ID: 1089777360

View in Genome Browser
Species Human (GRCh38)
Location 11:120847775-120847797
Sequence CTGAGTTAGCACCTTTAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089777353_1089777360 22 Left 1089777353 11:120847730-120847752 CCTATGTAAGGCAGGGGAAGAGG 0: 1
1: 0
2: 1
3: 21
4: 225
Right 1089777360 11:120847775-120847797 CTGAGTTAGCACCTTTAGCTTGG 0: 1
1: 0
2: 0
3: 8
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089777360 Original CRISPR CTGAGTTAGCACCTTTAGCT TGG Intronic
902825807 1:18973419-18973441 CTGAGCTAGCACATTAGGCTGGG - Intergenic
904442517 1:30540882-30540904 CTGTGTGAGGACCTTCAGCTAGG - Intergenic
905132580 1:35771912-35771934 CCAAGTTTCCACCTTTAGCTGGG + Intergenic
907380483 1:54083223-54083245 CTCAGTGAGAACCTTTGGCTAGG + Intronic
908160732 1:61406226-61406248 CTGAGTAACCAACTTTTGCTTGG - Intronic
909752294 1:79177706-79177728 CTGAGTTTTCACCTCAAGCTCGG - Intergenic
913652831 1:120934657-120934679 CTTTGCTAGCACCTTTATCTTGG - Intergenic
914168270 1:145194390-145194412 CTTTGCTAGCACCTTTATCTTGG + Intergenic
914518527 1:148394744-148394766 CTTTGCTAGCACCTTTATCTTGG - Intergenic
914643010 1:149628784-149628806 CTTTGCTAGCACCTTTATCTTGG - Intergenic
915482704 1:156197996-156198018 CTGAGTTGGGACCTTTGGCTGGG + Intronic
920038906 1:203083612-203083634 CTGAGTTTGCCCCCTGAGCTGGG + Exonic
921500106 1:215891361-215891383 CTTAATTAGCTCCTTTGGCTAGG + Intronic
1064135896 10:12750558-12750580 CTGAGTTTGGCCTTTTAGCTTGG - Intronic
1070530123 10:77329507-77329529 ATCAGTTAGCACCTTGATCTTGG + Intronic
1071337643 10:84613927-84613949 CTGAGTTCTCACTTCTAGCTTGG + Intergenic
1077585674 11:3450329-3450351 CTGTGTCAGCTTCTTTAGCTGGG + Intergenic
1077877147 11:6318657-6318679 CTGAGTAAGCACCTACAGCAAGG + Intergenic
1079801848 11:24879058-24879080 CTGGGTTCACACCATTAGCTGGG + Intronic
1088422318 11:109662086-109662108 CTTACTCAGCACCTTAAGCTAGG + Intergenic
1089777360 11:120847775-120847797 CTGAGTTAGCACCTTTAGCTTGG + Intronic
1097363950 12:58690639-58690661 CTGTGTTTGCAAATTTAGCTGGG + Intronic
1101110964 12:101485564-101485586 CAGAGTTAGCACTTTTACCTAGG + Intronic
1101621736 12:106395481-106395503 CTGATTTAGCACCATCACCTTGG - Intronic
1102338636 12:112104085-112104107 CTGAGTTAGGACATTTCTCTTGG - Intronic
1103327883 12:120133605-120133627 CTGGGATAGGCCCTTTAGCTCGG + Intronic
1105055329 12:133093431-133093453 CTGTGTCAGCTTCTTTAGCTGGG + Intronic
1109202782 13:59449423-59449445 CAGAGTTATCTCCTTCAGCTAGG - Intergenic
1117167735 14:53055771-53055793 CTGAGGTAGGTTCTTTAGCTGGG + Exonic
1120430955 14:84414244-84414266 ATGATTTAGGACCTTAAGCTAGG - Intergenic
1121839583 14:97121846-97121868 GTGAGTGAGCACCTGTGGCTTGG - Intergenic
1123168052 14:106345245-106345267 CAGAGTTAGCCCCATTATCTCGG + Intergenic
1125394959 15:39236566-39236588 CTGACTCAGCACTTTTAGTTGGG + Intergenic
1125830834 15:42716187-42716209 CCCAGTTAGGACCTTTAGCTTGG + Intronic
1132591758 16:729165-729187 CTGAGTGAGCATCTCTGGCTTGG + Intronic
1133974197 16:10588742-10588764 CTGACTTAAAACCTTCAGCTGGG - Intergenic
1137804893 16:51295824-51295846 TTGAGTTAGGACCTTAAGATGGG - Intergenic
