ID: 1089773993

View in Genome Browser
Species Human (GRCh38)
Location 11:120823514-120823536
Sequence CAGGTCGCACAGCTGGTACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 946
Summary {0: 1, 1: 1, 2: 5, 3: 145, 4: 794}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089773983_1089773993 29 Left 1089773983 11:120823462-120823484 CCCGGTCATTCCAGAGCTGAGAA 0: 1
1: 0
2: 0
3: 29
4: 196
Right 1089773993 11:120823514-120823536 CAGGTCGCACAGCTGGTACGTGG 0: 1
1: 1
2: 5
3: 145
4: 794
1089773982_1089773993 30 Left 1089773982 11:120823461-120823483 CCCCGGTCATTCCAGAGCTGAGA 0: 1
1: 0
2: 1
3: 10
4: 138
Right 1089773993 11:120823514-120823536 CAGGTCGCACAGCTGGTACGTGG 0: 1
1: 1
2: 5
3: 145
4: 794
1089773984_1089773993 28 Left 1089773984 11:120823463-120823485 CCGGTCATTCCAGAGCTGAGAAA 0: 1
1: 0
2: 1
3: 38
4: 306
Right 1089773993 11:120823514-120823536 CAGGTCGCACAGCTGGTACGTGG 0: 1
1: 1
2: 5
3: 145
4: 794
1089773985_1089773993 19 Left 1089773985 11:120823472-120823494 CCAGAGCTGAGAAAACAGAGTCT 0: 1
1: 0
2: 1
3: 29
4: 331
Right 1089773993 11:120823514-120823536 CAGGTCGCACAGCTGGTACGTGG 0: 1
1: 1
2: 5
3: 145
4: 794

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089773993 Original CRISPR CAGGTCGCACAGCTGGTACG TGG Intronic
900865954 1:5268846-5268868 CAGGTCCCACAGCTGCTGAGTGG + Intergenic
900941671 1:5802449-5802471 AAGGTCACACAGCTGGTAAGTGG - Intergenic
901053690 1:6438629-6438651 TCGGTCACACAGCTGGTAAGTGG - Intronic
901168465 1:7236547-7236569 AACGTCGCACAGCCGGTAAGGGG - Intronic
901761719 1:11476290-11476312 AAGGTCACGCAGCTGGTAAGGGG + Intergenic
901787609 1:11635162-11635184 CAGGTCACACAGCTAGTTAGCGG - Intergenic
901792038 1:11658762-11658784 CTGAACGCACAGCTGGTACTTGG - Exonic
901904781 1:12398924-12398946 CAGGTCACACTGCTGGTCAGTGG - Intronic
902065384 1:13681455-13681477 AAGGTCACACAGCTAGTAAGTGG + Intergenic
902189871 1:14754828-14754850 AAGGTCACACAGCTGGCAGGTGG - Intronic
902207075 1:14876591-14876613 AAGGTCACAGAGCTGGTAAGGGG - Intronic
902244829 1:15113968-15113990 AAGGTCACACAGCTGGGAAGTGG + Intronic
902548334 1:17204551-17204573 CAGGTCTCACTGCTAGTAAGTGG - Intergenic
902603009 1:17552824-17552846 CAGGTCACACAGCTAGTAAATGG + Intronic
902664345 1:17927149-17927171 AAGGTCACACAGCTGGTACATGG + Intergenic
902761625 1:18584598-18584620 AAGGTCACACAGCTGGTAAGTGG + Intergenic
902889995 1:19435994-19436016 AAGGTCACACAGCTGGGACCCGG - Intronic
902936897 1:19770970-19770992 AAGGTCACACAGCTGATAAGTGG - Intronic
903018477 1:20377236-20377258 GAGGTCACACAGCTGGGACCTGG - Intergenic
903187356 1:21636240-21636262 AAGGTCACACAGCTGTTATGTGG - Intronic
903192138 1:21662799-21662821 CAGGTCACCCAGCTGGTGAGTGG - Intronic
903272674 1:22201024-22201046 AAGGTCACACAGCTGATAAGTGG - Intergenic
903385095 1:22920950-22920972 CAGGTCACACAGCCAGTAAGTGG + Intergenic
903414910 1:23175932-23175954 AAGGTCACACAGCTGGTAAGTGG + Intronic
903450245 1:23448876-23448898 CAAGTCACACAGCTGTTAAGTGG + Intronic
903460272 1:23516089-23516111 AAGGTCACATAGCTGGTAAGTGG + Intronic
903480141 1:23647089-23647111 CAAGTCACACTGCTGGTAAGTGG - Intergenic
903574949 1:24333665-24333687 AAGGTCACACAGCTAGTATGTGG + Intronic
903577186 1:24346343-24346365 CAGGTCACACACCTAGTGCGTGG + Intronic
904090950 1:27944856-27944878 CAGGTCACACAGCTCCTAAGTGG + Intronic
904213308 1:28899887-28899909 GAGGTCTCACAGCTGGTAAGGGG - Intronic
904263761 1:29306053-29306075 CAGGTTGCACAGCTAGTGAGTGG + Intronic
904282994 1:29434353-29434375 AAGGTCACACAGCTGGTCCATGG + Intergenic
904320463 1:29694845-29694867 AAGGTCACACAGCTGGTGAGAGG - Intergenic
904437267 1:30506927-30506949 AAGGTCACACAGCTGGTGAGAGG + Intergenic
904456456 1:30651153-30651175 CAAGTCGCACAGCTTGTTGGCGG - Intergenic
904592638 1:31623566-31623588 CAGGTCCCCCAGCTGGTCTGAGG - Exonic
904772516 1:32888219-32888241 AAGGTCACATAGCTGGTAAGAGG + Intronic
904798404 1:33074932-33074954 AAGATCACACAGCTGGTAAGTGG - Intronic
904883489 1:33718112-33718134 AAGGTCGCCCAGCTAGTATGTGG + Intronic
904922373 1:34019026-34019048 GAGGTCACACAGCTAGTAAGAGG - Intronic
904974579 1:34445996-34446018 AAGGTCACACAGCTAGTAAGAGG - Intergenic
905270047 1:36781808-36781830 AAGGTCACCCAGCTGGTAGGAGG - Intergenic
905321967 1:37124218-37124240 AAGGACACACAGCTGGTAAGTGG + Intergenic
905360861 1:37419411-37419433 GAGGTCACACAGCTAGTAAGTGG + Intergenic
905395952 1:37666681-37666703 GAGGTCACACAGCTGGTACATGG + Intergenic
905451188 1:38057699-38057721 CTGGTCACACAGCTGGTAAGAGG - Intergenic
905453133 1:38069913-38069935 GAGGTCACACAGCTGGTAAATGG + Intergenic
905738553 1:40349430-40349452 CAAGTCACACAGCTAGTAAGTGG + Intronic
906526642 1:46497166-46497188 AAGGTCCCACAGCTAGTAAGTGG - Intergenic
906541548 1:46590541-46590563 AAGGTCGCATAGCTTGTAAGTGG + Intronic
906798998 1:48719835-48719857 GAGGTCACAGAGCTGGTAAGCGG + Intronic
906928387 1:50143614-50143636 AAGGTCACACAGCTAGTAAGTGG + Intronic
907048550 1:51314761-51314783 CAGGTCACACAGCTGGTAGCTGG - Intronic
907251642 1:53143418-53143440 GAGGTCACACAGCTAGTAAGTGG - Intergenic
907354796 1:53863314-53863336 AAGGTCCCACAGCTGGTACCCGG - Intronic
907473941 1:54692919-54692941 CAGGTCACACAGGTGGCAAGTGG - Intronic
907560725 1:55385181-55385203 AAGGTCACACAGCTGGTAAGTGG - Intergenic
907706473 1:56836823-56836845 AAAGTCACACAGCTGATACGTGG - Intergenic
907733707 1:57091666-57091688 AAGGTCACATAGCTGGTAAGTGG - Intronic
908112997 1:60915681-60915703 CAGTTCACACAGGTGGTAGGAGG - Intronic
908358003 1:63340955-63340977 CAAGTCACACAGCTAGTAGGTGG - Intergenic
908442369 1:64168211-64168233 GTGGTCTCACAGCTGGTAGGTGG - Intronic
908443224 1:64176518-64176540 GGGGTCACACAGCTGGTAAGTGG + Intronic
908767192 1:67564798-67564820 AAGGTCACACAGCTAGTAAGTGG + Intergenic
909321431 1:74291560-74291582 TAGGTCACACAGCTAGTAAGTGG + Intronic
909434751 1:75627992-75628014 TAGGTCTTACAGCTAGTACGTGG + Intergenic
909564848 1:77042881-77042903 AAGGTCCCACAGCTAGTAGGTGG + Intronic
909971533 1:81996820-81996842 AAGGTCTCACAGCTGGTAAGTGG + Intergenic
910355393 1:86346931-86346953 AAGGTCGCACAGCTAGTAAGTGG - Exonic
910440403 1:87246085-87246107 AAGGTCACCCAGCTGGTAAGTGG - Intergenic
910844761 1:91594393-91594415 AATGTCGCACAGCTGTTAAGGGG + Intergenic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
911328035 1:96492374-96492396 GAGATCACACAGCTAGTACGTGG + Intergenic
912420967 1:109542151-109542173 AAGGTCGCACAGCTAGTAAGCGG - Intronic
912859133 1:113197513-113197535 CAAGTCACAGAGCTGGTAAGTGG - Intergenic
913017892 1:114757709-114757731 CAGGTCGCAGAGCTGAAACGAGG - Intronic
913229146 1:116727042-116727064 AAGGTCACACAGCTTGTAAGAGG + Intergenic
913255401 1:116948820-116948842 AAGGTCACACAGCTGATAGGTGG - Intronic
914333182 1:146691300-146691322 AAGGTCTCACAGCTAGTAAGTGG + Intergenic
914901007 1:151711118-151711140 AAGGTCGCCCAGCTAGTAAGTGG - Intronic
915276044 1:154788912-154788934 AAGGTCACACAGCTGGTAAGTGG + Intronic
915300886 1:154951032-154951054 AAGGTCACACTGCTGGTAAGGGG - Intronic
915320534 1:155053686-155053708 CAGGTCACACAGCTAGTATGTGG + Intronic
915516250 1:156414249-156414271 CAGGTTGCCCAGCTGGTTAGCGG - Intronic
915548887 1:156620307-156620329 GAGGTCACACAGCTAGTAAGAGG - Intronic
915593858 1:156885392-156885414 AATGTCACACAGCTGGTAAGTGG - Intergenic
916002576 1:160631258-160631280 CAGATCACACAGCTGGTTTGTGG - Intronic
916452034 1:164930049-164930071 CAGGTGTCACTGCTGTTACGAGG + Intergenic
916748699 1:167704377-167704399 TAGGTCACACAGCTAGTAAGTGG - Intronic
917084104 1:171288411-171288433 AAGGTCACACAGCTAGTAAGTGG - Intergenic
917836080 1:178942567-178942589 CAGGTCACACAGCTGGTGCCTGG + Intergenic
918216709 1:182398009-182398031 CAAGTCTCACAGTTGGTATGAGG - Intergenic
919807264 1:201387563-201387585 AAGGTCACACAGCTGATTCGTGG + Intronic
919982069 1:202648004-202648026 AAGGTCACACAGCTGCTAAGTGG - Intronic
920032823 1:203047800-203047822 AAGGTCACACAGGTGGTAAGAGG + Intronic
920047914 1:203145603-203145625 CAGGTGGCAGAGCTGGGACTGGG - Intronic
920249262 1:204612083-204612105 AAGGTTGCACAGCTAGTAGGAGG - Intergenic
920394366 1:205632913-205632935 CAGGTCACACAGCTAGTAAATGG - Intergenic
920414995 1:205793211-205793233 CAGGACACACAGCTGGGAGGAGG + Intronic
920733725 1:208512499-208512521 CTGGTCTCACAGCTGGTAAGTGG + Intergenic
921218674 1:212958065-212958087 CAGGGCCCACAGCTAGTAGGTGG + Intronic
921318245 1:213912607-213912629 CAGGTCACCCAGCTAGTAAGTGG + Intergenic
921382448 1:214538322-214538344 CAGCTCTCACAGCTAGTAAGTGG - Intronic
921562146 1:216671624-216671646 AAGGTCTCACAGCTGGTAAGTGG + Intronic
