ID: 1089776809

View in Genome Browser
Species Human (GRCh38)
Location 11:120843397-120843419
Sequence GGGAGAAGGAGTACATCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089776807_1089776809 -8 Left 1089776807 11:120843382-120843404 CCATGTTAGAAGACAGGGAGAAG 0: 1
1: 1
2: 21
3: 335
4: 1590
Right 1089776809 11:120843397-120843419 GGGAGAAGGAGTACATCAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089776809 Original CRISPR GGGAGAAGGAGTACATCAGC AGG Intronic
904839449 1:33362721-33362743 AGGAGGAGGAGTATCTCAGCTGG - Intronic
904880820 1:33695499-33695521 GGAAGGAGGAGAACACCAGCAGG - Intronic
905280239 1:36844380-36844402 GGAGGAAGGAGGACATCGGCTGG + Intronic
906657755 1:47561149-47561171 GGGAGAAGGAGGCATTCAGCAGG + Intergenic
907931657 1:59006623-59006645 GGGAGAAGCAGGAGATGAGCTGG + Intergenic
907965656 1:59326084-59326106 GGAAGAAGGAGAAGATAAGCTGG + Intronic
908318727 1:62960516-62960538 AGGAGAAGGAGTAGATAAGTGGG - Intergenic
908657179 1:66400676-66400698 CGGAAAAGGAGTGCATCAGGAGG + Intergenic
912049914 1:105515769-105515791 AGGATAGGGAATACATCAGCGGG - Intergenic
912389770 1:109294996-109295018 GGGAGAAGGGGTTCCTCCGCTGG - Intronic
912855662 1:113166816-113166838 GGGAGCATGAGTCCATTAGCTGG + Intergenic
912903046 1:113673386-113673408 GGGGGAAGGAGTACAACATGGGG + Exonic
913185922 1:116371161-116371183 GGGAGAAAAAGGAGATCAGCTGG + Intergenic
913440117 1:118888138-118888160 GAGAGAAGGAAGACAGCAGCTGG + Intronic
915572330 1:156751391-156751413 GGCAGAAGGAGTACAAATGCGGG - Intronic
916852074 1:168713888-168713910 GGGAGAAGGAGAACAGCACTGGG + Intronic
919423515 1:197402064-197402086 GGGATTAGGAGTACATGTGCAGG + Intronic
922386049 1:225084236-225084258 GGGATAAGGAGGCAATCAGCTGG + Intronic
923056499 1:230430003-230430025 GGGAGAAAGAGTGCAGCTGCTGG + Intergenic
1064201457 10:13288435-13288457 CGGCGATGGAGCACATCAGCCGG - Exonic
1064785149 10:18886780-18886802 GAGAGATGGAGTTCATTAGCAGG + Intergenic
1065917375 10:30364991-30365013 AGGAGGAGGAGGACATCATCAGG - Intronic
1066753429 10:38683991-38684013 GGCTCAAGGGGTACATCAGCAGG - Intergenic
1068685581 10:59867246-59867268 GAGAGAAGGGGTCCATCAGGTGG - Intronic
1070249359 10:74760471-74760493 GGAAGAAGGAGAGCATCAGGAGG + Intergenic
1074828871 10:117234388-117234410 GGGAAAAGGAGTCAATCAACAGG - Intergenic
1074950333 10:118328279-118328301 GGGAGAAGGAGTATCTAAGAAGG - Intronic
1075849958 10:125578875-125578897 CGGAAAGGGAGTCCATCAGCAGG - Intronic
1077212907 11:1381805-1381827 GAGAGAAGGAGCAGAGCAGCGGG - Intergenic
1077483627 11:2828165-2828187 GGGAGCTGGAGGACCTCAGCAGG + Intronic