1139058399 16:63217363-63217385 CTGAGTTAGCACTGGCAGCTTGG - Intergenic
1144017149 17:11207316-11207338 CTGAGTTAGGTCCTTTGGTTTGG + Intergenic
1144720747 17:17468274-17468296 ATGTGTTGGCACCTTGAGCTTGG - Intergenic
1150018647 17:61587480-61587502 TTCAGTTACCACCTTTAACTAGG - Intergenic
1155891420 18:31275191-31275213 CTGAATAAGCAGTTTTAGCTTGG + Intergenic
1156507242 18:37605647-37605669 CTGCCTCAGCACCTGTAGCTGGG + Intergenic
1157846993 18:51013290-51013312 CTGAGTTAGGATCTTGAACTTGG - Intronic
1160080234 18:75719703-75719725 GTGGGTTAGCACCTTTGCCTTGG - Intergenic
1161105555 19:2442042-2442064 CTGAGTTAGAATCTTCAGCTGGG + Intronic
1165137353 19:33677990-33678012 CTGATTCAGCACCTGTAGCCTGG - Intronic
1166687397 19:44803712-44803734 CTGAGGTAGCATCTGTTGCTTGG - Intergenic
1167128888 19:47571626-47571648 CTGAGTTGCCACCCTGAGCTAGG + Intergenic
931008494 2:57880240-57880262 CTGAGATTGCACCTATACCTAGG + Intergenic
934571363 2:95375045-95375067 CGCAGTTAGCACCCTCAGCTGGG + Intronic
935345590 2:102104697-102104719 CTGAATTAACAACTCTAGCTAGG + Intronic
936434876 2:112495794-112495816 CTGAGATCGCACCTTCAGCCTGG + Intronic
940040681 2:149357048-149357070 GTGAGTTAGCACCATTAACTTGG - Intronic
942304602 2:174593868-174593890 CTGAGCAAGGACCTTCAGCTTGG - Intronic
945581690 2:211602796-211602818 CTGAATTAGATCCTTTAGTTCGG - Intronic
945616922 2:212082741-212082763 CTGAGTTATTACTTTTACCTGGG - Intronic
945638765 2:212395552-212395574 ATGTGTTAGCATCTTTGGCTTGG + Intronic
947294991 2:228621113-228621135 CTCTGTTAGTACCTTTAGCAGGG + Intergenic
1172678115 20:36689685-36689707 CTGGGTCAGCACCTTTCCCTTGG + Intronic
1174449579 20:50610978-50611000 CTGAGTTAGGACCTGTAGGAGGG - Intronic
1178291963 21:31376326-31376348 CTGAGATAGCACCTATGGTTTGG - Intronic
1180639569 22:17287528-17287550 ATTAGTTAGCGCCTTGAGCTAGG - Intergenic
949496285 3:4635298-4635320 CTGAGTTAGCACCTTTCTAAAGG - Intronic
949496345 3:4635639-4635661 CTGAGTTAGCACCTTTTGGCTGG - Intronic
950018349 3:9769590-9769612 CTGTGTGAGCGCCTTCAGCTGGG - Intronic
955964822 3:64378432-64378454 ATGAGTTAGCCCCTGTAACTTGG - Intronic
955993502 3:64653981-64654003 CTGATTTAACACCTTTGTCTAGG - Intronic
957069643 3:75557057-75557079 CTGTGTCAGCTTCTTTAGCTGGG - Intergenic
958080671 3:88742425-88742447 TTGAGTGAGAACCATTAGCTAGG - Intergenic
960401224 3:117201504-117201526 CTGAGTTATAACCTTGAGCTTGG + Intergenic
960705334 3:120475809-120475831 CTGAGTCTGCACCTTTAGGCTGG - Intergenic
962418668 3:135207776-135207798 CCTAGTTAGCACCTTGATCTTGG - Intronic
966754993 3:183360916-183360938 CTGAGATAGCACCTCCAGCCTGG + Intronic
969000863 4:3980258-3980280 CTGTGTCAGCTTCTTTAGCTGGG + Intergenic
969699475 4:8760209-8760231 CTGACCTGGCACCTTTCGCTTGG - Intergenic
969726167 4:8919746-8919768 CTGTGTGAGCACCTTGACCTGGG + Intergenic
969753148 4:9128438-9128460 CTGTGTCAGCTTCTTTAGCTGGG - Intergenic
969813059 4:9664611-9664633 CTGTGTCAGCTTCTTTAGCTGGG - Intergenic
972064653 4:34925822-34925844 GTCTGTTAGCACCTTGAGCTTGG + Intergenic
972215486 4:36893196-36893218 CTGAGTTTGTACCTTTTCCTTGG + Intergenic
974851010 4:67405057-67405079 CAGGGTTTGCACCTTTAGTTGGG - Intergenic
