ID: 1089775916

View in Genome Browser
Species Human (GRCh38)
Location 11:120835703-120835725
Sequence TGAAAATCTAGCCGACTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089775913_1089775916 6 Left 1089775913 11:120835674-120835696 CCAGTGGCCCAGGGCTGCAGAAT 0: 1
1: 0
2: 2
3: 24
4: 235
Right 1089775916 11:120835703-120835725 TGAAAATCTAGCCGACTGTCAGG 0: 1
1: 0
2: 1
3: 1
4: 65
1089775912_1089775916 7 Left 1089775912 11:120835673-120835695 CCCAGTGGCCCAGGGCTGCAGAA 0: 1
1: 0
2: 1
3: 44
4: 287
Right 1089775916 11:120835703-120835725 TGAAAATCTAGCCGACTGTCAGG 0: 1
1: 0
2: 1
3: 1
4: 65
1089775915_1089775916 -2 Left 1089775915 11:120835682-120835704 CCAGGGCTGCAGAATACATTATG 0: 1
1: 0
2: 0
3: 18
4: 170
Right 1089775916 11:120835703-120835725 TGAAAATCTAGCCGACTGTCAGG 0: 1
1: 0
2: 1
3: 1
4: 65
1089775914_1089775916 -1 Left 1089775914 11:120835681-120835703 CCCAGGGCTGCAGAATACATTAT 0: 1
1: 0
2: 13
3: 82
4: 547
Right 1089775916 11:120835703-120835725 TGAAAATCTAGCCGACTGTCAGG 0: 1
1: 0
2: 1
3: 1
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089775916 Original CRISPR TGAAAATCTAGCCGACTGTC AGG Intronic
900887584 1:5426195-5426217 TGAAAAACTAGCTCACTGCCTGG - Intergenic
903845420 1:26277144-26277166 TGCAAATCTAGCTGAGTCTCTGG - Exonic
904530272 1:31164108-31164130 TGAAACTCCAGCCTAGTGTCTGG + Intergenic
910653998 1:89601390-89601412 GGAAAACCTAGCAGACTGCCTGG - Intergenic
911641810 1:100297781-100297803 TGAAAATCTTCCCCACTGGCTGG + Intergenic
913189240 1:116399632-116399654 TGCAAATCCAGGCGACTTTCAGG + Intronic
923283644 1:232469075-232469097 TGAAAATCGTGCAGCCTGTCAGG - Intronic
1063048262 10:2416335-2416357 TGAAAATGTAGCCCTCTCTCTGG + Intergenic
1063286102 10:4690392-4690414 GGAAAATCAGGCCAACTGTCAGG - Intergenic
1065411711 10:25436607-25436629 GGAAAATCCAGCCAACTATCAGG + Intronic
1068090205 10:52424264-52424286 TGAAAATCTAGGTGTCTGGCCGG - Intergenic
1069533050 10:69233019-69233041 TGAATATGTAGCTGACTGTCTGG + Exonic
1072472946 10:95731387-95731409 TGAAGATGTAGCCGACCCTCTGG + Intronic
1078904052 11:15667889-15667911 TGAGAATCTAGCCTTCTCTCTGG + Intergenic
1085259144 11:75194353-75194375 GGAAATTCTAGCCGAGTGTTGGG - Intronic
1089775916 11:120835703-120835725 TGAAAATCTAGCCGACTGTCAGG + Intronic
1093752354 12:22814836-22814858 TGAGAATCTGGCAAACTGTCAGG + Intergenic
1099768030 12:87015252-87015274 TGAAAGTCTAGGGGACTTTCTGG + Intergenic
1100404601 12:94262597-94262619 TGAAAGTATCGCCGACTGGCTGG - Intronic
1107820607 13:44282350-44282372 TGGAATTCTACCCCACTGTCAGG + Intergenic
1119834187 14:77732815-77732837 AGAAAAACTAGCCGAGTGTGTGG - Intronic
1120977646 14:90263585-90263607 TGTAAATCTAGCGAACTATCAGG + Intronic
1133624308 16:7556299-7556321 TGCAAATCTAGCAGACAATCTGG - Intronic
1146724195 17:35144368-35144390 TTAAAAGTTAGCCGAGTGTCAGG - Intergenic
1154092519 18:11378682-11378704 TGAAAATCTAGCCGGGCGTAGGG - Intergenic
1168625397 19:57914188-57914210 AGAAAACCTAGCTGTCTGTCAGG + Intronic
