ID: 1089773760

View in Genome Browser
Species Human (GRCh38)
Location 11:120821634-120821656
Sequence TGGAATTAGACCCAAGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089773750_1089773760 30 Left 1089773750 11:120821581-120821603 CCTTGTGGAACAACTGGTTTTGG 0: 1
1: 1
2: 2
3: 14
4: 172
Right 1089773760 11:120821634-120821656 TGGAATTAGACCCAAGGAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089773760 Original CRISPR TGGAATTAGACCCAAGGAGC TGG Intronic
900186426 1:1335213-1335235 TGGAATGAGGCACAGGGAGCTGG - Exonic
906665078 1:47615746-47615768 GGGAATTATAGCCAAGGAGCAGG + Intergenic
907054499 1:51352526-51352548 TGGAATTTGAACCTAGGAGATGG - Intergenic
908142034 1:61195361-61195383 TGAAATGCAACCCAAGGAGCCGG + Intronic
914753259 1:150549656-150549678 AGGAATTCGACCCCAGGGGCTGG - Intronic
919350223 1:196442545-196442567 TGGAATTTGACCTAAGCAGGTGG + Intronic
919831160 1:201540941-201540963 AGGAAATAGACCCTAGGGGCTGG - Intergenic
920654818 1:207867605-207867627 TGGAACCAAACCCAAGGGGCTGG + Intergenic
921961452 1:221039160-221039182 AGGAAGGAGACCCAAGGAGAGGG + Intergenic
922014829 1:221634704-221634726 TGGATTTATAGCCAAGGAGAAGG + Intergenic
923181886 1:231528068-231528090 TGGAAGTAGACCCGAAGGGCAGG + Intergenic
923458268 1:234185220-234185242 TAGGATTAGAGCCAAGGAGAAGG + Intronic
924325149 1:242888341-242888363 TGAAAGTAAACACAAGGAGCAGG - Intergenic
1067045368 10:42982260-42982282 GGGTTTTAGACCCAAGTAGCAGG - Intergenic
1068547150 10:58360478-58360500 TGGAATTACAACCCAGGGGCGGG + Intronic
1071531548 10:86393247-86393269 TGGGATTACTCCCAAGTAGCTGG + Intergenic
1071618574 10:87097271-87097293 TGGAATTGGGCCTAAGGAGGTGG + Intronic
1072049268 10:91687339-91687361 GGGAACTAGTTCCAAGGAGCAGG + Intergenic
1073349154 10:102807289-102807311 AGGAAATAGAACAAAGGAGCAGG + Intronic
1076667886 10:132103219-132103241 TGGAAGGAGGCCCCAGGAGCAGG + Intergenic
1078131049 11:8614512-8614534 TGGAAATGGACTAAAGGAGCAGG + Exonic
1078782839 11:14456036-14456058 TGCAATGAGAGCGAAGGAGCTGG - Intronic
1081352071 11:42066236-42066258 TGGAAGAAGACACAAGCAGCTGG + Intergenic
1082998026 11:59268215-59268237 AGGAATCAGCCCCAGGGAGCAGG - Intergenic
1084173520 11:67411663-67411685 TGGACACAGACCCTAGGAGCCGG + Intronic
1084310875 11:68315443-68315465 TGGAATCAGACCCTGGGCGCAGG - Intronic
1085484684 11:76851996-76852018 AGGCATTAGACCCCAGCAGCTGG - Intergenic
1086191534 11:84084902-84084924 GGGATTTACAGCCAAGGAGCAGG - Intronic
1087368170 11:97248271-97248293 TCGAATTTGACCCAAGGACAGGG + Intergenic
1087919787 11:103853475-103853497 TCAAATTTGAACCAAGGAGCAGG - Intergenic
1088015583 11:105055048-105055070 TGAAATTAGCCCCCAGGAGAAGG - Intronic
1089773760 11:120821634-120821656 TGGAATTAGACCCAAGGAGCTGG + Intronic