922240052 1:223749518-223749540 CAGGCCACACAGCTGGTAAGAGG - Intronic
922248582 1:223825327-223825349 CAGGTCACACAGCTATTAAGTGG + Intronic
924197665 1:241624858-241624880 AAGATCACACAGCTGGTAAGTGG - Intronic
924543480 1:245003448-245003470 AAGGTCTCACAGCTAGTACATGG + Intronic
1063002306 10:1936007-1936029 CAGGTCACACAGCAAGTAGGTGG - Intergenic
1063189753 10:3682274-3682296 CAGGTCACACAGCAGGCAGGCGG + Intergenic
1065420105 10:25533858-25533880 CAGGTCACATAGCTGGTAAGTGG - Intronic
1065567583 10:27029903-27029925 AAGGTCACACAGCTGGTAACTGG - Intronic
1066501546 10:36000030-36000052 CAGGTCACACAGATGTGACGTGG + Intergenic
1067791562 10:49292305-49292327 AAGGTCACACAGCTGGTGTGAGG + Intergenic
1067816867 10:49485264-49485286 CAGGTCACGCAGCTGCTAAGTGG + Intronic
1069569548 10:69486040-69486062 AAGGTGGCACAGCTAGTATGAGG - Intronic
1069823952 10:71243967-71243989 GAGGTCACACAGCTGGTGTGTGG + Intronic
1069828538 10:71268918-71268940 AAGGACGCAGAGCTGGCACGGGG - Intronic
1069875513 10:71560554-71560576 AAGGTCGCACAGATTGTAAGTGG - Intronic
1069885308 10:71619887-71619909 GAGGTCACACAGCTAGTACATGG - Intronic
1069899453 10:71698895-71698917 AAGGTCACACAGCTGGTAAGTGG - Intronic
1070156420 10:73838357-73838379 AAGGTCACACAGCTGGCAAGTGG - Intronic
1070276681 10:75013821-75013843 GAGGTCACACAGCTGGTACATGG + Intronic
1070602932 10:77878246-77878268 GAGGTCACACAGCTGGTGAGTGG - Intronic
1070651479 10:78240104-78240126 AAGGAAGCACAGCTGGTACCAGG + Intergenic
1070730106 10:78821235-78821257 GAGGTCACACAGCTGTTAAGTGG - Intergenic
1070754897 10:78985815-78985837 CAGGTCACACAGCAGGTCAGTGG + Intergenic
1070785608 10:79160574-79160596 CAAGTCACACACTTGGTACGAGG + Intronic
1070805355 10:79267597-79267619 AAGATCACACAGCTGCTACGTGG + Intronic
1070853008 10:79583069-79583091 CAGGTCACACAGCCGGGAAGTGG - Intergenic
1070888072 10:79922236-79922258 CAGGTCACACAGCCGGGAAGTGG + Intergenic
1071003115 10:80853703-80853725 AAGGTCACACAGCTAGTTCGTGG + Intergenic
1071568409 10:86683394-86683416 AAGGTCACACAGCTAGTAAGTGG + Intronic
1071789800 10:88941777-88941799 CTGGACGCACAACTGGTAGGTGG - Exonic
1071981825 10:91010921-91010943 AAGGTCGCGCAGCTGGTAAGTGG - Intergenic
1072417347 10:95260252-95260274 AAGGTCACACAGCTAGTAAGAGG + Intronic
1072419360 10:95276750-95276772 GAGGTTGCACAGCTGGTGAGCGG + Intronic
1072627812 10:97124820-97124842 TGGGTCGCACAGCGGGTAAGTGG - Intronic
1072755867 10:98020464-98020486 AAGGTCACACAGCTAGTACCTGG + Intronic
1073442513 10:103560792-103560814 AAGGTCACATAGCTGGTAAGTGG - Intronic
1073458412 10:103651572-103651594 AAGGTTGCACAGCTGGGAGGTGG - Intronic
1074189471 10:111123488-111123510 AGGGTCACACAGTTGGTACGTGG + Intergenic
1074390529 10:113053885-113053907 AAGGTCACACAGCTGGGAGGCGG + Intronic
1074419138 10:113293777-113293799 AAGATCACACAGCTGGTAAGCGG - Intergenic
1074711248 10:116179483-116179505 AAGGTCTCATAGCTGGTAAGTGG + Intronic
1075394431 10:122116472-122116494 AAGGTCACACAGCTGGTAAGGGG - Intronic
1077634567 11:3833576-3833598 AGGGTCACACAGCTGGTAAGAGG - Intronic
1078402150 11:11037924-11037946 CAGGTCACATAGCTGGTGAGTGG + Intergenic
1078409095 11:11096848-11096870 AAGGTCAAACAGCTGGTAAGTGG - Intergenic
1078725672 11:13928779-13928801 AAAGTCACACAGCTGGTAAGTGG + Intergenic
1078735937 11:14020803-14020825 GAGGTCACACAGCTGGTAAATGG - Intronic
1079091337 11:17482361-17482383 AAGGTCACACAGCTGGTCAGGGG - Intergenic
1079148389 11:17875079-17875101 CAGGTTACACAGCTTGTAAGTGG + Intronic
1079335546 11:19567508-19567530 CAGGTCACACAACTAGTAAGTGG + Intronic
1079370874 11:19851192-19851214 AAGGTCACACAGCTAGTAAGTGG + Intronic
1079520583 11:21321710-21321732 CAGGCCACACAGCTGATAAGTGG + Intronic
1080328183 11:31102920-31102942 AAAGTCACACAGCTGGTACATGG - Intronic
1080443437 11:32315775-32315797 AAGGTCACACAGCTGGTAACTGG - Intergenic
1080545933 11:33318457-33318479 AAGGTCACACAGCTAGTAAGAGG - Intronic
1080684211 11:34502203-34502225 CAGGTCACATGGCTGGTAAGTGG + Intronic
1081325079 11:41734688-41734710 CAGGAAGCACAGCTGGAATGGGG + Intergenic
1081533107 11:43977816-43977838 AAGGTCACACAGCTGGTAGGTGG - Intergenic
1081593708 11:44444723-44444745 CAGGTCACACAGCTGGTGAATGG - Intergenic
1081620719 11:44617827-44617849 GAGGTTGCTCAGCTGGTAGGCGG + Intronic
1081677065 11:44976312-44976334 AAGGTCACACAGCTAGTAAGAGG - Intergenic
1081756851 11:45550928-45550950 AAGGTCACACAGCTGGTGCCTGG + Intergenic
1081862729 11:46342758-46342780 AAGGTCACCCAGCTGGTAAGTGG - Intronic
1082095808 11:48128273-48128295 CAGGTATCACAGCTGGAAAGTGG + Intronic
1082821001 11:57544588-57544610 AAGGTCACACAGCTGGTACATGG - Intronic
1083198543 11:61105359-61105381 AAGGTCGCCCAGTTGGTAAGTGG - Intronic
1083252271 11:61476140-61476162 CAGGTCACACAGCTACTAAGGGG - Intronic
1083257149 11:61503546-61503568 AAGGTCACACAGCCGGTAAGGGG - Intergenic
1083279604 11:61618774-61618796 CAGGTTGCACAGCTGAGACTTGG - Intergenic
1083640095 11:64140775-64140797 AAGGTCACAAAGCTGGTACACGG + Intronic
1083882298 11:65554592-65554614 AGGGTCGCACAGCTGGCACATGG - Intronic
1083891718 11:65598845-65598867 CAGCTCCCACAGCTAGTAAGTGG - Intronic
1083949502 11:65946213-65946235 GAGGTCACACAGCTGGGAAGTGG - Intronic
1084028841 11:66468890-66468912 AAGGGCACACAGCTGGTAAGTGG + Exonic
1084173736 11:67412767-67412789 AAGGTCACACAGCTGGTGAGAGG - Intronic
1084275556 11:68049452-68049474 CAGGTGGCACAACTGGCACTGGG + Intronic
1084959539 11:72709324-72709346 CAGGTCACACAGCTAGTCAGTGG + Intronic
1085029765 11:73264009-73264031 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1085250551 11:75140791-75140813 AAGGACACACAGGTGGTACGTGG - Intronic
1085250795 11:75142378-75142400 AAGGTCACACAGTTGGTAAGAGG - Intronic
1085477518 11:76797463-76797485 CATGCCGCACAGCTGGTCAGAGG - Exonic
1085718988 11:78896805-78896827 CAGGTCCCACAGCCAGTAAGTGG - Intronic
1085732400 11:79010921-79010943 CAGGACCCACAGCTAGTAAGGGG - Intronic
1085767114 11:79292735-79292757 CAGGTTGCATAGCTGGTAAGTGG - Intronic
1086119900 11:83294835-83294857 CAGGTCACAGAGCAAGTACGTGG + Intergenic
1088267717 11:108003470-108003492 AAGGTCTCACAGCTCCTACGTGG - Intergenic
1088831813 11:113543305-113543327 GAGGTCACACAGCTGGTAAGTGG + Intergenic
1088846778 11:113674926-113674948 AAGGTCACACAGCTGGTGAGGGG - Intergenic
1089166579 11:116482161-116482183 AGGGTCTCACAGCTGGTATGTGG + Intergenic
1089259251 11:117211830-117211852 CAGTTCTCACAGCTAGTAAGTGG - Intronic
1089299613 11:117490694-117490716 AAGGTCACACAGCTGGTGAGTGG + Intronic
1089307070 11:117533345-117533367 CAGGTCGCACAGCCAGGAAGTGG + Intronic
1089319712 11:117617163-117617185 AAAGTCACACAGCTGGTAAGGGG + Intronic
1089773993 11:120823514-120823536 CAGGTCGCACAGCTGGTACGTGG + Intronic
1089983442 11:122791283-122791305 AAGGCCACACAGCTGGTAAGTGG - Intronic
1090450459 11:126801604-126801626 AAGGTCCCACAGCTGGTGAGTGG - Intronic
1091306705 11:134540919-134540941 TAGGTCGCACAGTTATTACGAGG + Intergenic
1091674954 12:2482417-2482439 AGGGTCGCACAGCTGGGAAGTGG - Intronic
1091725503 12:2843837-2843859 CAGGTCACCCAGCTAGTACAGGG - Intronic
1091815330 12:3433528-3433550 AAGATCACACAGCTGGTAAGTGG + Intronic
1092086195 12:5764229-5764251 AAAGTCACACAGCTAGTACGTGG + Intronic
1092125198 12:6070489-6070511 AAAGTCACACAGCTGCTACGAGG - Intronic
1094066332 12:26364470-26364492 AAGGTCACAGAGCTGGTAAGTGG + Intronic
1094440604 12:30471670-30471692 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1095956638 12:47810314-47810336 GAGGTCACACAGATGGTATGTGG + Intronic
1096426709 12:51510069-51510091 CAGCCTGCACAGCTGGTACGAGG + Exonic
1098065327 12:66608707-66608729 GAGGTCACACAGCTAGTAAGTGG - Intronic
1098165662 12:67695058-67695080 CAGGTCACACAGCCAGTAGGTGG + Intergenic
1100300313 12:93300999-93301021 AAGGTCACACAGCTGGTCAGTGG + Intergenic
1100373759 12:93993442-93993464 GAGATCACACAGCTGGTAAGTGG - Intergenic
1100441070 12:94617352-94617374 CAGGTCGTATAGCTGCTAAGAGG - Intronic
1101013142 12:100471967-100471989 AAGGTCACACAGCTTGTAAGTGG + Intergenic
1101242312 12:102850644-102850666 CAGGTCACACAGCTGGTTAGTGG + Intronic
1101286019 12:103313497-103313519 CAGGTAACACAGCTGGGAAGGGG - Intronic
1101398494 12:104368415-104368437 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1101415671 12:104506306-104506328 CAGGTCACACGGCTAATACGTGG - Intronic
1101631184 12:106496484-106496506 AAGGCCACACAGCTGGTAAGAGG - Intronic
1101658823 12:106748156-106748178 AAGGTCACACAGCTGGCACATGG + Intronic
1101671814 12:106882594-106882616 AAGATCACACAGCTGGTAAGTGG + Intronic
1101753906 12:107606157-107606179 CAAGTCACAGAGCTGGTAAGTGG - Intronic