927322689 2:21766119-21766141 TGAAAATCAAGACAACTGTAAGG - Intergenic
928184741 2:29100386-29100408 AGAAAATCGAGCCGACAGTATGG + Intronic
931390969 2:61843566-61843588 TTTAAATTTAGCCTACTGTCTGG + Intronic
942194428 2:173503441-173503463 TGAAAAACTGGCCATCTGTCTGG - Intergenic
942515613 2:176749493-176749515 GGAAAATCTATCTCACTGTCAGG - Intergenic
943516066 2:188888663-188888685 TGAAAAGTCAGCTGACTGTCTGG + Intergenic
943532024 2:189094765-189094787 TGACAAGCTAGCAAACTGTCAGG - Intronic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
948693268 2:239720162-239720184 TGACCATCTAGGTGACTGTCTGG + Intergenic
1172102403 20:32493148-32493170 TGAAACTCTAGCTGGCTCTCCGG + Intronic
1178382265 21:32120722-32120744 TTAAAATCTATCAGACTGGCTGG + Intergenic
1179579344 21:42330567-42330589 TGGAAAGGTAGCCGACTGTAAGG - Intergenic
1183832473 22:40425681-40425703 GGGAAATCTAGCCGTGTGTCTGG - Intronic
951523651 3:23632402-23632424 TAAAAATCTAGCCAAGTGGCTGG + Intergenic
957907965 3:86582090-86582112 TGAAAAACTAGCCTAATGCCTGG + Intergenic
962307951 3:134305415-134305437 TGAAAAGAGAGCCGAATGTCTGG - Intergenic
962705089 3:138035521-138035543 TGAAAATTGAACCGACTGTGTGG - Intergenic
969154531 4:5198724-5198746 TGCAAGTCTAGCCGTCTGCCAGG - Intronic
971100074 4:23456692-23456714 AGAAAATCTCGCCCACTTTCAGG + Intergenic
977376089 4:96205722-96205744 TGAAAATCTACCAGATGGTCTGG - Intergenic
980304756 4:131044373-131044395 TGAGAAACAAGCCTACTGTCTGG - Intergenic
984019027 4:174462152-174462174 TGAAAATCTAAGGGATTGTCTGG + Intergenic
984643411 4:182195899-182195921 TGAAAATCTATCCGAGGCTCTGG + Intronic
986480207 5:8179337-8179359 TTACAATCTAGCCCACTGCCTGG + Intergenic
989469095 5:41794486-41794508 TGAATATCCAGCCCACTGTTAGG - Intronic
993398277 5:87417536-87417558 TGAAGATATAGCAGACTGGCTGG + Intergenic
1011228937 6:85138205-85138227 TGAATCTCTAGCCCAATGTCTGG - Intergenic
1012900870 6:105004564-105004586 TGAAAGTTTAGCCCATTGTCTGG + Intronic
1025173458 7:56782483-56782505 TGAAAATCAAGTCCACGGTCGGG - Intergenic
1025698644 7:63795688-63795710 TGAAAATCAAGTCCACGGTCGGG + Intergenic
1031562186 7:123251757-123251779 TGAATATCTAGCGCAGTGTCTGG - Intergenic
1031958068 7:127962712-127962734 TTGAAAACTATCCGACTGTCTGG + Intronic
1035854329 8:2958026-2958048 TGAAAATTTAGACGGCTGTTTGG + Intronic
1044396842 8:91722523-91722545 TGAAAATGTAACCGCCTGACGGG - Intergenic
1045549839 8:103161772-103161794 TGATAATCTACCCTACTGGCAGG - Intronic
1051902195 9:22055820-22055842 TCATAATGTAGCCGAGTGTCTGG - Intergenic
1054979173 9:71184068-71184090 TAAAAATCTGGCTGCCTGTCTGG - Intronic
1185513781 X:683136-683158 TGGACGTCTAGCCGACTATCTGG + Intergenic
1186194289 X:7095910-7095932 TGAAAATCTACAGGACTGTAAGG + Intronic
1187450718 X:19393735-19393757 TGAAAATCTAGCCCACTGCCTGG + Intronic
1192270300 X:69573399-69573421 TGAAAAAGTAGTCGACTGACTGG + Intergenic
1199399461 X:147380278-147380300 AAAAAATCTAGCCGTCTGTGTGG + Intergenic