1079073576 11:17368837-17368859 GAGAGAAGGAAAACATTAGCAGG - Intronic
1082673859 11:56071203-56071225 GGGAAATGGTGTAGATCAGCAGG - Intergenic
1082785240 11:57313106-57313128 GGAAGAAGGAGTGTCTCAGCAGG - Exonic
1083214627 11:61210659-61210681 GAGAGAAGGAGGACATCATCAGG - Intronic
1083217511 11:61229488-61229510 GAGAGAAGGAGGACATCATCAGG - Intronic
1083220501 11:61249238-61249260 GAGAGAAGGAGGACATCATCAGG - Intronic
1085204057 11:74719823-74719845 GGGAGCAGGAGTGGATCAGTGGG - Intronic
1086249838 11:84799330-84799352 GGGAGGAAGAGCACAGCAGCTGG - Intronic
1088644745 11:111908897-111908919 GTGAGAGGGTCTACATCAGCTGG + Exonic
1089081161 11:115777180-115777202 GGCAGTAGGCTTACATCAGCAGG - Intergenic
1089586859 11:119515112-119515134 GGGAGAGGGAGTCCAGCAACGGG + Intergenic
1089776809 11:120843397-120843419 GGGAGAAGGAGTACATCAGCAGG + Intronic
1090785405 11:130043824-130043846 GTGAGAGGCAGTGCATCAGCCGG + Intergenic
1091760293 12:3082860-3082882 GGGTCAAGGAGAACATCAGAGGG - Intronic
1092812593 12:12285690-12285712 GGGAGAAGGACAAGAACAGCTGG + Intergenic
1093935350 12:24994812-24994834 TGGAGAAGGAGTCCATTATCTGG + Intronic
1094220628 12:27989065-27989087 GGGAGAAGGAGTGAATCACAAGG + Intergenic
1096674026 12:53216993-53217015 GGGAGAAGGTGTTCATGAGGTGG - Intronic
1098694692 12:73537779-73537801 GGGGGAAAGACTACATCTGCTGG - Intergenic
1100980166 12:100157192-100157214 AGGAGGAGGAGTGCATCAGCAGG - Intergenic
1103118021 12:118354408-118354430 GCTAGAAGGAGTAGGTCAGCAGG + Intronic
1104721642 12:131047832-131047854 GGGAGAAGCAGGCCATCAGCAGG - Intronic
1104782070 12:131428394-131428416 GAGAGAAGGAGAAGAGCAGCAGG + Intergenic
1105811860 13:24002457-24002479 GGGGGAAGGAGTAGAGGAGCTGG + Intronic
1105845479 13:24290436-24290458 GCGAGAAGGGGTGCTTCAGCAGG - Intronic
1113052450 13:106228971-106228993 GGGAGAAGCAGAACATGAGTGGG + Intergenic
1113179852 13:107612522-107612544 GGGAGAATGAGTAGAACAGCTGG + Intronic
1113253827 13:108485642-108485664 GGGAGAGGGAGTACAGAAACTGG + Intergenic
1113255506 13:108500553-108500575 GGAAGAAGGAGAAAAACAGCAGG - Intergenic
1114579691 14:23746232-23746254 GGGGGAAGGAGTGAATCAGGAGG - Intergenic
1114582511 14:23775432-23775454 GGAAGAAGGAGGAAAGCAGCAGG + Intergenic
1116098149 14:40399001-40399023 GGGAAAAGGAGTACACCTACAGG + Intergenic
1118478282 14:66139557-66139579 GGGAGAAGGAGTCCAGCACAGGG + Intergenic
1202866198 14_GL000225v1_random:119564-119586 TGGAAAAGAAGTACATCACCTGG - Intergenic
1125554561 15:40573528-40573550 TGGAGAAGGAGTACGTGTGCCGG + Exonic
1126106710 15:45151624-45151646 GGTAGATGGAGTACATCCCCTGG + Intronic
1127035011 15:54906241-54906263 AGGAGAAGGAGGAAATCTGCTGG + Intergenic
