ID: 1089781426

View in Genome Browser
Species Human (GRCh38)
Location 11:120875687-120875709
Sequence CTGTGTCATTGGCATGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 269}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089781426_1089781438 18 Left 1089781426 11:120875687-120875709 CCACCCCCATGCCAATGACACAG 0: 1
1: 0
2: 0
3: 19
4: 269
Right 1089781438 11:120875728-120875750 CCTGCCTGCTCCATCATTGCAGG 0: 1
1: 0
2: 1
3: 19
4: 243
1089781426_1089781439 19 Left 1089781426 11:120875687-120875709 CCACCCCCATGCCAATGACACAG 0: 1
1: 0
2: 0
3: 19
4: 269
Right 1089781439 11:120875729-120875751 CTGCCTGCTCCATCATTGCAGGG 0: 1
1: 0
2: 3
3: 25
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089781426 Original CRISPR CTGTGTCATTGGCATGGGGG TGG (reversed) Intronic
900320725 1:2082242-2082264 CTGTGTATTTGGCAAGAGGGAGG + Intronic
900504406 1:3022136-3022158 CTGTGTCACGGGCCTGGTGGTGG + Exonic
900989002 1:6089335-6089357 CTGTGGCAGAGGCATGGGGCAGG - Intronic
901071190 1:6519549-6519571 CTGTGGCATTGGCATGTGGCTGG - Intronic
902395741 1:16131768-16131790 CTTTGGCATTGTCATGTGGGAGG - Exonic
903726160 1:25447079-25447101 CTGTTTCACTGGAATGGGAGAGG - Intronic
906661915 1:47589025-47589047 CTGTGTCCTTTGCCGGGGGGTGG - Intergenic
907142194 1:52197999-52198021 CTGAGTCATTCGAATGGAGGTGG + Intronic
907470235 1:54668959-54668981 CTGTGGCATTGGGGTGGGAGGGG + Intronic
907540529 1:55212797-55212819 CTGTGGATTTGGCCTGGGGGAGG - Intronic
909267276 1:73576929-73576951 CCCTGTCATTGGCCTGGGGCAGG + Intergenic
909498696 1:76309421-76309443 GTGTGTCATAGGGATGTGGGAGG - Intronic
909956635 1:81786972-81786994 CTGAATCATGGGGATGGGGGTGG + Intronic
910462765 1:87466531-87466553 CAGAGTTATGGGCATGGGGGGGG + Intergenic
912050392 1:105522450-105522472 CTGAGTCAATGGCATGGGAAAGG - Intergenic
912436831 1:109668108-109668130 CAGTGTCATGGGCATGGTGCTGG - Exonic
912448312 1:109753707-109753729 CTGTGTAATGGGCGAGGGGGAGG - Intronic
912482653 1:109995761-109995783 CTGTGTAATCAGAATGGGGGAGG + Intronic
912633801 1:111271813-111271835 AAGTGTCATTGGGGTGGGGGTGG - Intergenic
913376391 1:118157312-118157334 GTGTGTCTTTGGGATGGGGGTGG - Intronic
913450761 1:118991030-118991052 GTGTGTCTGTGGAATGGGGGTGG - Intergenic
913687140 1:121243107-121243129 CTGTGTGTTGGGGATGGGGGAGG + Intronic
913999795 1:143683819-143683841 CTGTGACATTTGCCTGGTGGTGG - Intergenic
914038998 1:144030745-144030767 CTGTGTGTTGGGGATGGGGGAGG + Intergenic
914150455 1:145037182-145037204 CTGTGTGTTGGGGATGGGGGAGG - Intronic
915121379 1:153631626-153631648 CTGAGTCAGAGGCAAGGGGGTGG - Intronic