1091741589 12:2963593-2963615 TGGAATTAGAAGATAGGAGCTGG - Intronic
1095367488 12:41425340-41425362 TGGAAGTATAGCCAAGGAGTAGG + Intronic
1098718725 12:73867053-73867075 TGGAATTATAACCAGGCAGCAGG - Intergenic
1100066493 12:90652491-90652513 TGGAAGGAGACAAAAGGAGCTGG - Intergenic
1102800194 12:115725672-115725694 TGGCATTAAACCCATGGGGCTGG + Intergenic
1103329093 12:120141472-120141494 TGGAAGTAGACCAAAGGAGATGG + Intronic
1103970300 12:124666644-124666666 TGGAATTAGAGCAGAGAAGCAGG + Intergenic
1107963394 13:45578299-45578321 AGAATTTATACCCAAGGAGCAGG - Intronic
1108824492 13:54395765-54395787 TGGATTTATAGCCAAGGAGTGGG + Intergenic
1109075713 13:57832293-57832315 TGGAAGAAGACACAAGCAGCTGG + Intergenic
1109132925 13:58611202-58611224 CGGAAGAAGACGCAAGGAGCTGG + Intergenic
1113197647 13:107827477-107827499 TGGATTTAGCTCCAAGGAGAGGG - Intronic
1116641832 14:47473229-47473251 TGGAATTAGAACCACAGAGCAGG - Intronic
1118065928 14:62190069-62190091 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1119899949 14:78251059-78251081 TGGGATTGGACCCAAGGCTCCGG + Intronic
1121726820 14:96158403-96158425 TGGAATTTGACTCAAGAAGAAGG + Intergenic
1122044381 14:99012764-99012786 TGGGATCAGCCCCAAGGATCCGG + Intergenic
1123850350 15:24349737-24349759 TGGAAATGGACCAGAGGAGCGGG - Intergenic
1123854201 15:24390664-24390686 TTGAATTAGACCACAGGTGCTGG - Intergenic
1123855286 15:24404295-24404317 TGGAAATGGACCAGAGGAGCAGG - Intergenic
1126604942 15:50466756-50466778 TGGAAAAACACCCATGGAGCCGG + Intronic
1128778735 15:70343576-70343598 TGGACTTAAACACAGGGAGCTGG + Intergenic
1128806136 15:70532552-70532574 TGGAGTTAGATCCCAGGAGGTGG + Intergenic
1129249939 15:74303245-74303267 TGGGATTGGCCCCCAGGAGCAGG + Intronic
1131177114 15:90216928-90216950 TGACATTAGACCCAAAGAGAAGG - Intronic
1132590936 16:726206-726228 TGAAATTAGGCCCAGGGTGCAGG + Intronic
1132843704 16:1990462-1990484 TGAAATTAGACCCGGGGAGGAGG - Intronic
1137032102 16:35533001-35533023 GGAAATTAGACCCCAGGAGAGGG - Intergenic
1140222683 16:73055524-73055546 TTGAATCTGACCCAAGGTGCAGG - Intronic
1144344866 17:14340417-14340439 GGGGTTTAGAGCCAAGGAGCAGG - Intronic
1147545656 17:41399407-41399429 TGTAATTAAATCCAAGGACCTGG + Intergenic
1147805678 17:43129184-43129206 TGGCTGTAGACCTAAGGAGCAGG + Intergenic
1153285250 18:3450306-3450328 TTGAATTCCACCCAAGGAGCGGG + Intronic
1155295523 18:24381187-24381209 TGGGATTATAGCCAAGGAGTAGG + Intronic
1156526085 18:37768583-37768605 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1156814730 18:41296135-41296157 TGGAATTAGACCCCAAGGGATGG - Intergenic
1157887514 18:51383269-51383291 TGGAAGTGAGCCCAAGGAGCAGG - Intergenic