1127698013 15:61470720-61470742 GGGAGGAGGAGTTGATGAGCTGG - Intergenic
1127772556 15:62243291-62243313 GGGAGAATGAGTACATAAGCAGG - Intergenic
1128183650 15:65625906-65625928 GGGTGAAGGAGCAGCTCAGCAGG + Exonic
1129476284 15:75786390-75786412 AGGAGAAGGAAGACATCATCAGG + Intergenic
1132270585 15:100520491-100520513 GTGAGAAGGAGCAGTTCAGCGGG - Intronic
1132426735 15:101724316-101724338 GGCAGGAGGAGGACATCCGCTGG - Exonic
1133335500 16:5004381-5004403 GGGAGTGCGAGCACATCAGCCGG + Intronic
1134675146 16:16085186-16085208 GGGAGATGGAGCACAGCAGGAGG - Intronic
1134823034 16:17261991-17262013 GGGAAAAGAGGAACATCAGCAGG - Intronic
1136376158 16:29866348-29866370 GGGAGAAGCAGTTTAGCAGCTGG + Intergenic
1137309503 16:47240200-47240222 GGGAGAAGGATCACTTGAGCCGG + Intronic
1138102502 16:54264998-54265020 ACAAGAAGGAGAACATCAGCTGG - Intronic
1138605810 16:58088163-58088185 GGCAGAAGGAGCCCAGCAGCTGG - Intergenic
1139474110 16:67194044-67194066 TGGAGAAGAAACACATCAGCGGG - Intronic
1141728123 16:85803903-85803925 TGGAGAAAGAGTAGAGCAGCGGG - Intronic
1142200728 16:88759998-88760020 CGGAGAAGGAGTGAAGCAGCTGG - Intronic
1143338382 17:6190495-6190517 GGAAGAGTGAGTAGATCAGCTGG - Intergenic
1143476220 17:7205217-7205239 GGGGGAGGGAGTAGATGAGCGGG - Intronic
1144136822 17:12302972-12302994 GGGAGAAGAAGTAGACCAGCAGG + Intergenic
1146108929 17:30069583-30069605 AGGAGAAGGAGCACATCACGAGG - Intronic
1147154334 17:38536039-38536061 GGGAGAAGGGGTACCTCAACTGG - Intronic
1148962381 17:51404119-51404141 GGAAGAAGGAGTCCAACAGAAGG + Intergenic
1150289680 17:63974004-63974026 GGGGGAATGACCACATCAGCAGG + Intergenic
1151456723 17:74230942-74230964 CGTCCAAGGAGTACATCAGCTGG - Exonic
1151463659 17:74270908-74270930 GGTAGAAGGATTACTTGAGCTGG + Intergenic
1152619185 17:81352916-81352938 GAGACAGGGAGTACAGCAGCAGG + Intergenic
1153992242 18:10410850-10410872 GGGAGAAGGTTTCCATGAGCTGG - Intergenic
1158864074 18:61620275-61620297 TAGAGAAGGAGTTCATCTGCAGG - Intergenic
1159170812 18:64763956-64763978 AGGATCAGGAGTACATCCGCAGG - Intergenic
1159561966 18:70005508-70005530 GGGAGAAGGAGTAAAAGAGAAGG - Intronic
1165397878 19:35577060-35577082 GGGAGAAGCAGGGCATCGGCAGG + Intergenic
1166368162 19:42287546-42287568 GGGAGAAGGACCACATCCGGCGG + Exonic
1167072409 19:47228458-47228480 GGGAGGAGGAGCAGGTCAGCAGG + Intronic
1167609582 19:50500768-50500790 GGGAGCAGGAGGAGGTCAGCTGG + Intergenic
1168564780 19:57413945-57413967 AGGATAAGGAGCACAGCAGCAGG + Intronic
925024623 2:598048-598070 GGGGGAAGGAGGGCATCAGGAGG + Intergenic
925991626 2:9259497-9259519 GGGAGCAGGAGTACAAGAGGAGG - Intronic