916368545 1:164061783-164061805 CTGTGTCAGTGGGAAAGGGGAGG - Intergenic
917099644 1:171432248-171432270 CTGTTTCATGGGGTTGGGGGAGG - Intergenic
918682421 1:187371996-187372018 CTGGGTCATTACCATGGAGGAGG - Intergenic
920182700 1:204142354-204142376 CTGAGTGCTTGGGATGGGGGTGG - Intronic
920474468 1:206261628-206261650 CTGTGTGTTGGGGATGGGGGAGG + Intronic
920573073 1:207032741-207032763 CTGAGTCAGTGGCAGGGTGGGGG - Exonic
920821542 1:209386298-209386320 CTCTGTCCTTGACATGGGTGAGG + Intergenic
921049225 1:211499276-211499298 GTGTGTCTTTGGCTTGGTGGAGG + Intergenic
924234011 1:241985530-241985552 GTGTATCAGTGGCATGGTGGTGG + Intergenic
1063583964 10:7334279-7334301 CTGTGTCACTGGGAAGGTGGAGG - Intronic
1067082614 10:43220052-43220074 CTGTGTCCACGGCATGGGGGTGG - Intronic
1067158498 10:43802644-43802666 CTGTGTCATGGGCTGGGGGTTGG - Intergenic
1067964886 10:50900151-50900173 CTGGGTCATTAACAAGGGGGTGG - Intergenic
1069121969 10:64577886-64577908 CTGTGACATTGGGAAGGGCGTGG + Intergenic
1069172604 10:65252783-65252805 CTGTGTCATTGCCAGGTGTGAGG - Intergenic
1069608043 10:69752597-69752619 CAGTGCCATTGGAATGGCGGGGG + Intergenic
1073829397 10:107364358-107364380 CTGTGTCATTGCCATGGAAAAGG + Intergenic
1074306078 10:112279714-112279736 CTGGGGCATTGGTATGGGGGCGG + Intergenic
1074818837 10:117164152-117164174 ATTTCTCAGTGGCATGGGGGAGG + Intergenic
1076323045 10:129597984-129598006 CACTGTGATTGGCATGGTGGTGG + Intronic
1076717662 10:132374585-132374607 CTGTGTCTGTGGGGTGGGGGTGG + Intronic
1077484898 11:2834128-2834150 CTGTGTGCATGGCATGGTGGTGG + Intronic
1077653553 11:3996603-3996625 CTGTGTCATTGAGTTGGGAGAGG + Intronic
1078439678 11:11353855-11353877 ATGTGTCATTGAGATGGGGTTGG + Intronic
1078478178 11:11652330-11652352 CTATTTCATTGGGCTGGGGGTGG - Intergenic
1081596482 11:44462897-44462919 CTGTCTCCTTGGCAAGGGGTGGG + Intergenic
1083293311 11:61701666-61701688 CTGTGTCACAGGGAAGGGGGTGG + Intronic
1083853816 11:65382364-65382386 CTCTCTCTGTGGCATGGGGGCGG - Intronic
1087159607 11:94935911-94935933 GTCAGTCATTGGCATGGGGAGGG - Intergenic
1088991654 11:114959216-114959238 CTGTGTGATTGCCATTGGGTGGG + Intergenic
1089781426 11:120875687-120875709 CTGTGTCATTGGCATGGGGGTGG - Intronic
1091778591 12:3200206-3200228 GTGTGTCATTGGGGAGGGGGTGG + Intronic
1093173293 12:15882700-15882722 CTGTCTCATTGCCATGGCGGCGG - Exonic
1096408816 12:51362621-51362643 CCTGGTCACTGGCATGGGGGTGG + Intronic
1098147773 12:67515470-67515492 CTGTGTGATGGGCAAGGGGGTGG + Intergenic
1099317228 12:81099567-81099589 CTTTGTTATTGGAATGGGAGAGG + Intronic