1101796327 12:107977992-107978014 AAGGTCGCACAGCTAGTAAGTGG + Intergenic
1101819347 12:108171759-108171781 AAGGTCACACAGCTGGTTAGAGG - Intronic
1101840486 12:108324340-108324362 AAGGTCACACAGCTGGTAAGCGG - Intronic
1102019662 12:109673366-109673388 AAGATCACACAGCTGGTAAGTGG - Intergenic
1102083173 12:110114828-110114850 AAGGTCGCAGAGCTGGTAGCTGG - Intergenic
1102152422 12:110698006-110698028 AAGGCCACACAGCTGGTAAGAGG + Intronic
1102198688 12:111042515-111042537 AAGGTCACACAGCTGGTAAGTGG - Intronic
1102224699 12:111219768-111219790 CAGATCACACAGCTAGTAAGTGG - Intronic
1102244535 12:111347271-111347293 CAGGTCACACAGCTAGTAAGTGG - Intronic
1102338907 12:112106585-112106607 GAGGTCACACAGATGGTAAGTGG - Intronic
1102387033 12:112518831-112518853 AAGGTCGCACAGCTAGTAAATGG - Intergenic
1102548934 12:113676885-113676907 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1102633971 12:114306397-114306419 ATGGTTGCACAGCTGGTAAGCGG + Intergenic
1102678385 12:114673743-114673765 AAGGTCACACAGCGGGTACATGG - Intronic
1102783026 12:115581926-115581948 AAGGTCACACTGCTGGTAAGTGG + Intergenic
1102891471 12:116561698-116561720 CAGGCCACACAGCTAGTAAGGGG - Intergenic
1102894632 12:116588789-116588811 AAGGTCACACAGCTGGTTAGAGG - Intergenic
1103190214 12:118994675-118994697 AAGGTCGCACAGCTACTAGGTGG - Intronic
1103208947 12:119153301-119153323 AAGGTCACACAGCTAGTAAGTGG + Intronic
1103210955 12:119166044-119166066 CAGGTCACACAGATAGTAAGTGG + Intergenic
1103231717 12:119336604-119336626 AAAGTCACACAGCTGGTGCGTGG - Intronic
1103335561 12:120186862-120186884 CAGGTCACACAGCCTGTAAGTGG + Intronic
1103403748 12:120660432-120660454 CAGATCACAGAGCTGGTAAGAGG - Intronic
1103530572 12:121598362-121598384 CAGGTCACACAGCTGGTACATGG - Intergenic
1103743841 12:123108984-123109006 CAGGTTGCACAGCTAGTCAGTGG - Intronic
1103925231 12:124420152-124420174 GAGGTCACCCAGCCGGTACGTGG - Intronic
1103928330 12:124435848-124435870 TAGGTCACACAGCTGGGAAGTGG - Intronic
1104031431 12:125067861-125067883 CTGATCACACAGCTGGTAAGTGG - Intronic
1104072285 12:125356285-125356307 AAAGTCACACAGCTGGTATGTGG - Intronic
1104412228 12:128568615-128568637 AAGGTCACACAGCTGGCAAGTGG + Intronic
1104701179 12:130905294-130905316 CTGGGCACACAGCTGGTAAGAGG - Intergenic
1105212699 13:18266757-18266779 GAGGTCACACAGCTGGGAGGTGG - Intergenic
1106859578 13:33890791-33890813 AAGGTCACACAGCTTGTAGGTGG + Intronic
1107646351 13:42497876-42497898 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1107790733 13:43999626-43999648 AAGGTCACACAGCTGGTAGTAGG + Intergenic
1108343277 13:49518690-49518712 CAGGTTACACAGCTGGTCAGTGG + Intronic
1108738143 13:53306913-53306935 GAGGTCACACAGCTAGTGCGGGG + Intergenic
1109683335 13:65782512-65782534 CAGGTAGGAAAGCTGGTAAGAGG + Intergenic
1109881306 13:68480975-68480997 TAGGTCACACAGTTGGTATGTGG - Intergenic
1110551505 13:76815708-76815730 CAGATCTCACAGCTGGTAATGGG + Intergenic
1110686749 13:78384522-78384544 AAGGTTACACAGCTGGTAGGTGG + Intergenic
1111650946 13:91090710-91090732 CAGGTCACACAGCTGGTGAGAGG - Intergenic
1112194589 13:97212607-97212629 AGGGTCGCACAGCTGGCAGGTGG - Intergenic
1113831967 13:113302844-113302866 CAGGTCACACAGCTAGTGAGTGG - Intronic
1113849581 13:113410556-113410578 CAGGACGCACAGCTGCTCCTTGG - Intergenic
1113897876 13:113777349-113777371 CAGGTCACATAGCTGGCAAGAGG - Intronic
1114169687 14:20259860-20259882 AAGGTCATACAGCTGGTAAGTGG - Intronic
1114539867 14:23446893-23446915 CAGGTCACATAGCTGGTTCGTGG - Intergenic
1114766127 14:25372786-25372808 CAAGTCACACAGTTGGTAGGTGG + Intergenic
1115922947 14:38396919-38396941 CAGGTCACAAAGCTAGTACATGG - Intergenic
1116875168 14:50104063-50104085 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1116951792 14:50885095-50885117 AAGGTCACACAGCAGGTAAGTGG + Intronic
1117475397 14:56089385-56089407 AAGGTCACACAGCTAGTAGGTGG - Intergenic
1118138761 14:63056764-63056786 AAGGTCACACAGCTGATAAGTGG + Intronic
1118595010 14:67428543-67428565 CAAGTCACACAGCTGGTACGTGG + Intergenic
1118720269 14:68589000-68589022 CAGGTCACCCAACTGGTACCTGG - Intronic
1119167341 14:72505695-72505717 AAGGTCACACAGCTGGTAGGTGG - Intronic
1119384299 14:74247600-74247622 CAGGCCCCACAGCTAGTAAGTGG + Intronic
1119614477 14:76089823-76089845 AAGGTCGTACAGCTGCGACGTGG - Intergenic
1119761481 14:77155070-77155092 CAGGTCACCCAGCTTGTAGGTGG + Intronic
1119784011 14:77298941-77298963 AAGGTCGCACAGCTAGTAAGTGG - Intronic
1119874881 14:78050277-78050299 CAGGTCACACAGCTGGTAAGTGG - Intergenic
1121288095 14:92752190-92752212 CAGCTCACACAGCTTGTAAGTGG - Intergenic
1121421678 14:93820226-93820248 AAGGTCACACAGCTAGTAAGAGG - Intergenic
1121425446 14:93847427-93847449 AAGGACACACAGCTGCTACGTGG + Intergenic
1121658096 14:95613197-95613219 CAGGTCACAGAGCTGGTAAGAGG + Intergenic
1121835435 14:97088049-97088071 AAAGTCGCACAGCTGGTAGGAGG - Intergenic
1122067604 14:99184533-99184555 CAGGTCACAGGGCTGGTAAGTGG + Intronic
1122250870 14:100438860-100438882 AGGGTCACACAGCTGGTAAGAGG + Intronic
1122445750 14:101767263-101767285 CAGGTCGCATAGGTGCTAGGCGG + Intronic
1122562592 14:102627142-102627164 CAGGTAGCACATCTGGTAAGGGG - Intronic
1122896436 14:104759860-104759882 CAGCTCGCCCAGCTGGTAAATGG + Intronic
1124873363 15:33566062-33566084 AAGGTCACACGGCTGGTAAGTGG + Intronic
1125607142 15:40946308-40946330 AGGGTCACTCAGCTGGTACGTGG + Intergenic
1125729885 15:41887117-41887139 AAGGCCACACAGCTAGTACGTGG + Intronic
1125795987 15:42404177-42404199 CAGGTCACCCCGCTGGTAAGTGG - Intronic
1125887869 15:43242181-43242203 AAGGTCACACAGCTAGTAAGAGG + Intronic
1126581798 15:50248817-50248839 AAGGTCACACAGCTAGTAAGTGG - Intronic
1126670472 15:51111073-51111095 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1126955067 15:53924301-53924323 AAGGTCACACAGCTGGTAAATGG - Intergenic
1127113315 15:55698098-55698120 AAGGGCGCAGAGCTGGTAGGAGG - Intronic
1127261677 15:57331326-57331348 GAGGACGCACAGCTGTTAGGAGG + Intergenic
1127960815 15:63888979-63889001 CAGGTCACACAGCTGGGGAGAGG - Intergenic
1128236056 15:66067965-66067987 CAGGCCACACAGCTAGTAAGTGG - Intronic
1128271510 15:66314349-66314371 AAGGTCACACACCTGGTAAGTGG + Intronic
1128336056 15:66786422-66786444 AAGGTCACACAGCTGCTAAGTGG - Intergenic
1128620354 15:69143942-69143964 AAGGTCATACAGCTGGTAAGTGG + Intergenic
1128730906 15:70020437-70020459 AAGGTCACACAGCTTGTATGTGG + Intergenic
1129316922 15:74750690-74750712 CAGGTCACACAGCTGGTCTGAGG - Intronic
1129421808 15:75434009-75434031 AAGGTTGCACAGCTAGTAAGAGG + Intronic
1129512334 15:76133613-76133635 CAGGTCACAGAGCTAGTAGGTGG + Intronic
1129693540 15:77727834-77727856 AAGGTCACACAGCTGGCAGGTGG + Intronic
1129880059 15:79000411-79000433 AAGGTCACACAGCTAGTAGGGGG - Intronic
1130056137 15:80527717-80527739 CAGTTTGCACAGCTGGTAACTGG + Intronic
1130225068 15:82050514-82050536 AGGGTCACACAGCTGGTATGTGG + Intergenic
1130910207 15:88265654-88265676 AAGGTCACCCAACTGGTACGTGG + Intergenic
1131395563 15:92082883-92082905 AAGGTCACACAGCTTGTACATGG - Intronic
1132205250 15:99982013-99982035 GAGGTCACACAGCTAGTAAGTGG - Intronic
1132338881 15:101065737-101065759 CCGGGCACACAGCTGGTAGGTGG - Exonic
1133218346 16:4307083-4307105 AAGGTCACACAGCTTGTAAGTGG - Intergenic
1133222632 16:4325292-4325314 AAGGTCCCACAGCTTGTCCGTGG - Intronic
1133242243 16:4421830-4421852 AAGGACACACAGCTGGTAAGTGG + Intronic
1133256750 16:4521778-4521800 CAGCTCGCTCAGCTGGAAAGTGG - Intronic
1133332435 16:4982800-4982822 AAGGTCACACAGCTTGTAAGTGG + Intronic
1133428148 16:5711330-5711352 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1133590989 16:7243290-7243312 AAGGTCACACAGCTGTCACGTGG - Intronic
1134026558 16:10958382-10958404 AAGGTCACATAGCTGGTAAGCGG + Intronic
1134038621 16:11050954-11050976 AAGGTCGCTCAGCTGGTGGGTGG - Intronic
1134104051 16:11472582-11472604 AAGGTCACACAGCTGGGAAGTGG - Intronic
1134460281 16:14424180-14424202 AAGGTCCCACAGCTAGTAAGTGG - Intergenic
1134492820 16:14708365-14708387 CAGATCACACAGCTGATAAGTGG + Intergenic
1134498201 16:14747487-14747509 CAGATCACACAGCTGATAAGTGG + Intronic
1134582373 16:15381606-15381628 CAGATCACACAGCTGATAAGTGG - Intergenic
1134679291 16:16112905-16112927 GAGGTCCCATAGCTGGTAAGTGG + Intronic
1134769642 16:16796286-16796308 AAGGTCACACAGCTAGTAAGAGG + Intergenic
1134784350 16:16927562-16927584 CAAATCCCACAGCTGGTAAGTGG - Intergenic
1134819536 16:17235465-17235487 AAGGTCACACAGCTGGAAAGAGG + Intronic
1134824928 16:17276791-17276813 TAGGTCACACAGCTGGGAAGTGG - Intronic
