9:81564651-81564673 GATGCAAAAGAACCTCCATGTGG + Intergenic
1056649589 9:88446879-88446901 GATGAAGAAGTGCCTTGGTGTGG + Intronic
1057290345 9:93802355-93802377 GAAGATGAAGTCCTTCCCTGGGG + Intergenic
1057876977 9:98765050-98765072 GAAAAAGAAGACCCTCCCTGAGG + Intronic
1058753741 9:108064752-108064774 GCTGAAGCAGTCAGTCCATGAGG + Intergenic
1060024036 9:120156004-120156026 GAATAAGAATTCCCACCATGAGG - Intergenic
1061237241 9:129350304-129350326 CATGAAGACGCCCCTCCGTGTGG + Intergenic
1062220722 9:135413694-135413716 GAAGCAGAAGGCCCTCCGTGGGG - Intergenic
1062695583 9:137874389-137874411 GGTGAGGAAGTCCCTACAGGAGG - Intergenic
1197188960 X:123623155-123623177 GATGAAGAAGGCCCACCACCAGG + Exonic
1199495318 X:148446457-148446479 TAGGCAGAAGTCCCTCCATAGGG - Intergenic