1101083091 12:101208995-101209017 CTGTTTCAGTGGAAAGGGGGTGG + Intronic
1101471172 12:104998758-104998780 CTGTGGTGTTAGCATGGGGGTGG + Intronic
1101944899 12:109129392-109129414 CTGTGTCACTGGCATGTGTGTGG - Intronic
1103202708 12:119101390-119101412 CTGTGTCATTGGCAGAGTTGGGG + Intronic
1104088019 12:125493564-125493586 CTGTGTGCTTGGGGTGGGGGTGG + Intronic
1104963308 12:132498240-132498262 CTGTGTCGGGGGCATGGGGCCGG + Intronic
1106632026 13:31484493-31484515 GTGTGTCAGTGGCATGGGATAGG + Intergenic
1107653222 13:42565963-42565985 CTGTGTTATTGAGATGGGAGTGG - Intronic
1107929221 13:45293037-45293059 CTGTGTCTTTGGGATAGGGGTGG - Intergenic
1109928920 13:69186197-69186219 CTGTGTCCTTTGGATGGTGGTGG + Intergenic
1110648630 13:77918293-77918315 ATGGGTCCTTGGCACGGGGGAGG + Exonic
1116316934 14:43409052-43409074 ATGTGTCATTGGCAAGAGGACGG + Intergenic
1117739947 14:58806834-58806856 CTGGGTCATGGGGATGGTGGAGG + Intergenic
1117953021 14:61101481-61101503 GTGTGTCCTTGGCATGGACGGGG + Intergenic
1119726561 14:76925008-76925030 CTGTGTCACTGTCGTGGGGCAGG + Intergenic
1120948964 14:90023340-90023362 CTGTGTGCTTGGAATGGGGATGG + Intronic
1121618068 14:95327083-95327105 CTGGGTCATTGCCATGGAAGGGG + Intergenic
1122138609 14:99648896-99648918 GAGTGTCAGTGACATGGGGGTGG + Intronic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1123030596 14:105449447-105449469 CTGTGTCCCTGGGCTGGGGGCGG + Intronic
1124504895 15:30264161-30264183 CTGTATCACAGGCATCGGGGAGG + Intergenic
1124738657 15:32274474-32274496 CTGTATCACAGGCATCGGGGAGG - Intergenic
1125860841 15:42998469-42998491 GTGGGTGATTGGCATGTGGGTGG - Intronic
1128964126 15:72040394-72040416 CTATGCCATTTGCAGGGGGGAGG + Intronic
1129253400 15:74320678-74320700 ATGTGGCATTGCCCTGGGGGTGG - Intronic
1130445895 15:84001677-84001699 GAGTGTCATTGGCTTAGGGGTGG + Intronic
1130542328 15:84829680-84829702 ATGTCTCATTAGCATGGGTGTGG - Intronic
1130547584 15:84868231-84868253 CTTTGGCTTTGGCTTGGGGGTGG - Exonic
1130673942 15:85936246-85936268 CTCTGTCCTCTGCATGGGGGAGG + Intergenic
1132269400 15:100510643-100510665 CTGGGTCAATGACATAGGGGTGG + Intronic
1132290065 15:100693841-100693863 CATTGTCATTAGGATGGGGGTGG - Intergenic
1132375045 15:101323310-101323332 CTGTGCCCTTGGGAAGGGGGTGG + Intronic
1132606634 16:796373-796395 CTGTGGGATGGCCATGGGGGTGG + Intronic
1133233140 16:4375795-4375817 TTGTTTAATTGGCCTGGGGGTGG + Intronic
1133756652 16:8767219-8767241 CTGTGCCATTTGCTTGGGGCTGG + Intronic
1134183105 16:12063249-12063271 CTGGGGCGTTGGCATGGAGGGGG + Intronic
1136009618 16:27354941-27354963 ATCTGCCATTGGCATGGGGAAGG + Intronic