1135046538 16:19160579-19160601 AAGGTCACACAGCTAGTAAGTGG + Intronic
1135109544 16:19680118-19680140 AAGGTCACACAGTTGGTACATGG - Intronic
1135132356 16:19863430-19863452 AAGGTCACACAGCTGGTAAGGGG + Intronic
1135173362 16:20206455-20206477 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1135195499 16:20390802-20390824 AAGGTCACACAACTGGTAAGTGG - Intronic
1135313691 16:21425656-21425678 CAGATCACACAGCTGATAAGTGG - Intronic
1135366615 16:21857936-21857958 CAGATCACACAGCTGATAAGTGG - Intronic
1135445200 16:22513222-22513244 CAGATCACACAGCTGATAAGTGG + Intronic
1135601328 16:23786231-23786253 CAGGTCACACAGCTGCTATAAGG + Intergenic
1135644122 16:24146490-24146512 AAGGTCGTACAGCTTGTATGTGG + Intronic
1135736115 16:24933079-24933101 TAGGTCACACAGCTAGTAAGGGG + Intronic
1135859626 16:26044049-26044071 CAAATCACACAGCTGGTAAGTGG + Intronic
1135928493 16:26716175-26716197 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1135941208 16:26823481-26823503 AAGGTCACACAGCTAGTAGGTGG + Intergenic
1135943878 16:26846857-26846879 GAGGTTGCACAGCTGGAAGGAGG + Intergenic
1136006448 16:27333483-27333505 CAGGTCCCACAGCTGGTAAAAGG - Intronic
1136062267 16:27734866-27734888 AAGGTCACACAGCTGGTATGTGG - Intronic
1136109910 16:28058212-28058234 AAGGTCACACAGCTAGTAAGTGG - Intronic
1136152830 16:28363379-28363401 CAGATCACACAGCTGATAAGTGG - Exonic
1136193921 16:28637761-28637783 CAGATCACACAGCTGATAAGTGG + Exonic
1136210253 16:28751894-28751916 CAGATCACACAGCTGATAAGTGG + Exonic
1136310354 16:29404359-29404381 CAGATCACACAGCTGATAAGTGG - Intergenic
1136323803 16:29506150-29506172 CAGATCACACAGCTGATAAGTGG - Intergenic
1136340891 16:29642523-29642545 ACGGTCACACAGCTGGTAAGGGG - Intergenic
1136438488 16:30246131-30246153 CAGATCACACAGCTGATAAGTGG - Intronic
1137333121 16:47520440-47520462 AAGGTCGCACATGTAGTACGTGG + Intronic
1137423881 16:48360144-48360166 AAGGTCACACAGCTGGTTAGTGG + Intronic
1137621944 16:49882020-49882042 CAGGCCACACAGCTGGCAGGTGG + Intergenic
1137711554 16:50570514-50570536 AAGGTCACACAGCTAGTAAGTGG - Intronic
1137788995 16:51158655-51158677 CAGGTCACACTGCTGGTAGGAGG - Intergenic
1138331199 16:56216832-56216854 GAGGTCCCACAGCTGTTAAGTGG - Intronic
1138384916 16:56629626-56629648 CAGGCCACACAGCCAGTACGTGG - Intergenic
1138417745 16:56880808-56880830 AAGGTCACACAGCTGGCACATGG - Intronic
1138418702 16:56885913-56885935 CAGGTCACACAGCTGGCAAGTGG + Intronic
1138497093 16:57415427-57415449 CAGGTCACACAGCTGGTCAGGGG + Intronic
1138529257 16:57626160-57626182 AAGGTCGCACAGCTTGGACCTGG - Intronic
1138547146 16:57726728-57726750 GAGGTCACACAGCTGGAAAGTGG + Intronic
1138752595 16:59441922-59441944 AAGGACACACAGCTGGTATGTGG + Intergenic
1139317148 16:66082608-66082630 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1139339525 16:66259014-66259036 CAGGTCACACAGCTGGGAAGTGG + Intergenic
1139858037 16:69996746-69996768 CAGATCACACAGCTGATAAGTGG - Intergenic
1140000439 16:71019954-71019976 AAGGTCTCACAGCTAGTAAGTGG - Intronic
1140962499 16:79930057-79930079 AAGCTCACACAGCTGGTACAAGG - Intergenic
1141094136 16:81150721-81150743 GAGGTCACACAGCTGGGAAGAGG - Intergenic
1141410061 16:83827102-83827124 AAGGTAGCACAGCTGGTAAGAGG + Intergenic
1141437055 16:84005887-84005909 GAGGCCACACAGCTGGTAAGTGG + Intergenic
1141604536 16:85145335-85145357 CGGGGCGCACAGCTGGTGAGAGG - Intergenic
1141764529 16:86049743-86049765 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1141889349 16:86916328-86916350 TAGGTCACACAGCTGTTATGTGG + Intergenic
1141896988 16:86964580-86964602 CAGGCCACACAGCTGGTAAGTGG - Intergenic
1142612381 17:1116357-1116379 CAGGTCACACAGTTGGCAAGAGG - Intronic
1142618541 17:1151058-1151080 AAGGTCACACAGCTGGTAAGGGG - Intronic
1142783677 17:2202817-2202839 AAGGTCACACAGCTGGCAAGTGG + Intronic
1142886582 17:2916472-2916494 AAGGTCCCACAGCTGGTGAGTGG + Intronic
1143057013 17:4170105-4170127 CAGGGGGCACAGCTGGTCTGTGG - Intronic
1143238441 17:5423119-5423141 CAGGTCATACAGCTAGTAAGTGG + Intronic
1143365622 17:6406664-6406686 AAGGTCACACAGCAGGTCCGTGG - Intronic
1143684086 17:8499965-8499987 AGGGTCACACAGCTGGTTCGTGG - Intronic
1143720408 17:8805200-8805222 AAGGTCACACAGCTAGTAAGTGG - Intronic
1144077271 17:11730556-11730578 AAGGTCACACAGCTAGTAAGTGG - Intronic
1144887870 17:18476337-18476359 CAGGTCACACAGCTAATTCGTGG - Intergenic
1144969180 17:19096467-19096489 CAGGTCACACAGCTGGAAAGTGG + Intronic
1144978736 17:19155599-19155621 CAGGTCACACAGCTGGAAAGTGG - Intronic
1144989486 17:19222633-19222655 CAGGTCACACAGCTGGAAAGTGG + Intronic
1145144343 17:20467964-20467986 CAGGTCACACAGCTAATTCGTGG + Intergenic
1145175794 17:20699367-20699389 CAGGTCACACAGCTAATTCGTGG + Intergenic
1145258025 17:21338156-21338178 AAGGTTACACAGCTGGTAAGAGG - Intergenic
1145318614 17:21749850-21749872 AAGGTTACACAGCTGGTAAGAGG + Intergenic
1145791522 17:27630748-27630770 CAGGTCACACAGCTAATTCGTGG - Exonic
1146061476 17:29609819-29609841 AAGGTCACACAGCTGTTAAGTGG + Intronic
1146268861 17:31471565-31471587 CAGGTCACCCAGCTGGGAAGTGG + Intronic
1146488665 17:33263997-33264019 AAGGTCACACAGCTGGCAGGAGG - Intronic
1146533733 17:33632083-33632105 CAGGTCACACAGCTAATAAGTGG - Intronic
1146611247 17:34306820-34306842 CAGGTCGCACAGCTGGTTTATGG - Intergenic
1146650774 17:34604937-34604959 AAGGTCACACAGCTGGAAAGAGG + Intronic
1146931185 17:36779132-36779154 AAGGTCACACAGCTGGTTTGAGG + Intergenic
1147237780 17:39070388-39070410 AAGGTCACACAGCTAGTAAGTGG - Intronic
1147305101 17:39557865-39557887 AAGGTAGCACAGCTGGTAAGTGG - Intronic
1147563061 17:41520725-41520747 CAGGTGGCACCACTGGTAAGGGG + Exonic
1147687015 17:42292256-42292278 CAAGTCACACAGCTAGTAAGTGG - Intronic
1147753313 17:42750804-42750826 CAGGTCATCCAGCTGGTAAGTGG + Intergenic
1147906311 17:43825428-43825450 AAGGTTGCACAGCTGGAAGGAGG + Intronic
1148159223 17:45440706-45440728 GAGGTCACACAGCTAGTAGGTGG + Intronic
1148228812 17:45918406-45918428 AAGGTCACACAGCTAGTAGGGGG - Intronic
1148233667 17:45952941-45952963 CAGGTCACACAGCCAGTAAGAGG - Intronic
1148358607 17:46993902-46993924 AAGGTCACACAGCTGGTCCATGG + Intronic
1148431721 17:47649076-47649098 AAGGTCACACAGCTGGTTAGTGG - Intergenic
1149554067 17:57560570-57560592 AAGGTTGCTCAGCTGGTAGGTGG - Intronic
1150323934 17:64240556-64240578 GAGGTCACACAGCTGGTGAGGGG - Intronic
1150647323 17:66987188-66987210 GAGGTCACACAGCTGCTAAGTGG + Intronic
1150788004 17:68178232-68178254 AAGGTCACACAGCTGGTCCATGG - Intergenic
1150890526 17:69144053-69144075 AAGGTCACACAGCTAGTACATGG - Intergenic
1151201474 17:72470894-72470916 AAGGTCACACAGCTAGTAGGGGG + Intergenic
1151424587 17:74022648-74022670 AAGGTCACACAGCTGGGAAGAGG - Intergenic
1151737295 17:75951762-75951784 GAGGTCACACAGCTCGTATGTGG + Intronic
1152146432 17:78571536-78571558 CCGGTCGCCCAGCTGGGACGAGG + Intronic
1152192037 17:78894251-78894273 CAGATCACACAGCTGGTAAGTGG + Intronic
1152374989 17:79914360-79914382 GAGGTCACACAGCTGGAAAGGGG + Intergenic
1152376550 17:79921563-79921585 AAGGTCACGCAGCTGGGACGTGG - Intergenic
1152383308 17:79953540-79953562 AAGGTCACACAGCTGGCAAGTGG + Intronic
1153166701 18:2269739-2269761 CAAGTCACACAGCTGGTGCATGG + Intergenic
1153189955 18:2527004-2527026 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1153848312 18:9069672-9069694 GAGGCCACACAGCTGGTAAGGGG + Intergenic
1154119484 18:11640018-11640040 CAGATCACACAGCTGATAAGTGG - Intergenic
1154259481 18:12817702-12817724 AAGGTCACACAGCTGGAACATGG + Intronic
1154301918 18:13201659-13201681 CAGGTCACACAGCTGGTAAATGG - Intergenic
1155131075 18:22934824-22934846 AAGGTCACACAGCTGGGACATGG - Intronic
1155247740 18:23925955-23925977 AAGGTCACACAGCTGGTAAGTGG - Intronic
1155408737 18:25518553-25518575 GAGGTCACACAGCTGGCAAGTGG - Intergenic
1155536689 18:26825893-26825915 AAGTTCCCACAGCTGGTAAGTGG + Intergenic
1155619989 18:27767678-27767700 CAGGTAGCACAGCTTGTACAAGG + Intergenic
1155635785 18:27953718-27953740 GAGGTCCCACAGCTAGTACTGGG - Intronic
1156521505 18:37725746-37725768 CAGGTAACACAGCTGGTAAATGG + Intergenic
1156864278 18:41871672-41871694 GAGGTCACACAGCTGGAATGTGG - Intergenic
1156994122 18:43446452-43446474 AAGGTCACACAGCTGATAAGTGG - Intergenic
1157301044 18:46479516-46479538 AAGGTCACACAGATGGTAGGTGG - Intronic
1157520737 18:48343591-48343613 AAGGTCACACAGCTGATAGGTGG - Intronic
1157548153 18:48562327-48562349 CAGGTCACACAGCTACTAAGTGG + Intronic
1157817372 18:50739687-50739709 CAGGTCTCACAGCTAGTAACTGG - Intergenic
1158649286 18:59272451-59272473 CAGCTCATGCAGCTGGTACGTGG + Exonic