976794400 4:88916139-88916161 CAGATATAGCACCTTGAGCTTGG + Intronic
977630583 4:99238524-99238546 TTGAATTACCTCCTTTAGCTTGG + Intergenic
978955485 4:114607652-114607674 CTGAGTTAGGAAGTTGAGCTGGG - Intronic
980749736 4:137072621-137072643 ATGGGTTAGCACCATTATCTAGG + Intergenic
984583251 4:181534499-181534521 CTGCCTTCGTACCTTTAGCTTGG + Intergenic
985461258 4:190108937-190108959 CTGTGTCAGCTTCTTTAGCTGGG + Intergenic
987565532 5:19579956-19579978 ATTAGTTAGCACCTTTAATTGGG - Intronic
991111586 5:62905722-62905744 ATGAGTTAGTACCTCTAGCAAGG - Intergenic
997885162 5:137623387-137623409 CTGTGTCTGCACCTTTAGCCAGG - Intronic
998692215 5:144599167-144599189 CTGAACTAGCACCTGTACCTAGG + Intergenic
1000266815 5:159646041-159646063 CTGATTTAGCACATTTAGGCTGG + Intergenic
1006864720 6:37200237-37200259 CTGAGTTTGCACTTTTCTCTGGG - Intergenic
1009833634 6:68970395-68970417 CTGCTTCAGCACCTGTAGCTGGG + Intronic
1011161519 6:84396227-84396249 CTAATTTAGTAACTTTAGCTAGG - Intergenic
1015640444 6:135326360-135326382 CTGTGCTAGCACCTTGATCTTGG + Intronic
1016846607 6:148574298-148574320 CTGAGTTAATACCATTAGATTGG - Intergenic
1022711308 7:32853631-32853653 CTGACTCAGGACCTTTGGCTTGG + Intergenic
1022913354 7:34921331-34921353 CTGACTCAGGACCTTTGGCTTGG - Intergenic
1023974687 7:45019511-45019533 CTGATTAAGCCCCTTTAACTTGG + Intronic
1024569155 7:50709832-50709854 CTGACTTAGCAGCTCTGGCTGGG - Intronic
1026405811 7:70064378-70064400 CAGAAATAGCACCTTTAACTGGG + Intronic
1027573086 7:79896335-79896357 CTTATTCAGCACCTCTAGCTGGG - Intergenic
1029216690 7:98955573-98955595 CTAAGTTTGCACCTTAAGGTGGG + Intronic
1030042866 7:105467725-105467747 CTGAGTAAGCACCTCTCTCTGGG - Intronic
1035121055 7:156567393-156567415 ATGAGTTAACACCTTTGGCAGGG - Intergenic
1036376357 8:8203770-8203792 CTGTGTCAGCTTCTTTAGCTGGG - Intergenic
1036853175 8:12219368-12219390 CTGTGTCAGCTTCTTTAGCTGGG + Intergenic
1036874550 8:12461890-12461912 CTGTGTCAGCTTCTTTAGCTGGG + Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1039863358 8:41478830-41478852 CTGAGTTAAGAACTTTACCTGGG + Intergenic
1041201685 8:55455527-55455549 CTGAGTTTCCACTTTTAGCGAGG - Intronic
1042421231 8:68591188-68591210 AAGAGTTAGGACCTTTAGTTTGG - Intronic
1045382626 8:101642625-101642647 ATAAGTTACCACCTTCAGCTGGG + Intronic
1049281628 8:141752485-141752507 GTGAGTGAGAACCTCTAGCTGGG + Intergenic
1049876340 8:145024148-145024170 CTGTGTCAGCTTCTTTAGCTGGG + Intergenic
1061155029 9:128854541-128854563 CTGTGTCAGCTTCTTTAGCTGGG - Intronic
1061825912 9:133258099-133258121 CGGTGTCAGCACCTTTGGCTGGG + Exonic
1192760583 X:74091557-74091579 ATGATTTAGCACCATTAGCTTGG - Intergenic
1195302547 X:103544792-103544814 CTGAGCTAGCACCTTGGGTTGGG - Intergenic
1196315100 X:114213191-114213213 CTGTGTTGGCACCTTGATCTTGG - Intergenic
1197138667 X:123092173-123092195 CTGGGGCAGCACCTTCAGCTGGG - Intergenic
1197749097 X:129952907-129952929 CTGAGGCAGCACCTTTCGGTTGG + Intergenic
1200752700 Y:6961299-6961321 CTGTGTCAGCTTCTTTAGCTGGG + Intronic
1201465411 Y:14275136-14275158 CAGAGATAGCACCTGTTGCTGGG - Intergenic