ID: 1089780384

View in Genome Browser
Species Human (GRCh38)
Location 11:120869612-120869634
Sequence AATAGTGGCAACCGTGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089780382_1089780384 -9 Left 1089780382 11:120869598-120869620 CCAGACGGAGTGGGAATAGTGGC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1089780384 11:120869612-120869634 AATAGTGGCAACCGTGTGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 68
1089780380_1089780384 -8 Left 1089780380 11:120869597-120869619 CCCAGACGGAGTGGGAATAGTGG 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1089780384 11:120869612-120869634 AATAGTGGCAACCGTGTGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 68
1089780375_1089780384 7 Left 1089780375 11:120869582-120869604 CCAAGAAAACCATGTCCCAGACG 0: 1
1: 0
2: 0
3: 11
4: 122
Right 1089780384 11:120869612-120869634 AATAGTGGCAACCGTGTGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 68
1089780379_1089780384 -2 Left 1089780379 11:120869591-120869613 CCATGTCCCAGACGGAGTGGGAA 0: 1
1: 0
2: 0
3: 9
4: 94
Right 1089780384 11:120869612-120869634 AATAGTGGCAACCGTGTGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089780384 Original CRISPR AATAGTGGCAACCGTGTGGC AGG Intronic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907867810 1:58415692-58415714 TAGAGTGTCAACCGTGTGTCAGG + Intronic
910648684 1:89540728-89540750 AACACTGGCAACTGTGTGGAGGG + Intronic
911869470 1:103076513-103076535 AAAAGAGGCAGCCTTGTGGCTGG - Intronic
923759449 1:236827407-236827429 AATTATGGCAACCATGTGACAGG - Intronic
1063142103 10:3264611-3264633 GATGGTGCCAGCCGTGTGGCCGG - Intergenic
1063442421 10:6083743-6083765 ACTACTGCCAACCGTGTGCCAGG - Intergenic
1071146505 10:82580339-82580361 AATAGTGGAAACTGTGGGGGGGG - Intronic
1072420578 10:95287745-95287767 AACAGTGGCAAATGTGTGGCTGG + Intronic
1072717774 10:97762958-97762980 AACAGAGGCAGCCTTGTGGCCGG + Intergenic
1080382770 11:31791105-31791127 GATAGTGGCAACCATCTAGCTGG - Intronic
1086313214 11:85559443-85559465 AATAATGGAAGCCATGTGGCCGG - Intronic
1089780384 11:120869612-120869634 AATAGTGGCAACCGTGTGGCAGG + Intronic
1090044085 11:123315691-123315713 AACAGTGGCAGGCATGTGGCGGG + Intergenic
1092578366 12:9814097-9814119 ATTGGTGCCAGCCGTGTGGCTGG + Intergenic
1095763749 12:45870367-45870389 AATAGTGGAAACTGTGTGCAGGG - Intronic
1097159452 12:57036066-57036088 AATCCAGGCAACCTTGTGGCAGG - Intronic
1101537838 12:105635960-105635982 AATAGTTTCAATAGTGTGGCAGG - Intergenic
1104154974 12:126122473-126122495 ATTAGTGGAGACAGTGTGGCAGG + Intergenic
1104647584 12:130508377-130508399 CATAGTGGCAACAGGGTAGCAGG - Intronic
1105759963 13:23504431-23504453 AAAAGTGATAACCGTGTGGGAGG - Intergenic
1109317357 13:60766085-60766107 AATAGTGGAAACTGTGTGGGAGG - Intergenic
1114626308 14:24132331-24132353 AGTAGGGGCAGCCGTGTGGCGGG + Exonic
1115472902 14:33786631-33786653 AACAGTGACAACTGTATGGCAGG - Intronic
1130246683 15:82257652-82257674 AATAGGGGAAACTGTGTGGGTGG - Intronic
1131983766 15:98020741-98020763 AAAAGAGGCAGCCATGTGGCAGG - Intergenic
1134509481 16:14834549-14834571 AGTATTGGCAACCCTGGGGCCGG + Intronic
1134697186 16:16233364-16233386 AGTATTGGCAACCCTGGGGCCGG + Intronic