1159523759 18:69561223-69561245 AAGGTTGCACAGCTAGTAAGTGG + Intronic
1160270527 18:77379450-77379472 CAGGACGCACACCTGGAACCTGG - Intergenic
1162001670 19:7748129-7748151 AAGGTCACACAGCTGGTAGATGG + Intergenic
1162003408 19:7762633-7762655 AAGGTCACACAGCTGGTAAATGG - Intergenic
1162389109 19:10378415-10378437 CAGGTGGCTCAGCTGGAAAGGGG + Exonic
1162502207 19:11060332-11060354 CAGGTCACACAGCCAGTATGTGG + Intronic
1162997036 19:14342741-14342763 CAGATCACACCGCTGGTAAGAGG + Intergenic
1163170309 19:15526609-15526631 TAGGTCACACAGCTTGTAAGTGG + Intronic
1163173847 19:15551064-15551086 CAGGACACACAGCTAGTAAGAGG + Intronic
1163306462 19:16482666-16482688 GAGGCCACACACCTGGTACGGGG + Exonic
1164208296 19:23075569-23075591 CAGGGCGCCCAGCAGGGACGCGG - Intronic
1164752612 19:30667951-30667973 AAGGTCACACAGCTGGTAATTGG + Intronic
1165312706 19:35038538-35038560 GAGGTCACACAGCTAGTAAGAGG + Intronic
1166019023 19:40008140-40008162 AAGGTCACACAGCTGGTAGGTGG + Intronic
1166545724 19:43634076-43634098 CAGGTCACACAGATGGCAAGTGG - Intronic
1167200411 19:48061464-48061486 CAGGCCACACAGCTGGTAAGTGG + Intronic
1168070288 19:53946343-53946365 CTGGTCACACAGCTAGTAAGCGG + Intergenic
1168348791 19:55663959-55663981 GAGGACACACAGCTTGTACGTGG + Intronic
1168382462 19:55935404-55935426 GAGGTCGCCCAGATGGTAGGAGG - Intergenic
1168450276 19:56461207-56461229 CAGGTCTCACAGCTAGTAAATGG + Intronic
926142418 2:10375626-10375648 CAGGTCACACAGCTGCTAACAGG - Intronic
926249518 2:11146283-11146305 AAGGTCACACAGCTGGCAAGTGG + Intronic
927136522 2:20100578-20100600 AAGGTCACACAGCTGGTTAGTGG - Intergenic
927136993 2:20104492-20104514 CAGGTCACACACCTGCTAGGTGG - Intergenic
927485472 2:23485749-23485771 GAGGTTGCACAGCTGGAAAGGGG - Intronic
927649853 2:24905849-24905871 CAGATCTCACAGTTGGTAAGTGG + Intronic
928033435 2:27800386-27800408 GAGGTCACACAGCTAGTAAGTGG - Intronic
928118231 2:28563397-28563419 CAAGTCACACAGCTGGTCAGCGG + Intronic
928132529 2:28663111-28663133 GAGGTCTCACAGCTGGTGAGTGG - Intergenic
928211939 2:29329915-29329937 CAGGCCCCACACCTGGTATGTGG + Intronic
928285839 2:29989347-29989369 CAATTTGCACAGCTGGTAAGTGG - Intergenic
928450233 2:31371980-31372002 CAGGCCACACAGTTGGTAAGTGG - Intronic
929316240 2:40482616-40482638 GTGGTCACACAGCTGGTAAGTGG + Intronic
929410392 2:41692550-41692572 CAAGTCGCACAGCTGGTAAAGGG - Intergenic
929654596 2:43717720-43717742 AAGGTCACACAGGTGGTAAGTGG - Intronic
929667608 2:43845363-43845385 AAGGTCACACAGCTGGTAAGTGG - Intronic
929966128 2:46538367-46538389 CAGATCACACAGCTGGTAAGTGG - Intronic
930057444 2:47262960-47262982 AAGGTCACATAGCTAGTACGTGG - Intergenic
930736756 2:54787440-54787462 CAGGCCACACAGCTGGTAAGTGG - Intronic
930901769 2:56515848-56515870 AAAGTCACACAGCTGGTATGTGG + Intergenic
931668761 2:64628200-64628222 AAGGTCACACAGCTGGCAAGTGG - Intergenic
931707026 2:64955097-64955119 CAGATCACACAGCTGGAAAGTGG - Intergenic
932018508 2:68058552-68058574 CAGGTCACAGGGCTGGTAAGTGG + Intronic
932196136 2:69785702-69785724 CAGGTCACACAGCTAGAAAGAGG + Intronic
932282555 2:70506778-70506800 AAGGTCTCACAGCTAGTAGGTGG + Intronic
932608240 2:73178223-73178245 CAGGTCACGCAGCTAGTAAGTGG - Intergenic
933750693 2:85600740-85600762 CAGGTCACACAGCTAATAAGCGG - Intronic
934084066 2:88494731-88494753 AAGGTCACACAGCTGGGAAGTGG - Intergenic
934124826 2:88878146-88878168 CAGATGGCAAAGCTGGTATGTGG + Intergenic
934721167 2:96577904-96577926 CAAATCACACAGCTGGTAAGTGG - Intergenic
935327443 2:101949455-101949477 CAGGTCACACAGCTAGCAAGTGG + Intergenic
935580793 2:104754559-104754581 CTGGTCGCACAGCTGGTCATGGG - Intergenic
937238238 2:120443264-120443286 GAGGTCGCACAGCGAGTAAGTGG - Intergenic
937273566 2:120670543-120670565 AAGGTCACACAGCTGGTCAGCGG + Intergenic
937303178 2:120855788-120855810 GAGGTCCCACAGCTGGTAAGGGG + Intronic
937355526 2:121195981-121196003 AAGGTCACACAGCTTGTAAGTGG + Intergenic
938054962 2:128208082-128208104 CAGGCCGCACAGCAGGAGCGGGG - Intergenic
938678993 2:133670113-133670135 CAAGTCACAGAGCTGGTAAGGGG - Intergenic
941413953 2:165195292-165195314 CAGGTGGCACACCTGGCACACGG - Intronic
941471151 2:165888937-165888959 AAGGTCACACAGCTAGTAAGTGG + Intronic
941617081 2:167733009-167733031 AAGGTTACACAGCTGGTAAGTGG + Intergenic
941746139 2:169088668-169088690 AAGGTCACCCAGCTGGTAAGTGG + Intronic
942033831 2:171991212-171991234 AAGGTCACACAGCTAGTAAGTGG + Intronic
942128840 2:172857226-172857248 AAGGTCATACAGCTGGTAAGTGG + Intronic
942205473 2:173616000-173616022 CAAGTCACACAGCAGGTAAGTGG + Intergenic
942386136 2:175445110-175445132 AAGGTCACACAGCTGGTAAGTGG - Intergenic
942881388 2:180865383-180865405 AAGGTCACACAGCTAGTAAGTGG - Intergenic
942990993 2:182202530-182202552 CCAGTCACACAGCTGGTACATGG + Intronic
944384999 2:199154295-199154317 GAGGTCGCACAGCTCATACATGG - Intergenic
944540951 2:200753015-200753037 AAGGTCACACAGCTAGTAAGTGG - Intergenic
944625732 2:201566988-201567010 AAGGTCTTACAGCTGGTAAGTGG + Intronic
944654977 2:201868362-201868384 CCGGTCACACAGCTGGTAAGAGG + Intronic
944692127 2:202167979-202168001 AAGGTCACACAGCTAGTAAGTGG - Intronic
944836454 2:203584919-203584941 AAGGTCACACAGCTAGTAAGTGG - Intergenic
944895679 2:204161475-204161497 AAGGTCACAGAGCTGGTAAGTGG + Intergenic
944987169 2:205190607-205190629 CAGGTCACACAGCTGGCCAGGGG - Intronic
945265937 2:207891449-207891471 AAGGTCACACAGCAGGTAAGGGG + Intronic
946175901 2:217921913-217921935 AAGGTCACACAGCTGATAAGTGG + Intronic
946441005 2:219695936-219695958 AAGGTCACACAGCTAGTAAGTGG + Intergenic
946766667 2:223046920-223046942 CAGATCACACAGCTAGTACATGG - Intergenic
947831559 2:233145257-233145279 GAGGTCGCACAGCTAGTAAATGG - Intronic
947831980 2:233147922-233147944 CAGGTCACACAGCTGCTAAGTGG - Intronic
947862697 2:233373112-233373134 CAGGTCACAAAGCTGGAAAGTGG + Intronic
948305431 2:236943884-236943906 CAGGACACACAGCTGGTTTGAGG + Intergenic
948328151 2:237142874-237142896 GAAGTCACACAGCTGGTAAGTGG - Intergenic
948337420 2:237221448-237221470 CAGGTCACACAGCTGGTAGCGGG + Intergenic
948637934 2:239352104-239352126 GAGGTCACAGAGCTGGTAGGTGG - Intronic
948752084 2:240138701-240138723 AAGGTCACACAGCTGGTTAGGGG - Intergenic
1169248438 20:4042178-4042200 AAGGTCACACAGCTGGCAAGCGG - Intergenic
1170201815 20:13752298-13752320 GAAGTCACACAGCTGGTAAGTGG - Intronic
1170603077 20:17856389-17856411 AAGGTCACACAGCTGGTTAGAGG + Intergenic
1171070189 20:22061144-22061166 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1172038045 20:32024090-32024112 AAGGTCACACAGCTGGTAAGTGG + Intronic
1172121219 20:32599924-32599946 AAGGTCACACAGCTGGTGAGTGG - Intronic
1172161535 20:32872233-32872255 AAGGTCACACAGCTGGTAAGTGG - Intronic
1172328632 20:34057907-34057929 AAGGTCACACAGCTAGTAAGTGG + Intronic
1172357951 20:34292698-34292720 AAGGTCACACAGCTGGCAAGTGG - Intronic
1172610028 20:36243829-36243851 AAGGTCACACAGCTGCTAAGTGG + Intronic
1172828794 20:37814097-37814119 AAGGTCACACAGCTAGTACCTGG + Intronic
1172899418 20:38323585-38323607 AAGGTCACACAGCTGGTAAGTGG - Intronic
1172980783 20:38939965-38939987 AGGGTCACACAGCTGGTAGGTGG + Intronic
1173151311 20:40568544-40568566 CAGGTAGCAAAGCTGGGATGTGG - Intergenic
1173260176 20:41427508-41427530 AAGGTCACACAGCTGGCAAGTGG + Intronic
1173327910 20:42050406-42050428 AAGGTCACACAGCTTGTAAGGGG + Intergenic
1173609643 20:44357219-44357241 AAGGTCACACAGCTGGTGTGTGG - Intronic
1173610345 20:44362801-44362823 AAGGTCACACAGCTAGTAGGTGG - Intronic
1173736339 20:45364095-45364117 CAGGTCACACAGCTAGTAAGTGG - Intronic
1173884449 20:46445308-46445330 CAGCTTCCACAGCTGGTACTGGG + Intergenic
1173999358 20:47363031-47363053 AAGGCCGCACAGCTGGCAAGTGG - Intergenic
1174058456 20:47815833-47815855 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1174121517 20:48269278-48269300 AAGGTCACACAGCTGGCACAGGG - Intergenic
1174304833 20:49607807-49607829 AAGGTTGCACAGCTTGTAGGTGG + Intergenic
1174344012 20:49916108-49916130 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1174375107 20:50121382-50121404 AAGGTCACACAGCTGGTAGGTGG - Intronic
1174389313 20:50208092-50208114 GAGGTCACACAGCTGGTGGGTGG + Intergenic
1174399315 20:50267492-50267514 AAGGTCACACAGCTGGGATGTGG + Intergenic
1174519801 20:51120687-51120709 GAGGTCACACAGCTGGTGAGTGG + Intergenic
1174580455 20:51567809-51567831 AAGGTTGCACAGCCGGTAAGTGG - Intergenic
1174741731 20:53020894-53020916 GAGGTCACATAGCTGGTAAGTGG - Intronic
1174857134 20:54056983-54057005 AAGGTCACACAGCTAGTACGTGG + Intronic
1175194350 20:57232151-57232173 AAGGTCACACAGCTGGTAAGTGG - Intronic