928100556 2:28435031-28435053 GGGAGAAGGAGTCAAGAAGCAGG - Intergenic
928435046 2:31249445-31249467 GGGAGAAGCAGAGGATCAGCCGG + Exonic
929305212 2:40353696-40353718 GGGAGAAAGAGTACAAAGGCAGG - Intronic
929338161 2:40777711-40777733 GGGAGAAAGAGGACAACAACTGG + Intergenic
929848062 2:45553804-45553826 GGGAGATGGAATACAGAAGCGGG + Intronic
929967008 2:46543362-46543384 GGGAGAGGGGGTGGATCAGCGGG - Intronic
939743383 2:145937870-145937892 GGGAGAAATAGTACACAAGCAGG + Intergenic
946639417 2:221767388-221767410 GGAAGAAGGTGGACATGAGCAGG + Intergenic
948277252 2:236718679-236718701 GGGGGTAGGAGAACCTCAGCAGG - Intergenic
1171425250 20:25044794-25044816 GGGAGAAGGGCTGCCTCAGCTGG + Intronic
1172692178 20:36797508-36797530 TGGAGAAGCAGGACAACAGCTGG - Exonic
1174264668 20:49322829-49322851 GGGAGAAGGAATATATCAACTGG + Intergenic
1176236166 20:64054492-64054514 GGGAGAGGGAGAACATCCTCAGG + Intronic
1180755928 22:18161174-18161196 CGGAGAAGGAGTAAGTCAGTGGG + Intronic
1181075840 22:20376229-20376251 CGGAGAAGGAGTAAGTCAGTGGG - Intronic
1181920552 22:26317266-26317288 GGGGGAAGGAATTCATAAGCTGG - Intronic
1183007163 22:34913080-34913102 TGGAGAAGGAGTACTCCAGTAGG - Intergenic
1183066580 22:35367760-35367782 GGGAGAAGGTGGCCATCTGCAGG - Intergenic
1183642411 22:39100684-39100706 GGGAGAATGAGTAAATGAGAGGG - Intronic
1185048571 22:48541514-48541536 GGGACAAGGAAAACAGCAGCCGG - Intronic
950479451 3:13235508-13235530 GGGAGTGGGAGCACCTCAGCAGG + Intergenic
950680522 3:14581993-14582015 GGGAAAAGGAATCCAGCAGCAGG + Intergenic
951953513 3:28228219-28228241 GAGAGGAGGAGTATATGAGCTGG + Intergenic
952311231 3:32192275-32192297 TGGAAAAAAAGTACATCAGCAGG + Intergenic
953093935 3:39756597-39756619 GGGAGGAGGAGTGCATAAACAGG - Intergenic
954103812 3:48398371-48398393 AGGAGAAGGTGCACAGCAGCAGG - Intronic
954339260 3:49940058-49940080 GGGAGATGAAGTACAGCTGCCGG - Exonic
955213300 3:56962096-56962118 GGGAGAAGGAGGAAATTATCAGG - Intronic
955259879 3:57377111-57377133 GGCAGAAGTAGAACATCATCTGG - Intronic
958880551 3:99664568-99664590 GGGAGGAGGAGTAAAAGAGCAGG - Intronic
960185844 3:114637871-114637893 GGAAGAAGCAGAACATAAGCTGG - Intronic
961129616 3:124453793-124453815 CGGAGAAGCAGTACTTAAGCTGG - Intronic
961615342 3:128175100-128175122 GGGAGGAGGAGTAGAGCAGAGGG - Intronic
962866925 3:139454762-139454784 GGGAGAAGGAGAACCGCGGCTGG - Exonic
967554195 3:190835619-190835641 GAGAGAATGAGTGCACCAGCAGG - Intergenic
968125996 3:196160693-196160715 GTGATCAGGAGTAAATCAGCTGG + Intergenic
968914393 4:3490936-3490958 GGGAGAAGGAATGAATGAGCAGG - Intronic
969058956 4:4420063-4420085 AGGAGAAGGAGCACATCACGAGG + Exonic