1136097343 16:27966642-27966664 CTGTGTCCGTGGCATCAGGGAGG - Intronic
1136453669 16:30369041-30369063 CTGTGACATTGGCATGTTAGTGG - Intronic
1138595704 16:58027861-58027883 CTGTGTGAATGGGGTGGGGGAGG - Intronic
1139079976 16:63505846-63505868 CTGTGTCAATTGCATGGGTGGGG - Intergenic
1139340206 16:66263489-66263511 CTGTGTCAGTTTCATGGGTGGGG - Intergenic
1139472154 16:67184092-67184114 CTGTGGCCTTGGGAAGGGGGCGG - Intergenic
1143055116 17:4156639-4156661 CTGTGCCCTTGGCCTGGGGAAGG + Intronic
1146845441 17:36179104-36179126 CTGTGTGCTTGGCTTGGGGTGGG + Intronic
1146873656 17:36390947-36390969 CTGTGTGCTTGGCTTGGGGTGGG + Intronic
1146881015 17:36442035-36442057 CTGTGTGCTTGGCTTGGGGTGGG + Intergenic
1147065732 17:37921926-37921948 CTGTGTGCTTGGCTTGGGGTGGG - Intergenic
1148250294 17:46072537-46072559 CAGTATCATTGAAATGGGGGTGG - Intronic
1148846862 17:50534548-50534570 CTGAGTCACTAGCAAGGGGGAGG + Intronic
1149413149 17:56429729-56429751 CAGTGTCATTGGATTGGTGGGGG + Intronic
1149772544 17:59332428-59332450 CGGTGTCCTTGCCAAGGGGGTGG + Intronic
1151153914 17:72111199-72111221 CTGTTGCATTGGCTTGGGGGTGG - Intergenic
1152257172 17:79246848-79246870 CAGTGCCAATGGGATGGGGGTGG + Intronic
1153601065 18:6781696-6781718 CTGTGGCATTGTTCTGGGGGTGG + Intronic
1153699947 18:7682822-7682844 CTCTGTCTTGGGCATTGGGGGGG + Intronic
1154501993 18:15001729-15001751 GTGTGTCACTGTCATGGGCGGGG - Intergenic
1155225407 18:23725464-23725486 CTGTGTCCTTGGCAGAGTGGTGG + Intronic
1155838230 18:30613764-30613786 CTGTGTCAGGGGCATGAGGCTGG - Intergenic
1156271846 18:35542393-35542415 CTGTGGCAGTGGGGTGGGGGTGG + Intergenic
1156341024 18:36210894-36210916 CTGTGGCAGTGGCATGGGATTGG + Intronic
1156368885 18:36454762-36454784 CTGGCTCTTCGGCATGGGGGAGG + Intronic
1156619147 18:38828195-38828217 TTGAGTCAGTGGCATGGGGAAGG - Intergenic
1157731750 18:50010086-50010108 CTGTGTAATTGGCATTTGGCAGG + Intronic
1158215817 18:55099553-55099575 CTGGATCACTGGCTTGGGGGTGG + Intergenic
1158723791 18:59949740-59949762 TTGAGTCAGTGGCATGGGAGAGG + Intergenic
1161628873 19:5341276-5341298 CTGGATCATTGACATGGTGGGGG - Intergenic
1162911808 19:13851586-13851608 CTGAGTCACTGGAATGGTGGAGG + Intergenic
1163571183 19:18083327-18083349 CTGGGTCTTTGGCCTGGTGGTGG + Intronic
1165930868 19:39357614-39357636 CTGTGAGATTGGCATTGGGATGG + Intronic
1168071982 19:53958542-53958564 TGGTGGCATTGGAATGGGGGAGG + Intergenic
925921971 2:8644582-8644604 CTCTGTCCTTGGCTTGGAGGTGG - Intergenic
926624459 2:15079499-15079521 CTGTGTCCTTGGAAAGGAGGAGG - Intergenic
