ID: 1089781990

View in Genome Browser
Species Human (GRCh38)
Location 11:120879756-120879778
Sequence TCGCATGTGCAAAAACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089781990_1089781998 27 Left 1089781990 11:120879756-120879778 CCCTCCAGTTTTTGCACATGCGA 0: 1
1: 0
2: 0
3: 9
4: 176
Right 1089781998 11:120879806-120879828 CCTTTTCATGACACGGAAGATGG 0: 1
1: 0
2: 1
3: 12
4: 135
1089781990_1089781994 20 Left 1089781990 11:120879756-120879778 CCCTCCAGTTTTTGCACATGCGA 0: 1
1: 0
2: 0
3: 9
4: 176
Right 1089781994 11:120879799-120879821 TATCCTCCCTTTTCATGACACGG 0: 1
1: 0
2: 1
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089781990 Original CRISPR TCGCATGTGCAAAAACTGGA GGG (reversed) Intronic
901615754 1:10538275-10538297 GCACATGAGCAAAGACTGGAAGG + Intronic
902116384 1:14125079-14125101 CAGCAGGTGCCAAAACTGGAAGG + Intergenic
902511228 1:16967979-16968001 TGGCCTGGGCTAAAACTGGAAGG + Intronic
909799814 1:79792446-79792468 TTGCATGTGCAGATTCTGGAGGG - Intergenic
910521043 1:88122914-88122936 ATGCTTGTGCAAAAATTGGAAGG - Intergenic
911410564 1:97501033-97501055 TGGAATGTGCAAAGACTGAAAGG - Intronic
915060986 1:153184799-153184821 CTGAATGTGCAAAAACTGGAAGG - Intergenic
915961926 1:160274252-160274274 TGACCTGTGCAAAAACTAGATGG - Intergenic
916973830 1:170052889-170052911 TTGAATGGGCAAAAGCTGGAAGG + Intronic
916979801 1:170121747-170121769 TGGCAAGTCCAAAATCTGGAAGG - Intergenic
919074831 1:192800027-192800049 TCGGAAATGGAAAAACTGGAAGG + Intergenic
919496496 1:198276880-198276902 TCACAGGTGTAAAAACTGAAAGG + Intronic
920444540 1:206005922-206005944 TCCCATGTGCAAAGGCTGTAAGG - Intergenic
920973864 1:210767216-210767238 TCACATGTGCTAATACTAGAAGG - Intronic
921004756 1:211082567-211082589 TCCCATGTGCAAAAGCAGGCTGG - Intronic
921184935 1:212662075-212662097 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1066202786 10:33158403-33158425 TGGCATTTGCAGCAACTGGATGG + Intergenic
1066424477 10:35293579-35293601 TCCCATGTCCACAGACTGGAAGG - Intronic
1070072909 10:73107001-73107023 TCCCATGTTCATAAATTGGAAGG - Intergenic
1075472470 10:122702388-122702410 TAGCAAGTGCAAAATCTGCAGGG + Intergenic
1076214490 10:128681973-128681995 CCGGATGTGCAAAAACTGTAAGG - Intergenic
1079264353 11:18915897-18915919 TCCCTTGTGCTAAAGCTGGAGGG + Intergenic
1081064351 11:38521646-38521668 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1082814045 11:57496665-57496687 TCCCACGTGCAACAACTGGGGGG + Intronic
1082817353 11:57518023-57518045 TAGCAGGTGCAAAGACTGGGAGG - Intergenic
1083201383 11:61123062-61123084 TCCCACGTGCAGAGACTGGAGGG + Intronic
1089468199 11:118699540-118699562 GCGCATGTGAAAAATGTGGATGG - Intergenic
1089781990 11:120879756-120879778 TCGCATGTGCAAAAACTGGAGGG - Intronic
1090200539 11:124852009-124852031 TCACATCTGCTAAAACTGGTCGG - Intergenic
1090324294 11:125871370-125871392 TCTCATGTTAAAATACTGGAAGG - Intergenic
1094592086 12:31831344-31831366 TGGCATTTGCAGCAACTGGATGG + Intergenic
1096920391 12:55078918-55078940 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1099744605 12:86686430-86686452 GTGAATGGGCAAAAACTGGAAGG - Intronic