1175538434 20:59732282-59732304 AAGGTCACACAGCTGGTAAATGG - Intronic
1175597823 20:60249529-60249551 CAGGTCCCAGAGCTGCTATGTGG + Intergenic
1175612504 20:60363554-60363576 CAGGTCACACAGCTTGTCAGTGG + Intergenic
1176973901 21:15296702-15296724 GAGGTCACACAGCAGGTAAGTGG + Intergenic
1178250475 21:30999010-30999032 GAGGTCACACAGCAGGTAAGTGG - Intergenic
1178811100 21:35882209-35882231 CAGGTCACCCAGCTGGTAAGGGG - Intronic
1179424905 21:41268253-41268275 CAGATCACACAGCTTGTATGTGG + Intronic
1179976788 21:44873079-44873101 GAGGTCGCACAGCTGGTCGGGGG - Intronic
1180203891 21:46244952-46244974 CAGGTCACACAGCTGTTCAGAGG + Exonic
1180308414 22:11148921-11148943 GATGTCGCACAGCTGGTAAATGG + Intergenic
1180546891 22:16510734-16510756 GATGTCGCACAGCTGGTAAATGG + Intergenic
1180620344 22:17157847-17157869 AAGGGCACACAGCTGGTAAGTGG - Intronic
1180815516 22:18787081-18787103 GAGGTCACACAGCTGGGAGGTGG - Intergenic
1181201706 22:21221416-21221438 GAGGTCACACAGCTGGGAGGTGG - Intronic
1181674543 22:24443059-24443081 CAGGTCACACAGCTAGTAAGTGG + Intergenic
1181683314 22:24511111-24511133 CAAGTCCCACAGCTGGCAAGTGG + Intronic
1181700051 22:24615555-24615577 GAGGTCACACAGCTGGGAGGTGG + Intronic
1181747017 22:24962509-24962531 AAGGCCACACAGCTGGTAAGCGG - Intronic
1181873203 22:25919354-25919376 CAGATCACACAGCTAGTAAGTGG - Intronic
1181915441 22:26276035-26276057 GAGGTGTCACAGCTGGTAAGTGG - Intronic
1182086166 22:27562735-27562757 CAGGTCACACAGCTGATACGTGG + Intergenic
1182107261 22:27698355-27698377 AAGGTCTCACAGCTGCTAAGTGG + Intergenic
1182176638 22:28296872-28296894 CAAGTCACACAGCTAGTAAGTGG + Intronic
1182958779 22:34452767-34452789 AAGGTCCCACAGCTAGTAAGTGG + Intergenic
1183014116 22:34971915-34971937 CAGGTCACACAGCTGGCTCATGG - Intergenic
1183716559 22:39536619-39536641 CAGGTCACACATCTGCTAAGCGG - Intergenic
1183727986 22:39600048-39600070 CAGGTCACACAGCAGATAAGTGG - Intronic
1183903165 22:41021531-41021553 GAGGTCGCACAGATGGTGGGTGG + Intergenic
1184087810 22:42275720-42275742 CAGGTCACACAGCTAGGAAGAGG + Intronic
1184474321 22:44712344-44712366 CAGGTTCCACAGCTGGTGCTTGG - Intronic
1185059815 22:48600392-48600414 CATGTCCCAGAGCTGGTGCGAGG - Intronic
1185215728 22:49599009-49599031 TGGATCGCACAGCTGGTAGGAGG - Intronic
1203225208 22_KI270731v1_random:74012-74034 GAGGTCACACAGCTGGGAGGTGG + Intergenic
1203265619 22_KI270734v1_random:12772-12794 GAGGTCACACAGCTGGGAGGTGG - Intergenic
949454420 3:4223857-4223879 CAGGTCGCACAGTTGGTATTTGG - Intronic
949569446 3:5278036-5278058 AAGGTCGCACAGCTGGCTTGTGG + Intergenic
950079693 3:10212504-10212526 GAGGTCCCACAGCTGGTCAGTGG - Intronic
950124448 3:10502904-10502926 AAGGTCACACAGCTGGCATGTGG - Intronic
950131361 3:10549096-10549118 CATGTCACACAGCTGGCACATGG - Intronic
950143729 3:10633126-10633148 AAGGTCACACAGCTGGGAGGTGG - Intronic
950427564 3:12932726-12932748 CAGGTCCCACAGCTGATAGGTGG + Intronic
950529959 3:13547752-13547774 AAGGTCACACAGCTGGTGTGTGG + Intergenic
951109075 3:18779899-18779921 AAGGTCACACAGCTAGTACTTGG - Intergenic
951114331 3:18842160-18842182 AAGGTCACATAGCTTGTACGTGG + Intergenic
951542305 3:23793565-23793587 AAGGTCAAACAGCTGGTAAGAGG - Intergenic
951694031 3:25427419-25427441 CAGAACACACAGCTGGTAAGTGG + Intronic
951871252 3:27364984-27365006 AAGGTCCCACAGCTGGTAAGTGG + Intronic
951890022 3:27559826-27559848 CAGGTCACGCAGCTGGTGAGTGG + Intergenic
952028716 3:29115008-29115030 CAAGTCACATAGCTGGTAAGTGG + Intergenic
952083688 3:29792557-29792579 CAGGTCATACAGCTAGTAAGTGG - Intronic
952234535 3:31465051-31465073 AAGGTCACACAGCTGATAAGTGG - Intergenic
952916597 3:38250379-38250401 AAGGTCACACAGCTGGAAAGAGG + Intronic
952995327 3:38875112-38875134 CAGGTCATACAGCTGATAAGTGG + Intronic
953271873 3:41453652-41453674 AAAGTCACACAGCTGGTAAGTGG + Intronic
953414305 3:42706902-42706924 AAGGCCACACAGCTGGTAAGTGG + Intronic
953419770 3:42745401-42745423 AAGGTCACACAGCTGGTGAGTGG + Intronic
953908572 3:46881104-46881126 CAGGACACACAACTGGTAAGCGG + Intronic
954451196 3:50572608-50572630 AAGGTTGCACAGCTGATACCAGG - Intronic
954985748 3:54790152-54790174 CAGATGGCACAGCTGCTAAGTGG - Intronic
955106954 3:55907697-55907719 AAGGTCACACAGCTGGTAAGTGG - Intronic
955231693 3:57105073-57105095 AAGGCCGCACAGCTAGTAAGTGG - Intronic
955350474 3:58189730-58189752 GAGGTCCCACAGCTGGTAGGTGG + Intergenic
955537525 3:59940060-59940082 CAGGTCCCACAGCTGGAAAGTGG - Intronic
955777193 3:62446494-62446516 AAGGTCACACAGCTTGTAAGTGG - Intronic
955829468 3:62985890-62985912 TAGGTCACACAGCAGGTACTTGG + Intergenic
956100476 3:65762809-65762831 AAGGTCACACAGCTAGTAAGTGG + Intronic
956112074 3:65879816-65879838 CAAGTCACACAGCTGATAAGTGG + Intronic
956703198 3:71976960-71976982 TAGGTCACACAGCTGGTAGCAGG - Intergenic
956798061 3:72733685-72733707 AAGGTCACAGAGCTGGTAGGCGG + Intergenic
956875628 3:73459868-73459890 CAGGTCACCCAGCTAATACGTGG + Intronic
959095599 3:101952180-101952202 AAGATCTCACAGCTGGTAGGTGG + Intergenic
959606981 3:108251554-108251576 AAGGTCACACAGCTGGTATGTGG + Intergenic
960166995 3:114413824-114413846 AAGGTCACACAGCTGGTAAATGG + Intronic
960618875 3:119620504-119620526 CTGATCACACAGCTGGTAAGTGG - Intronic
961098771 3:124180546-124180568 AAGGTCACACAGCTGATAAGTGG - Intronic
961538922 3:127587521-127587543 CAGGTCACACAGCAAGCACGTGG - Intronic
961823174 3:129585633-129585655 CAGGTCGCACAGCTAGGGAGTGG - Intronic
962368355 3:134800904-134800926 AAGGTCACACAGCTAGTAAGTGG + Intronic
962829183 3:139124546-139124568 AAGGTCCCACAGCTGGTAAGTGG - Intronic
963004083 3:140709948-140709970 AAGGTCACACAGCTTGTAAGTGG + Intergenic
963054918 3:141178487-141178509 AAGGTCACACAGCTAGTAAGTGG + Intergenic
963065949 3:141264734-141264756 GAGGTCACATAGCTGGTAAGTGG - Intronic
964159607 3:153630999-153631021 AAGGTCACACAGCTGGTAAGTGG - Intergenic
964384159 3:156129549-156129571 CAGGTCACACAGATTGTAAGGGG - Intronic
964830198 3:160875753-160875775 CAGGTCACATAGCTGGTAGCTGG + Intronic
964846960 3:161054659-161054681 AAGGTCACACAGCTAGTAAGGGG - Intronic
965727988 3:171739779-171739801 AAGGTCACACAGCTGGTAAGTGG + Intronic
966138670 3:176730212-176730234 AAGGTCACACAGCTTGTAAGTGG + Intergenic
966310552 3:178588950-178588972 CAGGTCACACAGCTATTAAGTGG + Intronic
966807849 3:183820311-183820333 CAGGTCCCAGAGCTGGAAGGTGG + Intronic
966886967 3:184382194-184382216 AAGGTCACACAGCTAGTAAGTGG + Intronic
967084824 3:186085147-186085169 CACGTCTCACAGCTGGTCAGTGG + Intronic
967335294 3:188337354-188337376 CAGGTCCCTCAGCTGGGACTTGG + Intronic
967493885 3:190121700-190121722 AAGGTCACACAGCTGGTAAACGG - Intronic
968279612 3:197466393-197466415 AAGCTCACACAGCTGGTAAGAGG - Intergenic
969101259 4:4769900-4769922 AAGGGCACACAGCTGGTACATGG - Intergenic
969200814 4:5604012-5604034 AAGGTCACAAAGCTGGTACATGG - Intronic
969274001 4:6122816-6122838 GAGGTCACACAGCTAGTAAGTGG - Intronic
969429233 4:7144668-7144690 GAGGTCACACAGCTAGTAAGTGG + Intergenic
969578179 4:8048521-8048543 CAGGTCACACAGCTGGGAGGAGG + Intronic
969587079 4:8100340-8100362 AAGGTCACACAGCTGGGAAGTGG - Intronic
969635634 4:8368120-8368142 CAGGCCGCACAGGTGGCACGTGG + Intronic
970131338 4:12875191-12875213 GAGGTCACACAGCTAGTAAGTGG - Intergenic
971194821 4:24462528-24462550 AAGGTCACACAGCTAGTAAGTGG - Intergenic
971299624 4:25430979-25431001 AAGGTCTCACAGCTGCTAAGTGG - Intergenic
972629031 4:40827643-40827665 AAGGTCACACAGCTAGTAAGTGG - Intronic
973661707 4:53114047-53114069 AAGGTCACACAGCTAGTAAGTGG - Intronic
973699017 4:53518674-53518696 AAAGTCACACAGCTGGTAAGTGG + Intronic
974400845 4:61403817-61403839 TAGGACACACAGCTGGTACCTGG + Intronic
974886410 4:67823443-67823465 AAGGTCACATAGCTGGTAAGTGG - Intronic
975645531 4:76542302-76542324 AAGGTCACACAGCTAGTAAGTGG + Intronic
975870525 4:78775369-78775391 AAGGTCACACAGCTGGCTCGTGG - Intergenic
975883353 4:78937704-78937726 CAGGTCTCAGAGCTGTTAAGTGG + Intronic
976140016 4:81981449-81981471 CAAGTGACACAGCTGGTAAGTGG - Intronic
976428211 4:84930494-84930516 AAGGTCACAAAGCTAGTACGTGG + Intronic
977295020 4:95200464-95200486 TAGGTCACACAGCTGTTAAGTGG - Intronic
978022031 4:103826224-103826246 AAGGTCACACATCTGGTAAGTGG - Intergenic
978646199 4:110934712-110934734 CAAGTCACACAGCTGGTATGTGG + Intergenic
980616959 4:135240925-135240947 AAAGTAGAACAGCTGGTACGTGG + Intergenic
981073197 4:140566954-140566976 AAGGTCACACAGCTGGGAGGGGG - Intronic
982189063 4:152834933-152834955 CAGCTGGCACAGCTGGGATGTGG + Intronic
982231623 4:153213206-153213228 CAAGCCGCACAGCTGGTCAGGGG + Intronic
983519106 4:168688317-168688339 TAGGTCTCACAGCTGGTCAGAGG + Intronic