969594840 4:8143063-8143085 GGGAGAAGAAGGACAAGAGCCGG - Intronic
969941994 4:10741919-10741941 GAATGAAGGAGTACATGAGCAGG - Intergenic
970007342 4:11424477-11424499 GGGAGAAGCTGTACATCAGTGGG + Intronic
975473033 4:74792822-74792844 GGGAGAAAGAGCTCAACAGCGGG - Intronic
975491399 4:74993017-74993039 GGGAAGAGGATTACATCAGGAGG - Intronic
977415673 4:96729879-96729901 AGGAGGAGGAGGGCATCAGCAGG - Intergenic
977726966 4:100307238-100307260 GGGAGAAGGAAGAGGTCAGCTGG - Intergenic
979516367 4:121614707-121614729 GGGAGAAGGAGTGCAGATGCAGG - Intergenic
979678843 4:123437240-123437262 GGCAGAAGGATTGCTTCAGCGGG + Intergenic
981396010 4:144250288-144250310 GAAAGAAGGAGTACAACAACAGG - Intergenic
981922507 4:150100502-150100524 GGGATAAGTAGTAAGTCAGCTGG - Intronic
982704439 4:158692064-158692086 GTGAGAAGGAGAAAATCTGCTGG - Intronic
983672732 4:170256983-170257005 GTTAGCATGAGTACATCAGCTGG + Intergenic
986034666 5:3926159-3926181 GGGAGAAGGGATGCATCAGGAGG - Intergenic
994212108 5:97099052-97099074 GGCAGAAGGAGCAGCTCAGCTGG - Intronic
996474604 5:123902539-123902561 GGGAGAAGGAGTACTAGAGCTGG - Intergenic
997579681 5:135009453-135009475 GGCAGCAGGAGGAGATCAGCAGG + Exonic
998060224 5:139113377-139113399 GGGAGAGGGAGGAGATCAGGAGG - Intronic
998604795 5:143622546-143622568 GGGGGAAGGAGAGCATCAGGAGG + Intergenic
1002347572 5:178558384-178558406 GGGAGAAGGGGGACACAAGCTGG - Intronic
1002959883 6:1904833-1904855 GGCAGAAGGAGTGCATGAGATGG + Intronic
1002984742 6:2178142-2178164 GGAAGAAGGAGAGCAACAGCTGG + Intronic
1003532776 6:6951956-6951978 GGGAGAAGGTGGGCAACAGCTGG - Intergenic
1004716500 6:18221111-18221133 GGGGGAGTGATTACATCAGCAGG - Intronic
1005510954 6:26511168-26511190 GGCAGAAGGAAGACAGCAGCAGG + Intergenic
1009436054 6:63619723-63619745 GGGAGAAGGAGTCTAGCTGCTGG - Intergenic
1010463867 6:76143758-76143780 GTGAGATGAAGTACCTCAGCTGG + Intergenic
1010760742 6:79719593-79719615 TGGTGACGGAGTACATCAGAAGG - Intergenic
1012988789 6:105903617-105903639 GGCAAAATGAGTACATCAGAGGG - Intergenic
1013461130 6:110376508-110376530 GGGAGCATGAGTAATTCAGCTGG + Intergenic
1014756539 6:125307626-125307648 TGGAGAAGGATTACACCACCAGG - Intergenic
1016432940 6:144007397-144007419 GGAAGAAGGAGGACCTAAGCTGG + Intronic
1016610549 6:145984164-145984186 GAAATAAGGAGTACATCAGCAGG + Intergenic
1021364215 7:19756386-19756408 GTGTGTAGGAGTACATCTGCAGG + Intronic
1021583609 7:22183936-22183958 GGAAAAAGGAGTACATGAGGGGG - Intronic
1021937835 7:25648696-25648718 GGGAGAAGGTGTACATGAAGTGG - Intergenic
1022984185 7:35634380-35634402 GCAAGAAGGAGGTCATCAGCAGG - Exonic