926896418 2:17694198-17694220 GTGTGTCAGTGGGATGGGAGGGG + Intronic
928336040 2:30399358-30399380 CTGTGCCATTTGCAGGGGTGGGG + Intergenic
929393003 2:41493710-41493732 GTGTGTCATTTGCATAGGGCAGG - Intergenic
929883809 2:45860860-45860882 CAGTGGCTTTGGCATGGGGAGGG - Intronic
931185277 2:59945023-59945045 CAGTGTCCTTGGCATGGGTGTGG - Intergenic
932078853 2:68692774-68692796 CAGTGGCAATGGCATGGCGGTGG - Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934656989 2:96121586-96121608 CTGTGTAACTGGCATGGGGAGGG - Intergenic
934926567 2:98385957-98385979 CTGTGTCCCTGTCATGGTGGTGG - Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937446610 2:121963496-121963518 CTGGGTCAGTGGCTGGGGGGAGG + Intergenic
937578051 2:123448419-123448441 CTGTGTCATTCTCATAGGTGAGG - Intergenic
940840928 2:158580940-158580962 CTGTGCCAGGGCCATGGGGGTGG - Intronic
941140359 2:161773175-161773197 CTGTATCATTCCCATGGTGGAGG + Intronic
942163280 2:173215183-173215205 CTGTCTCACTGGCAGGGGTGTGG + Intronic
943083580 2:183284956-183284978 CTGTGTCCTTGGCTTTGGGAAGG + Intergenic
944388852 2:199196121-199196143 CTGTTTCCTTGGCATGGTGAAGG + Intergenic
944574700 2:201080644-201080666 CTGTGGTATTGGCATAAGGGTGG - Intronic
947385839 2:229589211-229589233 CATTTTCATTGACATGGGGGAGG - Intronic
947953909 2:234171360-234171382 ATTTGACATTGGGATGGGGGAGG - Intergenic
948169930 2:235893171-235893193 CTGTGTCTTTGGCGCGGGTGTGG + Intronic
948169950 2:235893314-235893336 CCGTGTCTGTGGCATGGGTGTGG + Intronic
948798569 2:240419692-240419714 CTTGGCCACTGGCATGGGGGGGG - Intergenic
1168936243 20:1667979-1668001 ATGTGTCATTAGCTTGAGGGAGG - Intergenic
1169465422 20:5833974-5833996 TTCTGTCATTGGCATTGAGGAGG + Intronic
1170428492 20:16258094-16258116 GTGTGTGTTTGGCATGGGGAAGG - Intergenic
1170762772 20:19265363-19265385 CTGTGTTCATGGCATGGGGAGGG + Intronic
1172688665 20:36775576-36775598 CTGTGTCATTAGGCTGGGTGTGG + Intergenic
1175192286 20:57219509-57219531 ATGTGTCATTGGCATCTGGTGGG + Intronic
1175515116 20:59564468-59564490 CTCTGCCCTTGGCCTGGGGGCGG - Intergenic
1175936792 20:62517813-62517835 CTGTGTTTGGGGCATGGGGGAGG - Intergenic
1175936829 20:62517921-62517943 CTGTGTGGGGGGCATGGGGGAGG - Intergenic
1177727837 21:24991835-24991857 CTTTGTCTTCGGCATGTGGGTGG - Intergenic
1179047718 21:37861309-37861331 CTCTGTCCTTGGCTTGGGGATGG + Intronic
1180257418 21:46641771-46641793 GTGTGACATGGGCATGGTGGAGG + Intronic
1180971391 22:19817933-19817955 GTGTGTCCTTGGCATGCGGGAGG + Intronic
1181045297 22:20211454-20211476 CTCTCTCATTGTCATGGGGAGGG + Intergenic
1182264417 22:29102508-29102530 CTGTGTCATTCTCTTGGGAGTGG + Intronic