984943475 4:184953558-184953580 CAGGTCACACAGCAAGTAAGTGG + Intergenic
986663655 5:10081371-10081393 AAGGTAGCATAGCTGGTAAGTGG - Intergenic
986746931 5:10753262-10753284 CAAATCGCACAGCTGGCAAGCGG + Intronic
987135522 5:14896371-14896393 AAGGTCACACAGCTGGTAAGAGG - Intergenic
987290163 5:16501277-16501299 CAGGTCACCCAGCTAGTACCTGG + Intronic
987332171 5:16866939-16866961 CAGGTCGGGCAGCTGGCAGGAGG - Intronic
987785792 5:22496979-22497001 AAGATCACACAGCTGGTAAGTGG - Intronic
988166577 5:27597875-27597897 CAGGTCACACAGCCAGTACATGG + Intergenic
988715248 5:33820100-33820122 CAGGTGGCACAGCTGAAACCTGG - Intronic
988730786 5:33970612-33970634 AAGGTCACACAGCTGGTTAGTGG - Intronic
989096655 5:37788200-37788222 CAGGTCGAACAGCTGAAAAGAGG - Intergenic
989140056 5:38193096-38193118 AAGGTCACACAGCTAATACGTGG + Intergenic
989164357 5:38420099-38420121 AAGGTCACACAGCTAGTAAGTGG + Intronic
989197124 5:38726483-38726505 CAGGTCACACATCTGGCAGGTGG - Intergenic
989242555 5:39217638-39217660 CAAGGCCCACAGCTGGTGCGTGG + Intronic
990294608 5:54387933-54387955 AAGGTCACACAGCTAGTAAGTGG - Intergenic
991127719 5:63086413-63086435 CAGGTCACACAGCTAGTAGGTGG - Intergenic
991254545 5:64599787-64599809 CAGGGTGCAAAGCTGGTAGGTGG - Intronic
991617664 5:68513837-68513859 AAGGTCACACAGCTGGTAAGTGG - Intergenic
992186776 5:74251922-74251944 CAGGTCTCACTGCTGGTAAGAGG - Intergenic
992193573 5:74317540-74317562 AAGGTCGCACAGCTAGTAAGTGG + Intergenic
992673020 5:79078520-79078542 AAGGTCACACAGCTGGTCAGTGG - Intronic
993369159 5:87070854-87070876 CAGGTGGCACAGCTGGCAAATGG + Intergenic
995336309 5:111003786-111003808 AAGTTCACACAGCTGGTATGAGG + Intergenic
996437458 5:123451188-123451210 GAGGTCGCACAGCTGTTTGGTGG + Intergenic
997404771 5:133636518-133636540 CAGGTTGCACAGCTCATAGGTGG - Intergenic
997424417 5:133793521-133793543 AAGGTCTCACAGCTGGAACATGG + Intergenic
997473976 5:134132151-134132173 AAGGTCACACAGCTAGTAAGTGG - Intronic
997610396 5:135211934-135211956 AGGGTCGCACAGCTGCTAGGTGG + Intronic
997736810 5:136218935-136218957 AAGGTCACACAGCTGGAAAGTGG + Intronic
998388187 5:141770409-141770431 CAAGTCACACAGCTGGTAAGTGG - Intergenic
998505857 5:142671896-142671918 GTGGTCACACAGCTGGTAAGGGG + Intronic
998602305 5:143597505-143597527 AAGGTCACACAGCTGGTGTGGGG + Intergenic
998827699 5:146120906-146120928 AAGGTCACACAGCTAGTAAGTGG + Intronic
999295915 5:150459320-150459342 CAGGTCACTCAGCTGGTTCAGGG + Intergenic
999319898 5:150607629-150607651 CAGGTCTCACAGCTGGTACGTGG + Intronic
999323621 5:150629850-150629872 AAGGTCGCACACCTGGTAAGTGG + Intronic
999364009 5:151009585-151009607 GAGGTCGCAGAGCTTGTACATGG - Intergenic
999368288 5:151037203-151037225 AAGGTCACACAGCTAGTAAGTGG + Intronic
999494562 5:152084353-152084375 GAGGTCACACAGCAGGTAAGTGG - Intergenic
999702739 5:154243043-154243065 AAGGTCACACAGCTAGTAAGTGG - Intronic
999809328 5:155113004-155113026 CAGGTCACACAGCTAGTAAGTGG - Intergenic
1000221659 5:159220209-159220231 AAGGTCACACAGCTGGTAAGAGG - Intergenic
1000258470 5:159563202-159563224 GAGGTCACATAGCTGGTAAGTGG - Intergenic
1000266370 5:159641715-159641737 CAGCTCCCACAGCTGGCACTGGG - Intergenic
1000537500 5:162497058-162497080 AAGGTCACACAGCTGGTAGGTGG - Intergenic
1000554559 5:162709573-162709595 CAAGTCCCACAGCTAGTAAGTGG + Intergenic
1001038081 5:168312391-168312413 AAGGTCGCACAGCTAGAAAGTGG + Intronic
1001309528 5:170600989-170601011 AAGGTCACACAGCTGGTAAGTGG - Intronic
1001487475 5:172129810-172129832 CAGGTCGCCCAGCTAGTAAGTGG - Intronic
1001528751 5:172447620-172447642 GAGGTCACACAGTTGGTAGGTGG + Intronic
1001555839 5:172636711-172636733 CAGGTCACACAGCTAGAAGGGGG - Intergenic
1001705105 5:173735857-173735879 AAGGTCACACAGCTAGTAAGAGG - Intergenic
1001705262 5:173737003-173737025 GAGGTCGCTCAGCAGGTCCGGGG - Intergenic
1001939390 5:175729742-175729764 CAGGTCGCAATGCTGATACTCGG - Intergenic
1002312633 5:178323911-178323933 CAGCTGGAACAGCTGGTATGTGG + Intronic
1002871328 6:1169712-1169734 CGGGTCACACAGCTGGGAAGGGG + Intergenic
1003046280 6:2735982-2736004 GAGGTCACACAGCCGGTAGGTGG + Intronic
1003728423 6:8792468-8792490 AAGGTCACACAGCTGGTAAACGG + Intergenic
1004335231 6:14758272-14758294 CAGGTCCCACAGTTTGTACTTGG - Intergenic
1004357236 6:14940661-14940683 CAGGTTGCACAGCTTGTAACTGG + Intergenic
1004742156 6:18472514-18472536 CAGGTCGTACAGCAGGTGAGTGG + Intergenic
1006381177 6:33698195-33698217 CAGGTTGCACAGCTGGGAAGTGG + Intronic
1006454926 6:34126207-34126229 AAGGTCACACAGCTAGTAAGTGG - Intronic
1006593515 6:35175895-35175917 TAGGTCACACAGCTGGTAAGGGG - Intergenic
1006609492 6:35285571-35285593 AAGGTCACACAGCTGTTAAGAGG + Intronic
1006629220 6:35419220-35419242 GAGGTAGGACAGCTGGTATGTGG + Intronic
1006906724 6:37537922-37537944 CAGCTCACACGGCTGGTAAGAGG - Intergenic
1007308465 6:40925728-40925750 CAGGTCGATCAGCTGGGAAGAGG - Intergenic
1007437698 6:41827912-41827934 AAGGTTGCACTGCTGGTACATGG + Intronic
1007947452 6:45839054-45839076 AAGTTCTCACAGCTGGTAAGGGG + Intergenic
1008481616 6:51992042-51992064 CAGGACCCACAGCTGGAAAGTGG - Intronic
1010155685 6:72789733-72789755 TAGGTCACACAGCTGGTGAGTGG + Intronic
1010209456 6:73351640-73351662 CAGGTCTCAGGGCTGGGACGGGG + Intergenic
1010587132 6:77666625-77666647 GAGGTCACATAGCTGGTAAGGGG + Intergenic
1010885212 6:81228761-81228783 CAGGTAGTACAGCTAGTAAGAGG - Intergenic
1011226105 6:85108998-85109020 AAGGTCACACAGCTGGTTAGTGG - Intergenic
1012313993 6:97762395-97762417 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1015361263 6:132341918-132341940 CAGGTCACACAACTAGTAAGGGG - Intronic
1015426340 6:133072885-133072907 CATGTCTCACAGCTAGTAAGAGG + Intergenic
1015571244 6:134623506-134623528 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1016287189 6:142486389-142486411 CAGATTGCACAACTGGTAAGTGG - Intergenic
1017440636 6:154461531-154461553 AAGGTCACACAGCTGGGAAGTGG - Intronic
1017516193 6:155157681-155157703 AATGTCACACAGCTGGTAAGTGG + Intronic
1017749597 6:157479152-157479174 AAGGTCACACAGCTGGTTAGTGG - Intronic
1021619911 7:22541251-22541273 AAAGTCCCACAGCTGGTATGTGG - Intronic
1022257287 7:28671747-28671769 AAGGTCACACAGCTGGCACGTGG - Intronic
1022291703 7:29010933-29010955 AAGGTCATACAGCTGGTACATGG + Intronic
1022394200 7:29971176-29971198 CAGGTCACACAGCTAGTAGGTGG - Intronic
1022487464 7:30790839-30790861 CAGGTGACACAGTTGGTAGGTGG + Intronic
1023254004 7:38294951-38294973 CAGGTCACACAGCTGGTTCATGG - Intergenic
1023552646 7:41386492-41386514 AAGGTCACACAGCTGGTTAGAGG - Intergenic
1024583508 7:50820896-50820918 AAAGTCACACAGCTGGTAAGTGG + Intergenic
1024971197 7:55072379-55072401 CAAGTCCCACAGCTGGTAAGTGG - Intronic
1024993925 7:55256349-55256371 GAGGTCACACAGCTGGCATGTGG - Intronic
1029515495 7:101020733-101020755 CAGGGTGCACAGCTGGTTCATGG - Intronic
1029624263 7:101709959-101709981 AAGGTCTCACAGCTGGTAAATGG - Intergenic
1029844178 7:103396097-103396119 AAGATCACACAGCTAGTACGTGG + Intronic
1030112951 7:106042028-106042050 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1030273631 7:107696289-107696311 AAGATCACACAGCTAGTACGTGG + Intronic
1031680554 7:124668236-124668258 AAGTTCACACAGCTGGTACATGG - Intergenic
1032451935 7:132039122-132039144 CAGGTCACACAGCTAGTAGGTGG + Intergenic
1033310714 7:140259980-140260002 CAGTTCTCACAGCAGGTAGGAGG + Intergenic
1033494252 7:141877607-141877629 CAGGTGGAACAGCTGCCACGAGG - Intergenic
1034493836 7:151408854-151408876 CAGGTCGCACAGCCAGTGAGGGG - Intronic
1035768677 8:2129281-2129303 CAGGGCGCACAGCTGGGACCAGG + Intronic
1036410001 8:8491069-8491091 CAGGTCACAGAGCTAGTAAGTGG + Intergenic
1037436017 8:18864262-18864284 AAGGTCACACAGATGGTAAGTGG - Intronic
1037492274 8:19407604-19407626 CAGGCCTCACAGCAGGTAAGAGG - Intronic
1037561440 8:20078386-20078408 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1037610142 8:20469156-20469178 GAGGTCACACAACTGGTAGGTGG - Intergenic
1037645772 8:20791494-20791516 AAGGTCACACAGCTGGTAGTTGG - Intergenic
1037725313 8:21478508-21478530 CAGATCTCACAGCTGGTAAGTGG + Intergenic
1038061225 8:23915416-23915438 AAGGTCACACAGCTGGCAAGTGG - Intergenic
1038590455 8:28832600-28832622 AAGGTCGCACAGCTAGTGAGTGG - Intronic
1039342308 8:36664385-36664407 CAGGTCAAAGAGCTGGTAAGAGG - Intergenic
1039936928 8:42052782-42052804 AAGGTCACACAGCTAGTATGTGG + Intergenic
1040907720 8:52486037-52486059 AAGGTTGCACAGCTGGTGAGTGG - Intergenic
1040949894 8:52927042-52927064 AAGGTTGCACAGCTAGTAAGTGG + Intergenic
1042474101 8:69225816-69225838 AAGGTCCCACAGCTGGTAAATGG - Intergenic