1102605681 12:114065571-114065593 TCTCATGTTAAAATACTGGAAGG + Intergenic
1102818150 12:115885637-115885659 GCCCTTGTGCAAAAACAGGAGGG + Intergenic
1107148911 13:37089817-37089839 TTGCAAGTCCAAAATCTGGAGGG - Intergenic
1107753883 13:43598582-43598604 AGGCATGTGCAGAGACTGGAGGG - Intronic
1108147223 13:47491317-47491339 TAGCATGTGCAAAGTCTAGATGG + Intergenic
1108565428 13:51692288-51692310 CTGAATGGGCAAAAACTGGAAGG - Intronic
1113105722 13:106770018-106770040 TGGCGTGTGCAAACACTGGGAGG - Intergenic
1113476282 13:110583778-110583800 TCACATGTGAAAAAGCAGGAGGG - Intergenic
1116026681 14:39523651-39523673 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1116226059 14:42153770-42153792 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1116782825 14:49254957-49254979 CCGAATGGGCAAAAGCTGGAAGG + Intergenic
1117455747 14:55895150-55895172 TGGCATCTGCACAAACGGGATGG + Intergenic
1117640186 14:57790041-57790063 CTGAATGGGCAAAAACTGGAAGG + Intronic
1117850400 14:59962340-59962362 TTTCAAGTGCAAAAACTGAATGG + Intronic
1125637992 15:41205421-41205443 AAGCATGTGAAAAAACTGTATGG + Intronic
1127405980 15:58646954-58646976 CAGCATGTGCAAAGACTGGCAGG - Intronic
1127455640 15:59153911-59153933 CCGCATTTGAAAAAAATGGAAGG + Intronic
1128431517 15:67599638-67599660 TTGCATGGGCAGAAAATGGATGG - Intronic
1130846684 15:87754148-87754170 TGGGATGAGAAAAAACTGGATGG - Intergenic
1130914445 15:88293894-88293916 TCTCAGGTGCCAAGACTGGACGG - Intergenic
1132299857 15:100768725-100768747 TGGCATTTGCAAAGACAGGAAGG - Intergenic
1133642183 16:7727635-7727657 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1134280521 16:12812864-12812886 TGGCAAGTGCAAAATCTGCAAGG - Intergenic
1137371814 16:47913895-47913917 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1138039880 16:53651577-53651599 TAGCAAGTGCAAAAACCTGAGGG - Intronic
1142220275 16:88850877-88850899 TGGCATGTGCAAAAACAGTGTGG + Intronic
1143987920 17:10931128-10931150 TCTGATGTGCAATAACTGGCTGG - Intergenic
1146237456 17:31180642-31180664 CTGAATGGGCAAAAACTGGAAGG + Intronic
1146830204 17:36062317-36062339 TGGCTTCTGCAGAAACTGGATGG + Intergenic
1148703202 17:49604509-49604531 TCCCATGAGCAAACCCTGGAAGG + Intronic
1151201798 17:72473992-72474014 TGGCATTTGCAGCAACTGGATGG + Intergenic
1155258741 18:24021397-24021419 TCACTTGTTCAGAAACTGGAAGG - Intronic
1157138456 18:45082085-45082107 TGGCATGTGCCAAAAATGCAGGG + Intergenic
1158326223 18:56316229-56316251 TGGCATGTCCAAAATCTGCAGGG - Intergenic
1159079925 18:63725494-63725516 TGGCAAGTGCAAAATCTGCAGGG + Intronic
1159748980 18:72277045-72277067 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1164509384 19:28885138-28885160 GCGCATGTGCAAAAACCACAGGG - Intergenic
926421851 2:12707779-12707801 TCTCAGGTGCAAAAATTGAAAGG - Intergenic
933277977 2:80303283-80303305 GCGCACGGGCACAAACTGGATGG + Exonic
933567438 2:83968481-83968503 TGGCAAGTGCAAAATCTGCAGGG + Intergenic
934123553 2:88863889-88863911 TTGTAGGTGCAAAAACTTGAGGG + Intergenic
936415210 2:112301523-112301545 TCTCATGTGAAAAAAATGGATGG - Intronic