1183167284 22:36157208-36157230 CTGGGCCATTGCCGTGGGGGAGG - Intronic
1183243875 22:36678666-36678688 GTGAGTGACTGGCATGGGGGTGG - Intronic
1183276316 22:36900384-36900406 CGGGGTGACTGGCATGGGGGTGG - Intergenic
1184443908 22:44536015-44536037 CTGTGACCATGGCATGGTGGTGG + Intergenic
1184564123 22:45281523-45281545 CTTTGTTATTGGCAGTGGGGAGG + Intergenic
1184564417 22:45283641-45283663 CTTTGTTATTGGCAGTGGGGAGG - Intergenic
949576214 3:5341246-5341268 CTATGTGGTTGGTATGGGGGTGG + Intergenic
950256429 3:11510456-11510478 CTGTATCACTGGGATGGGGGAGG - Intronic
950638927 3:14335477-14335499 CTGGGTCATTGGGATGGATGAGG + Intergenic
951280499 3:20743236-20743258 CTGTGTACTTGGAATGAGGGAGG + Intergenic
954219071 3:49141631-49141653 CTGTGTCCTTGGCAAGGAGAGGG - Intergenic
954870102 3:53761339-53761361 CTGGCTCCTTGTCATGGGGGTGG - Intronic
955508315 3:59654151-59654173 CTGGATCTTTGGCATGCGGGAGG - Intergenic
956143166 3:66165936-66165958 CTGTGGGGTTGGGATGGGGGTGG - Intronic
956553158 3:70484736-70484758 CTTAGCCATGGGCATGGGGGAGG + Intergenic
958711316 3:97720341-97720363 CTATGGCATTGTCATGTGGGAGG + Exonic
961426217 3:126850550-126850572 GTGTGTCAGTGGGATGGTGGTGG + Intronic
963273446 3:143307842-143307864 CTGAGTCACAGGCATGGGGCTGG - Intronic
965450058 3:168827135-168827157 GTGTGGCATGGCCATGGGGGTGG + Intergenic
966735057 3:183181302-183181324 CTGTGTGAGTAACATGGGGGCGG + Intronic
968503601 4:962040-962062 CTGTGGCATTGGCATCGACGCGG - Exonic
969313288 4:6366761-6366783 CTGGGTCCCTGGCATGGGGCAGG - Intronic
971166785 4:24191720-24191742 CTGTGTGATTAGGATGGGTGTGG + Intergenic
972460344 4:39296047-39296069 CTGTGACGTTGGCATCGGTGAGG - Intronic
973991494 4:56413015-56413037 CAGTATCATTTGCATGGGGGTGG - Intronic
974058623 4:57009577-57009599 CTGTGACATTGGGAAGGGAGGGG + Intronic
974084198 4:57242179-57242201 CAGTGTGATTGGAATGGGGAAGG + Intergenic
974572680 4:63674282-63674304 ATGTGTTCTTGTCATGGGGGAGG + Intergenic
976690743 4:87864525-87864547 CTGTGCCATTTGCAGTGGGGAGG - Intergenic
981932459 4:150205871-150205893 CTGGGGCAATGGCCTGGGGGAGG - Intronic
982613853 4:157615046-157615068 TTGTCTCTTTGGGATGGGGGAGG + Intergenic
984282731 4:177691221-177691243 CTTTGTCAATGCCATGGGTGAGG + Intergenic
985790838 5:1926249-1926271 CTGTGGCATTGGCAGGGGCTGGG - Intergenic
986674126 5:10168606-10168628 CTGTGCCAGTGGCAGGGGCGAGG - Intergenic
988526381 5:31990862-31990884 CAGTGTCATGGGCAGGGGGCTGG + Intronic
989490576 5:42048081-42048103 CTGTGTCAATCCCATGTGGGTGG - Intergenic
990540743 5:56770550-56770572 CTGTACCATTGGCCTGGGGCTGG - Intergenic