1044865416 8:96565985-96566007 AAGATCACACAGCTGGTACGTGG - Intronic
1044950355 8:97429994-97430016 AAGGTCACACAGCTGGTTGGTGG - Intergenic
1045472934 8:102528475-102528497 CAAACCGCACAGCTGGTAAGTGG + Intergenic
1047111516 8:121794459-121794481 CAAGTCACACAGCTGATAAGTGG + Intergenic
1047307499 8:123664789-123664811 CAGGTCACACAGCTGGTAAGTGG - Intergenic
1047757728 8:127931596-127931618 CAGATCACACAGCTGGAAAGTGG + Intergenic
1047961527 8:130015458-130015480 AAGGTCACACAGCTAGTAAGCGG + Intronic
1047963233 8:130026061-130026083 AAGGTCACACAGCTAGTAAGGGG + Intergenic
1048295296 8:133209553-133209575 CAGGGCACACAGCTGGTGAGGGG - Intronic
1048335482 8:133499127-133499149 GAGGTCACACAGCCGGTAAGTGG - Exonic
1048352747 8:133629297-133629319 CAGGTTACACAGCTGGGAAGGGG - Intergenic
1048801019 8:138193847-138193869 CAGGTCCCACAGCTGCTCCAAGG + Intronic
1048819567 8:138368351-138368373 AAGGTCACACAGCTGGAAAGCGG - Intronic
1048866744 8:138767043-138767065 AAGGTCACACAGCTGGAGCGTGG - Intronic
1049013218 8:139901802-139901824 TAGGTCACCCAGCTGGTCCGTGG - Intronic
1049245160 8:141558509-141558531 GAGGTCGCACAGCTGGCCTGTGG + Intergenic
1049245290 8:141559180-141559202 GAGGTCACACAGCTGGTCCGTGG - Intergenic
1049653749 8:143788776-143788798 CAGTGCTCACAGCTGGTGCGTGG - Intergenic
1051220012 9:14838039-14838061 CAGGGAGCACAGCTTGTAGGTGG + Intronic
1051360823 9:16280223-16280245 CAGATTGCACAGCTGGAAAGAGG + Intergenic
1051529586 9:18085273-18085295 AAGATCGCACAGCTGGTAAGTGG - Intergenic
1051540940 9:18216893-18216915 TAGGCCACACAGCTGGTAAGGGG - Intergenic
1051707149 9:19892795-19892817 AAGGTCACACAGATGGTAAGTGG + Intergenic
1052875039 9:33552983-33553005 AAGGTCGCACAGCTAGTATCTGG + Intronic
1053256576 9:36621527-36621549 AAGGTCACACAGCTAGTAAGAGG + Intronic
1053293078 9:36894915-36894937 AAGGTCACACGGCTGGTAAGTGG - Intronic
1053294657 9:36904001-36904023 AAGGTCACACAGCTTGTAAGTGG - Intronic
1053299864 9:36941402-36941424 CAAATCACACAGCTGGTAAGAGG - Intronic
1053422495 9:37988262-37988284 AAGGTCACACAGCTGGTGAGCGG - Intronic
1054728079 9:68672791-68672813 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1054814463 9:69461680-69461702 CAGGTCACACAGCTGTGAAGTGG + Intronic
1056193794 9:84209818-84209840 AAGGTCACACAGCTGGTAAGTGG + Intergenic
1056910577 9:90696555-90696577 CAGGTCACACAGCTGGCTAGTGG - Intergenic
1057305148 9:93907929-93907951 GAGGTTGCACAGCTGGTGAGTGG - Intergenic
1057745085 9:97745096-97745118 AAGGTCACACAGCTGGTGAGTGG + Intergenic
1058163070 9:101591466-101591488 AAAGTCGCCCAGCTGGTAAGTGG - Intronic
1058766696 9:108188903-108188925 CAGGTCACATAGCTGGGACATGG - Intergenic
1059206328 9:112469745-112469767 AAGGTCACACAGCTTGTATGAGG - Intronic
1059247517 9:112861465-112861487 CAGGCCACACACCTGGTAAGTGG + Intronic
1059404951 9:114093737-114093759 CAGGTGACACAGCTAGTAGGTGG + Intronic
1059459916 9:114423194-114423216 CAAGGCACACAGCTGGTAAGTGG + Intronic
1059685146 9:116627956-116627978 AAGGTCACAGAGCTGGTAAGTGG + Intronic
1059695637 9:116727749-116727771 AAGGTCACACAGCTAGTAAGTGG - Intronic
1059704661 9:116810383-116810405 GAGGTCACACAACTGGTAAGTGG - Intronic
1059742167 9:117162584-117162606 AAGATCTCACAGCTGGTATGTGG - Intronic
1059761889 9:117345530-117345552 AAGGTCACACAGCTGATAGGTGG + Intronic
1059798805 9:117728925-117728947 CAGGTCACACAGCTTCTATGTGG - Intergenic
1059990007 9:119856005-119856027 AAGGTCACACAGCTGGTAAATGG + Intergenic
1060191206 9:121594189-121594211 TAGGTCACACAGCTGGCAAGTGG + Intronic
1060250864 9:121986015-121986037 AAGTTCGCACAGCTGGGAAGAGG + Intronic
1060276535 9:122186972-122186994 AAGGTCACACAGCTGGTGAGTGG - Intronic
1060287627 9:122267924-122267946 AAGGTCACACAGCTAGTAAGTGG + Intronic
1060368653 9:123046504-123046526 CAGGTCTCACAGCTAGTAAGTGG - Intronic
1060400330 9:123344858-123344880 AAGGTCACACAGCTGGTAGAAGG - Intergenic
1060438166 9:123614170-123614192 AAGATCGCACAGCTGGTCAGTGG + Intronic
1060443784 9:123668550-123668572 AAGGTCACACAGCTAGTACGTGG + Intronic
1060506686 9:124203025-124203047 AAGGTCACACAGCTGATAAGTGG - Intergenic
1060556525 9:124510776-124510798 CAGGTCACACAGCTAGAAAGTGG - Intergenic
1060578176 9:124717775-124717797 AAGGTCACACAGCTGGTAAGTGG - Intronic
1060661868 9:125409251-125409273 CAAGTCGCGCAGCTGGAAAGGGG + Intergenic
1060667264 9:125439344-125439366 CAGGTCACACAGCAGGTGGGAGG - Intronic
1060674362 9:125499103-125499125 AAGGTCACACAGCTAGTAAGTGG + Intronic
1060741912 9:126104355-126104377 TAGGTCACACAGCTGGTAAGTGG - Intergenic
1061037207 9:128120507-128120529 CAGGGCACACAGCTGGGCCGTGG - Intergenic
1061067735 9:128289200-128289222 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1061086803 9:128404422-128404444 CAGATGGCACAGCTGGTGGGTGG + Intergenic
1061183550 9:129038655-129038677 AAAGTCACACAGCTGGTACTTGG - Intronic
1061227281 9:129288085-129288107 CGGGTCGCACAGCTGGGAACCGG + Intergenic
1061363034 9:130155812-130155834 CAGGTCACACAGCTGGTGACTGG - Intergenic
1061542366 9:131284394-131284416 CAGGGCCCACAGCTGGTACAAGG - Intergenic
1061627342 9:131848798-131848820 CAGGTCTCACAGCTGACACCAGG - Intergenic
1061676369 9:132218251-132218273 GAGGTTCCACAGCTGGTAAGGGG - Intronic
1061845567 9:133386281-133386303 CAGGTTACCCAGCTAGTACGTGG + Intronic
1061857113 9:133448458-133448480 GAGGTCACACAGCTGGTAAGTGG + Intronic
1187031445 X:15492620-15492642 CAGGTCACACAGCTGATATGTGG - Intronic
1187227870 X:17391304-17391326 AAGGTCACACAGCTGGTAAGTGG - Intronic
1187294600 X:17986534-17986556 CAAGTCACACAGCTAGTAAGGGG + Intergenic
1187310112 X:18133693-18133715 GTGGTCACACAGCTGGTAAGTGG + Intergenic
1187338527 X:18401533-18401555 AAGGTCACACAGCTGGGAAGCGG + Intergenic
1188207876 X:27381495-27381517 CAGCTCCCACAGCTGGCACCAGG - Intergenic
1188696739 X:33202328-33202350 AAGGTAGCTCAGCTGGTACGTGG - Intronic
1189226929 X:39420745-39420767 AAGGTCACACAGCTGGTGAGTGG + Intergenic
1190338289 X:49276405-49276427 CAGGTCACACAGCTGATAGGTGG + Intronic
1190485022 X:50915470-50915492 AAGGACACACAGCTGGTATGTGG - Intronic
1192013463 X:67300220-67300242 CAGGTCACACAGCTGCTTCTGGG - Intergenic
1192130347 X:68543782-68543804 AAGGCCGCACAGCTAGTAAGTGG + Intergenic
1192591358 X:72362484-72362506 AAGGTCACACAGCTAGTAGGTGG - Intronic
1192627449 X:72745056-72745078 AAGGTCACACAGCTAGTAAGTGG - Intergenic
1192654259 X:72975757-72975779 AAGGTCACACAGCTAGTAAGTGG + Intergenic
1192805347 X:74503825-74503847 TAGGTCACACAGCTAGTAAGTGG - Intronic
1193610136 X:83621381-83621403 TAGGTCACACAGCTAGTAAGTGG - Intergenic
1194694064 X:97023525-97023547 AAGGTCACACAGCTAGTAAGTGG + Intronic
1194773074 X:97928554-97928576 AAGGTCACACAGCTTGTAAGTGG - Intergenic
1195320991 X:103721915-103721937 CAAGTCGCACAGCTAGTAAATGG - Intronic
1195467370 X:105194888-105194910 AAGGTCGCACAGCTAATAAGTGG - Intronic
1195561155 X:106285393-106285415 AAAGTCGCACAGCTGGTGAGTGG - Intergenic
1195598572 X:106720722-106720744 AAGGTCACACAGCTGGTAGGTGG - Intronic
1195688928 X:107608308-107608330 AAGGTCACACAGCTGGTAAATGG + Intergenic
1196187390 X:112759076-112759098 AAGGTCACACAGCTGGTAAGTGG - Intergenic
1196774697 X:119327621-119327643 AAGGCCACACAGCTGGTAAGTGG - Intergenic
1196926927 X:120642577-120642599 CAGGTCACACAGCTAGGAAGTGG - Intergenic
1197148869 X:123197783-123197805 AAGGTCTCACAGCTAGTAAGTGG - Intronic
1197681051 X:129385806-129385828 AAGGTCACACATCTGGTAAGTGG - Intergenic
1197749420 X:129954410-129954432 GAGGTCACACAGCTGGTTAGTGG + Intergenic
1197805881 X:130398152-130398174 TAGGTCACACAGCTGGTAAATGG - Intergenic
1197822312 X:130553754-130553776 AAGGTCACACAGCTGGTCAGTGG - Intergenic
1197829697 X:130628277-130628299 AAGGTCACACAGCTGGTAAGTGG + Intronic
1198320541 X:135515173-135515195 CAGGTCACATAGCTGGTAAATGG + Intergenic
1198419307 X:136453277-136453299 CATGTCACACAGCTAGTAAGTGG - Intergenic
1198683836 X:139207106-139207128 GAGGTCACACAGCTGGTACATGG + Intronic
1198891551 X:141402894-141402916 GAGGCCGCACAGCTGGTATAGGG + Intergenic
1199586112 X:149417964-149417986 AAGGTCACACAGCTTGTAAGTGG - Intergenic
1199697587 X:150353794-150353816 AAGGTCACAGAGCTGGTAAGAGG + Intergenic
1199780126 X:151050890-151050912 CAGGTCACACAGCAGCTAAGTGG - Intergenic
1201575021 Y:15454210-15454232 TAGGTCACACAGCTAGTAAGAGG - Intergenic
1202273367 Y:23091643-23091665 AAAGTCACACAGCTGGTAAGTGG - Intergenic
1202292659 Y:23329039-23329061 AAAGTCACACAGCTGGTAAGTGG + Intergenic
1202426364 Y:24725387-24725409 AAAGTCACACAGCTGGTAAGTGG - Intergenic
1202444425 Y:24944699-24944721 AAAGTCACACAGCTGGTAAGTGG + Intergenic