1135081020 16:19435691-19435713 AATAGTGGCTACCTTGAGGAAGG - Intronic
1136358753 16:29763964-29763986 ATGAGTGGCATGCGTGTGGCAGG - Intergenic
1138333423 16:56233677-56233699 AATGGTGGCAACTCTCTGGCTGG - Intronic
1139590884 16:67932151-67932173 TATAGTGACAACCTGGTGGCTGG + Exonic
1141116210 16:81312020-81312042 AATACTAGCAACAGTGTGGGTGG + Intergenic
1143614222 17:8039824-8039846 AATCGTGGAGACTGTGTGGCTGG + Intronic
1153065274 18:1038656-1038678 AATAGTGGAAACCTTGGGGTGGG - Intergenic
1155381057 18:25223292-25223314 AAATGTGGCATCTGTGTGGCAGG - Intronic
1158836971 18:61341109-61341131 AACATTGGCACCCGTGTGGGAGG - Intronic
1160439168 18:78875996-78876018 AAGTTTGGCATCCGTGTGGCTGG + Intergenic
932530068 2:72520761-72520783 AACACTGGCAACTGTGTGGCAGG - Intronic
935830203 2:106994243-106994265 AGAAGTGGCAAATGTGTGGCTGG + Intergenic
942448506 2:176093631-176093653 AAAAGTGGGACCCCTGTGGCTGG - Exonic
1172179976 20:32996920-32996942 GATAGTGGCAACCCTGTTGCTGG + Intronic
1177368515 21:20170837-20170859 AATAGGGGCCAACTTGTGGCAGG - Intergenic
1180106070 21:45618920-45618942 GATAGTGGCATCTGTGAGGCTGG - Intergenic
1184478888 22:44736019-44736041 AAGAGTGGCCACCAGGTGGCGGG - Intronic
1184684989 22:46092283-46092305 AATACTGACAACCCTGTGCCAGG - Intronic
949800519 3:7898580-7898602 AGTAGTGGCAACAGTGGGCCAGG - Intergenic
949852531 3:8433418-8433440 AATAGTGGCACCCGATTGCCTGG - Intergenic
952682595 3:36112041-36112063 AATAGGGGAAACCGTGTGTGAGG + Intergenic
961969741 3:130948722-130948744 ATTTGTGGCAACCCTGTGTCAGG + Intronic
962344726 3:134610722-134610744 AATGGGGGCAAGCGTGAGGCTGG + Intronic
966969808 3:185033054-185033076 AATAGGGGCAACTGTGGGGGTGG - Intronic
969227323 4:5807521-5807543 AATAATGGAAACAGGGTGGCTGG + Intronic
971079001 4:23185771-23185793 AATAGAGGAAACCGTGTGTGTGG - Intergenic
977032690 4:91906726-91906748 AAGAGGGGCTACAGTGTGGCAGG - Intergenic
994497852 5:100535777-100535799 AATGGCAGCAACCCTGTGGCCGG + Exonic
994571372 5:101518195-101518217 AAAAGTGGCAACAGTGTGAGTGG - Intergenic
997612727 5:135226487-135226509 AGTAGTGGCAGCTGGGTGGCTGG + Intronic
999192550 5:149759459-149759481 AACAGTGGCCACCGTGGAGCAGG + Intronic
999977585 5:156927316-156927338 AATGGTGGCAACGGTGTTTCAGG + Intronic
1015715273 6:136185819-136185841 TATAGTGACTACCGTGTGCCAGG - Intronic
1031845405 7:126799717-126799739 AATAGTGGCTGAAGTGTGGCAGG + Intronic
1040314625 8:46254465-46254487 AACAGAGACAACTGTGTGGCAGG + Intergenic
1046853953 8:119007949-119007971 AATAATTGCAACCTTGTGTCAGG - Intronic
1048340562 8:133535427-133535449 AATCGTGGCAACCTTGTGTTGGG + Intronic
1048822926 8:138396269-138396291 AGCAGTGGCCAGCGTGTGGCAGG + Intronic
1056131962 9:83595991-83596013 AATAGTGGCAATCTTTTGGGAGG + Intergenic
1061533645 9:131234090-131234112 AATAGTAGCCAGCGTGAGGCAGG + Exonic
1194387322 X:93272612-93272634 AATATTGGCATCCATGTGGGAGG + Intergenic
1196187370 X:112758758-112758780 TATAGTGATTACCGTGTGGCAGG + Intergenic
1196324839 X:114390558-114390580 AAAAATGGCGACCGTGTTGCGGG - Intergenic
1196746181 X:119073340-119073362 GACAGTGGCAACACTGTGGCCGG + Intergenic
1197178978 X:123513915-123513937 AATAGTGGGAAGCGGGTGGGAGG - Intergenic
1198565715 X:137903237-137903259 AATAGAGGCAACTGTGTGATAGG - Intergenic