990967110 5:61461102-61461124 TTGTGTCACTGGCATTTGGGGGG - Intronic
991647400 5:68815036-68815058 CTGTGGCCTTGGCAGGGGGAGGG - Intergenic
992239065 5:74746756-74746778 CAGTGCCATTGGCAATGGGGAGG - Intronic
995353288 5:111207313-111207335 CTGTATAATGGGGATGGGGGAGG - Intergenic
995657050 5:114438356-114438378 CTGGGTCATTGGCATTTGGGAGG + Intronic
995847783 5:116512693-116512715 CTGTGTGTTTGGGGTGGGGGTGG - Intronic
995967363 5:117923982-117924004 ATGTGTCATTGTCATAGGGAAGG + Intergenic
1000278878 5:159764876-159764898 CTGCATTATTTGCATGGGGGAGG - Intergenic
1001748690 5:174111377-174111399 CTCTGGCACTGGCTTGGGGGAGG - Intronic
1002365005 5:178703021-178703043 GTGTGTCTTTGGCATGGGAAAGG - Intergenic
1003011884 6:2434251-2434273 CTGTGTCATGGGAATGAGGAAGG + Intergenic
1003552983 6:7115357-7115379 CTGTGTGATAGGCTGGGGGGTGG - Intronic
1005690666 6:28301910-28301932 TTGTGTCGTTGGTATGGGGATGG + Exonic
1007418417 6:41705525-41705547 CTGTGTCGTTGGGAAGAGGGTGG - Intronic
1008665020 6:53707386-53707408 CAGTATCATTGGCATCAGGGTGG - Intergenic
1010224438 6:73475943-73475965 TTGTGTAATGGGCAAGGGGGCGG - Intronic
1010541996 6:77103135-77103157 CTGAGTCATTGGGCTGGGGAAGG + Intergenic
1012626247 6:101406670-101406692 CTGAGTGATTAGCATGGGTGTGG + Intronic
1014434692 6:121408534-121408556 CTTTGTCTTGGGCATGGTGGCGG - Intergenic
1015702918 6:136055799-136055821 ATGTGGCATGGGCAAGGGGGCGG + Intronic
1016498163 6:144688738-144688760 CTGTGGCATTGGAATGGCAGTGG + Intronic
1016738644 6:147507231-147507253 CTGTGTGTTTGGCATTTGGGTGG - Intergenic
1016988946 6:149916320-149916342 CTGTGTCCTTGGCATTGGGTGGG + Intergenic
1018341635 6:162857079-162857101 CTGAGTCATTTGCAGCGGGGTGG + Intronic
1019003063 6:168771591-168771613 CTGTGTCATTTGCATGCCAGAGG + Intergenic
1019549706 7:1595870-1595892 CTGTGGCACGGGCATGGGGTGGG + Intergenic
1019619924 7:1986983-1987005 CTGTGCCATGGGCCTGGAGGGGG - Intronic
1022578837 7:31527161-31527183 CTCTGTCCTTTGCATGGGGTGGG - Intronic
1024061324 7:45700694-45700716 CTGTGTCACTTGCAGGAGGGAGG + Intronic
1024545269 7:50512530-50512552 ATGTGCCATGGGCCTGGGGGTGG - Intronic
1028294342 7:89108978-89109000 CTGTGTCATTAGTATTGGAGGGG + Intronic
1028345049 7:89769516-89769538 GTGTGCCATGGGCCTGGGGGAGG + Intergenic
1030415235 7:109235660-109235682 GTGTGTGTTTGGCAGGGGGGAGG + Intergenic
1031668141 7:124510892-124510914 CTGGGTCATTGCCATGGAAGTGG + Intergenic
1032061845 7:128731308-128731330 CTCTGGCAGTGGCATGGAGGTGG - Exonic
1032445238 7:131976650-131976672 CTTTGTCACTGGAATGGTGGGGG - Intergenic