1158383785 18:56966157-56966179 AGGATTTATAACCAAGGAGCAGG + Intronic
1159108770 18:64032319-64032341 TGAAATTAAACCCCAGTAGCTGG + Intergenic
1160516489 18:79481899-79481921 TGGAATGACACCCCAGGACCAGG - Intronic
1160516509 18:79481987-79482009 TGGAATGACACCCCAGGACCAGG - Intronic
1160516546 18:79482165-79482187 TGGAATTACACCCCAGGACCAGG - Intronic
1160516584 18:79482343-79482365 TGGAATGACACCCCAGGACCAGG - Intronic
1160516604 18:79482431-79482453 TGGAATGACACCCCAGGACCAGG - Intronic
1160516635 18:79482579-79482601 TGGAATGACACCCCAGGACCAGG - Intronic
1160516655 18:79482668-79482690 TGGAATTACACCCCAGGACCAGG - Intronic
1160516686 18:79482815-79482837 TGGAATTACACCCCCGGACCAGG - Intronic
1160516693 18:79482844-79482866 TGGAATTACACCCCAGGACCAGG - Intronic
1160516746 18:79483077-79483099 TGGAATTACACCCCAGTACCAGG - Intronic
1160516833 18:79483433-79483455 TGGACTTACACCCCAGGACCAGG - Intronic
1160516886 18:79483640-79483662 TGGAATTACACCCCAGGACCAGG - Intronic
1160516920 18:79483817-79483839 TGGAATGACACCCCAGGACCAGG - Intronic
1160516976 18:79484054-79484076 TGGAATGACACCCCAGGACCAGG - Intronic
1161843254 19:6694851-6694873 TGAAATGAGACCCAAGGACCAGG - Intronic
1163429655 19:17259654-17259676 TGGGAAGAGACCCAAGGATCTGG + Exonic
1164519753 19:28969863-28969885 TGGTATTAGCCCCCAGGAACAGG - Intergenic
1166529474 19:43534000-43534022 TGAAACTAGACCCAGGGGGCGGG - Intronic
1166957074 19:46471669-46471691 TGCAATTGGACCTAGGGAGCCGG + Intergenic
1168104966 19:54160957-54160979 TGGAAATAGACTCAGGGATCTGG + Exonic
1168293202 19:55367130-55367152 TGGAGTTAGGCCCAAGAACCAGG + Intronic
925908778 2:8557656-8557678 TGGAATCAGAGCCAGAGAGCAGG - Intergenic
926769669 2:16358734-16358756 TGGAATTACTCCCAAAGTGCTGG - Intergenic
928008365 2:27583319-27583341 AGGAATTAAATCCAAGGAGGTGG - Intronic
928978865 2:37117775-37117797 AGGAACTAGACCAAAGGCGCTGG - Intronic
932103276 2:68920403-68920425 TGGAATTTGATCCAGGTAGCTGG + Intergenic
936167012 2:110129669-110129691 TGGAATCAGACCTGAGCAGCAGG - Intronic
939037926 2:137155368-137155390 TGCAATGAGGCCCTAGGAGCAGG - Intronic
939436177 2:142180874-142180896 TGGAAGAAGACACAAGCAGCTGG + Intergenic
942605996 2:177691583-177691605 TGGAATTTGAACCAAGTAGTTGG - Intronic
945201449 2:207285712-207285734 TGCAAATAGACACAAGGAGAAGG - Intergenic
946172236 2:217902414-217902436 TGGGACCAGACCCAGGGAGCTGG + Intronic
1169064750 20:2688697-2688719 TAGAATGAGACCCAAGGCTCTGG + Intergenic
1170233986 20:14081281-14081303 GGGATTTATAGCCAAGGAGCAGG - Intronic
1171279582 20:23884413-23884435 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1174075700 20:47934472-47934494 TGGGTTTATAGCCAAGGAGCAGG + Intergenic
1174986073 20:55453613-55453635 TGGGATTAGAACCAAGAAACTGG - Intergenic