1023171960 7:37398733-37398755 GAGAGAAGGATAACTTCAGCTGG + Intronic
1024248451 7:47488475-47488497 GGGAGAAGGTGGCCATCTGCAGG - Intronic
1025161903 7:56668583-56668605 GGGAGAAGAATAACATCACCCGG + Intergenic
1026213331 7:68326127-68326149 GGGTGAAAGAGGACATCATCTGG + Intergenic
1027006223 7:74695848-74695870 GGGAGAATAAGTACAGCTGCAGG - Intronic
1029555039 7:101262954-101262976 GGGAGAAGGTGGACATCTGCAGG + Intergenic
1033596886 7:142865157-142865179 GGGAGAATGACTGCAGCAGCAGG + Intronic
1035338393 7:158144650-158144672 AGGAGAAGGGGGACATCAGCAGG + Intronic
1035484451 7:159211784-159211806 GGGAGAGGGAGCAGATAAGCAGG + Intergenic
1039805168 8:40991545-40991567 TGGAGGAGGAGGCCATCAGCTGG + Intergenic
1040079763 8:43274890-43274912 GGGAGGAGGAGAAGATCAGAAGG - Intergenic
1042841581 8:73129625-73129647 GGGAGAGGGGGTACTTGAGCTGG + Intergenic
1044971996 8:97628793-97628815 GGGAGCAGCAGAACCTCAGCAGG - Intergenic
1045266061 8:100619561-100619583 GGGAGAGGGAGGACACCAGGAGG + Intronic
1046668625 8:117033709-117033731 GGGAGAAGGATTCTATCAGCTGG + Intronic
1055478718 9:76688928-76688950 GGGAGAAGGAACACTGCAGCTGG - Intronic
1056126055 9:83537658-83537680 TGGAGAAGGCATGCATCAGCTGG - Intronic
1056326739 9:85486155-85486177 GGGAAAAAGAGCACAGCAGCTGG - Intergenic
1058849532 9:108997628-108997650 GGGAGGAGCAGGTCATCAGCAGG - Intronic
1059766311 9:117386937-117386959 GGGAGAAGCAGAACAGCAGTGGG + Intronic
1061062487 9:128257628-128257650 AGAAGGAGGAGTACATCAGCAGG - Exonic
1061667015 9:132166467-132166489 GGGATAAGGAGAAAATCCGCAGG - Exonic
1062199050 9:135291295-135291317 GAGAGAAAGAGTTCATCTGCTGG + Intergenic
1203738148 Un_GL000216v2:156662-156684 TGGAAAAGAAGTACATCACCTGG + Intergenic
1186589061 X:10909520-10909542 GGGTGGAGCAGTACATCATCTGG + Intergenic
1188173766 X:26962159-26962181 GGAAGAAAGAGTAAATAAGCAGG - Intergenic
1188364351 X:29296289-29296311 TAGAGAATGAGTACAACAGCTGG + Intronic
1189359755 X:40340729-40340751 GGGAGAATGAGTGCTTCAGTGGG + Intergenic
1190699846 X:52979520-52979542 GGGAGAAGGAGAAGGACAGCTGG - Intronic
1190761587 X:53441943-53441965 GGGAGAAGGAGGGCGACAGCGGG - Intergenic
1191700272 X:64034255-64034277 AGAAGAAGGAGTACTCCAGCAGG - Intergenic
1193886995 X:86994546-86994568 GTGAGAAGGACTGCATCATCTGG + Intergenic
1197997790 X:132398244-132398266 GGGAGGAGAAATACAACAGCAGG + Intronic
1199521581 X:148741690-148741712 GGGAGAAGGAATTCTTTAGCTGG - Intronic
1200864072 Y:8023861-8023883 GGAAGAAGCATCACATCAGCTGG + Intergenic
1200865497 Y:8039120-8039142 GGGAGAAGGGTCACATCACCTGG - Intergenic
1200870107 Y:8088638-8088660 GGAAGAAGGATCACATCACCTGG + Intergenic