1033495434 7:141889186-141889208 CTGTGTCTTTGGGCTGAGGGTGG + Intergenic
1036788288 8:11702174-11702196 CTGTGTCCTTGGCTGTGGGGAGG + Intronic
1037634972 8:20693353-20693375 GTGTGTAAGTGGCCTGGGGGAGG + Intergenic
1040027355 8:42794303-42794325 TTGTGCCATTTGCATAGGGGAGG - Intronic
1044316312 8:90753013-90753035 CTGTTTCTTTGGCCTGAGGGAGG + Intronic
1044553705 8:93539234-93539256 CTCAGTCATTGGCATGGGCACGG - Intergenic
1047127264 8:121976207-121976229 CTCAGTGAGTGGCATGGGGGTGG - Intergenic
1047238187 8:123060966-123060988 TCGTATGATTGGCATGGGGGTGG - Intronic
1048643800 8:136394913-136394935 CTGTTTCAGTGGGATGTGGGTGG + Intergenic
1049198305 8:141327355-141327377 CTGGGTCCTGGGGATGGGGGCGG + Intergenic
1049498177 8:142946458-142946480 CTCTGTCCTTGGCACGGGGAAGG + Intergenic
1049679876 8:143913371-143913393 CCGCGTCATTGGCTTGTGGGTGG - Intergenic
1049968249 9:798576-798598 CTAGGACACTGGCATGGGGGAGG - Intergenic
1050009485 9:1171492-1171514 GGGTGGCATTGGCATGGGAGAGG + Intergenic
1050365161 9:4867399-4867421 CTGTGTCAGTAGCATTGGGCTGG + Intronic
1050745128 9:8867350-8867372 TTGTGTCTTTGCCAAGGGGGAGG - Intronic
1053360489 9:37483112-37483134 CTGTGTAACTGGGATGGGGCAGG - Intergenic
1056641305 9:88373241-88373263 CTGAGTCATGGGCCTGGGTGGGG + Intergenic
1056647392 9:88425713-88425735 CTTTGGCATTTGCATGGGTGAGG + Intronic
1057944146 9:99309933-99309955 CTGAGTCACTGGCATAGCGGAGG - Intergenic
1058923269 9:109638608-109638630 CAGTGGCAGCGGCATGGGGGAGG + Intergenic
1059833077 9:118120232-118120254 TTGTGTCATTTGCAGAGGGGAGG + Intergenic
1060735365 9:126063458-126063480 AGGTGTCCTTGGCATGGGGGCGG + Intergenic
1062192924 9:135256976-135256998 CACTGGCCTTGGCATGGGGGAGG - Intergenic
1062628919 9:137454971-137454993 CTGTGTGATTGGAGTGGGGGAGG + Intronic
1185814909 X:3145802-3145824 TTGTGTGCATGGCATGGGGGAGG - Intergenic
1186442475 X:9598100-9598122 CTGTCTCCTTGGCTTGGAGGTGG - Intronic
1186848715 X:13557757-13557779 CTTTGTCTTTGGCATGGCAGTGG + Intergenic
1189305108 X:39980984-39981006 TTGTGTCATTGGCTGGGGGATGG + Intergenic
1190913152 X:54790244-54790266 CTGGTTCAGTAGCATGGGGGTGG - Intronic
1190917791 X:54823065-54823087 CTGGTTCAGTAGCATGGGGGTGG + Intergenic
1192775313 X:74238525-74238547 CTGTGTCCTTGGAGTGTGGGTGG - Intergenic
1197563433 X:128051738-128051760 CTGTGTCACAGGCCTGGTGGTGG - Exonic
1197892239 X:131279056-131279078 CAGTGTCATTGGCCAGGGAGTGG - Intronic
1198019765 X:132646336-132646358 ATTGGTCATTTGCATGGGGGAGG + Intronic
1199622652 X:149713863-149713885 CTTTTTCTTTGGCATGTGGGAGG - Intronic
1200756122 Y:6991606-6991628 CTGTCTCCTTGGCTTGGAGGTGG - Intronic