1175203660 20:57294700-57294722 TGGAATTTGACCTCTGGAGCTGG - Intergenic
1176412456 21:6456422-6456444 TGGAAAAGGGCCCAAGGAGCCGG + Intergenic
1179010808 21:37554613-37554635 TGGACATACACCCAAGGGGCTGG + Intergenic
1179558191 21:42194047-42194069 GGCACTTAGACCCAAGGAGCTGG + Intergenic
1179687950 21:43064744-43064766 TGGAAAAGGGCCCAAGGAGCCGG + Intronic
1182579455 22:31296635-31296657 TGGAATAAGACCTAATGAGTTGG + Intergenic
1183169554 22:36176590-36176612 TGGAAATGGTCCCAAGGAGCCGG - Intergenic
1185169144 22:49282257-49282279 TGGAATAACAGCCAGGGAGCTGG - Intergenic
950794772 3:15501851-15501873 GGGAATTATAGCCAAGAAGCAGG - Intronic
950983038 3:17329747-17329769 AGGAAGTAAAACCAAGGAGCTGG - Intronic
955560595 3:60185105-60185127 TGGAATTAGAAACAAAGATCTGG + Intronic
956018260 3:64907348-64907370 TGGAAATGGAACCAGGGAGCAGG - Intergenic
957946316 3:87067910-87067932 GGGAATAAGACACAGGGAGCTGG + Intergenic
959770565 3:110090314-110090336 GGGATTTATAGCCAAGGAGCAGG + Intergenic
960570062 3:119176973-119176995 AGGAAAGAGACCCAAGGAGAGGG - Intronic
960847342 3:122016795-122016817 TGGAAGTAGACAGAAGTAGCAGG + Intronic
961654580 3:128433993-128434015 TGGAATCAGGCCGGAGGAGCTGG + Intergenic
963460295 3:145604395-145604417 AAGAATTAGAACCATGGAGCTGG + Intergenic
967795995 3:193599335-193599357 GGGCAAGAGACCCAAGGAGCTGG - Intronic
968090116 3:195894161-195894183 TGGAAGGAGACCCAGGGACCGGG + Intronic
969504523 4:7576577-7576599 TGGGAAAAGACCCAAAGAGCTGG + Intronic
972228580 4:37043743-37043765 GGGATTTATAGCCAAGGAGCAGG + Intergenic
976145460 4:82038685-82038707 TGGGATTGGACTCTAGGAGCAGG + Intronic
976287111 4:83381424-83381446 GGAATTTAGAGCCAAGGAGCAGG - Intergenic
981932668 4:150207947-150207969 GGGGATTATAACCAAGGAGCAGG + Intronic
983728030 4:170954202-170954224 TGGTATTAGACACCAAGAGCTGG + Intergenic
988732848 5:33990507-33990529 TTAAATTATACCCAAAGAGCAGG + Intronic
989179991 5:38567088-38567110 AGGAATTGGACCTAAGGAGCTGG - Intronic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
990762042 5:59140369-59140391 TTTAATTAGACCCAATGTGCAGG - Intronic
992714996 5:79501715-79501737 TGGTAAGAGCCCCAAGGAGCTGG + Intronic
996334988 5:122373841-122373863 TGGATTTACACCCAAGGGGTGGG - Intronic
998340196 5:141410363-141410385 TGGAAGCAGTCCCAAGTAGCAGG - Exonic
1002843324 6:924373-924395 TGGAATAAGACACAAGCAGCTGG + Intergenic
1003075770 6:2982668-2982690 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1003660862 6:8060381-8060403 TTTAAGTAGAGCCAAGGAGCTGG + Intronic
1003835228 6:10064612-10064634 TGAAATTATACCCAAGAAACTGG + Intronic
1004194289 6:13489246-13489268 TGGTGTCAGACCCAAGGGGCTGG + Intergenic
1005349333 6:24918829-24918851 TGGATTCAGAGCCTAGGAGCAGG - Intronic
1005632917 6:27725565-27725587 TGGAATAAGATCCCAGGAGATGG + Intergenic
1009380787 6:63026288-63026310 TGGATTTATAACCAAGGAGCAGG + Intergenic
1013864998 6:114685304-114685326 TAAAATTACACACAAGGAGCAGG - Intergenic
1014521521 6:122449126-122449148 TTGAAATAGGCCCAAGGAGAGGG - Intronic
1017553931 6:155542638-155542660 AGGAATTGGACTCAAGGATCAGG + Intergenic
1017574133 6:155782610-155782632 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1021212488 7:17871691-17871713 GGGATTTATAGCCAAGGAGCAGG - Intronic
1022660137 7:32359226-32359248 GGGATTTATAACCAAGGAGCAGG - Intergenic
1023581096 7:41683504-41683526 TGGAATTCTACTGAAGGAGCTGG + Intergenic
1028959938 7:96737495-96737517 TGAAATTAGAGCTAAGGAGAGGG + Intergenic
1030235869 7:107261547-107261569 TGGAATTAGAGACAAAGATCTGG + Intronic
1036486291 8:9182384-9182406 AAGAAATAGACCCAAGGTGCAGG - Intergenic
1038865128 8:31431233-31431255 GGGATTTACAGCCAAGGAGCAGG - Intergenic
1038944415 8:32341545-32341567 AGGGATTACACCAAAGGAGCAGG + Intronic
1040676498 8:49757107-49757129 GGGATTTACAGCCAAGGAGCAGG - Intergenic
1040924806 8:52668664-52668686 TAGAATTAGAGCCAGGGAACAGG - Intronic
1041655591 8:60346663-60346685 TGGAAGGACACCAAAGGAGCTGG + Intergenic
1044623504 8:94213910-94213932 TGGGATTGGGCCCAAGGAGTTGG - Intronic
1045129536 8:99133686-99133708 AGGAAATAGGCCCAAGGAGAAGG + Intronic
1045637266 8:104206802-104206824 TGGAATATGTCCCAAGGAGTAGG + Intronic
1053479689 9:38406878-38406900 TGGATGTAGACCCAGAGAGCAGG - Intergenic
1055953818 9:81755468-81755490 GGGACTTATAGCCAAGGAGCAGG - Intergenic
1059192210 9:112336993-112337015 TGAATTTAGAACCAAGGGGCAGG - Intergenic
1059668504 9:116472014-116472036 TGGAATTAGAACCATGCAGGGGG - Intronic
1059976144 9:119719478-119719500 TAGAAATAGACTAAAGGAGCTGG - Intergenic
1061820653 9:133225689-133225711 TGGAATTCAACCCCGGGAGCTGG + Intergenic
1185770834 X:2764400-2764422 TGGAATCAGACCCCAGGACAGGG - Intronic
1186067482 X:5781456-5781478 TGTAATTAGAGCCAAGCAGGCGG - Intergenic
1186550283 X:10497582-10497604 GGGATTTACAGCCAAGGAGCAGG - Intronic
1189078503 X:37943438-37943460 GGGATTTACAACCAAGGAGCAGG + Intronic
1189303576 X:39970113-39970135 TGGAATTAGACCAGAGGCGGTGG - Intergenic
1195252018 X:103058182-103058204 TGGAAGTAGTCCCATGGAGGTGG - Intergenic
1196072278 X:111539184-111539206 TGGAAGAAGACACAAGCAGCTGG + Intergenic
1197449034 X:126588323-126588345 TGAAATTATAGTCAAGGAGCAGG - Intergenic
1198687013 X:139237794-139237816 TGGTATTAGACCCAAGGCCCTGG - Intergenic
1200403585 Y:2785347-2785369 GGGATTTATAGCCAAGGAGCAGG + Intergenic
1200801335 Y:7389632-7389654 TGGAATGGGACCCAAGCTGCTGG + Intergenic
1201299468 Y:12493387-12493409 TGGAATCAGACCCCAGGAGAGGG + Intergenic