936577390 2:113667994-113668016 TCTCATGTGCAAAGACAGCAAGG - Intergenic
937105020 2:119303322-119303344 TTGCATGTTTAATAACTGGAAGG - Intronic
937170823 2:119866431-119866453 TTGCATGAGAAACAACTGGAAGG + Intronic
937700482 2:124858101-124858123 CTGAATGGGCAAAAACTGGAAGG + Intronic
937834032 2:126453466-126453488 CTGAATGGGCAAAAACTGGAAGG - Intergenic
938651164 2:133385141-133385163 CTGAATGGGCAAAAACTGGAAGG - Intronic
939698744 2:145362515-145362537 TGGCATGGGCAAAATCTGCAAGG - Intergenic
939874192 2:147557709-147557731 AAGCATGTGTAGAAACTGGAAGG - Intergenic
941440770 2:165532606-165532628 CTGAATGGGCAAAAACTGGAAGG + Intronic
943106382 2:183549027-183549049 TGGAATGGGCAAAAACTAGAAGG + Intergenic
943353595 2:186823433-186823455 TGGCCCTTGCAAAAACTGGAAGG + Intergenic
943398039 2:187366654-187366676 TCACATGTGAAAAGATTGGAAGG + Intronic
944281853 2:197907084-197907106 CCGAATGGGCAAAAGCTGGAAGG + Intronic
944316062 2:198286930-198286952 TGGCAAGTCCAAAATCTGGAGGG - Intronic
944632885 2:201644307-201644329 TCGCATGTGCAAATTTTGGAGGG + Intergenic
946734031 2:222736516-222736538 TGGCAGATGCTAAAACTGGAAGG - Intergenic
1173581740 20:44151867-44151889 TAGCATGTGCAAAGACATGAAGG - Intronic
1178522468 21:33297945-33297967 TGGCAAGTTCAAAAACTGCAGGG + Intergenic
1180879121 22:19191494-19191516 TCATTTGAGCAAAAACTGGAAGG - Intronic
1182265996 22:29115820-29115842 TAGCATGTGCAAAAACCCGGAGG + Intronic
1182705926 22:32280315-32280337 TCCCAGGATCAAAAACTGGAGGG - Intergenic
1184394253 22:44223387-44223409 TCCCAGGATCAAAAACTGGAGGG - Intergenic
1184703296 22:46192411-46192433 GGGCAGGTGCAAACACTGGAAGG - Intronic
1185422841 22:50744670-50744692 TCTCATGTGCAAAGACAGCAAGG + Exonic
949262539 3:2119224-2119246 TGGCAAGTGCAAAATCTGCAGGG - Intronic
949570656 3:5289543-5289565 TGGCAAGTCCAAAAACTGCAGGG - Intergenic
949708656 3:6848253-6848275 TCCCATGTGTAAAAACTTGAGGG + Intronic
950166191 3:10801586-10801608 TCACATTTGCAAAAAATGCATGG + Intergenic
955254849 3:57320620-57320642 TCACACCTGCAGAAACTGGAAGG + Intronic
957092774 3:75748738-75748760 CTGAATGGGCAAAAACTGGAAGG + Intronic
961582179 3:127891974-127891996 TCTCATGTTAAAATACTGGAAGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
966966798 3:185002753-185002775 TGGCATTTGCACAATCTGGATGG - Intronic
967228605 3:187316847-187316869 TAGCTTGTGCAAATACAGGAGGG - Intergenic
974394748 4:61320444-61320466 TCCCAAGTGCAAAATCTGTAGGG + Intronic
974504183 4:62746899-62746921 CTGAATGGGCAAAAACTGGAAGG + Intergenic
974759466 4:66256365-66256387 CTGAATGGGCAAAAACTGGAAGG - Intergenic
976668680 4:87627741-87627763 TGGCAAGTCCAAAAACTGCAGGG - Intergenic
977723186 4:100264626-100264648 CTGAATGGGCAAAAACTGGAAGG - Intergenic
978996033 4:115154293-115154315 TCACATGAGCAAAACTTGGAAGG - Intergenic
979896643 4:126166008-126166030 CTGAATGGGCAAAAACTGGAAGG - Intergenic
981453302 4:144924417-144924439 TGTCATTTGCAATAACTGGATGG - Intergenic
986679753 5:10222090-10222112 TAGCATGTCCAAAAACAGGAAGG + Intergenic
987275565 5:16358621-16358643 CCGAATGGGCAAAAGCTGGAAGG - Intergenic
989412583 5:41137418-41137440 CTGAATGGGCAAAAACTGGAAGG + Intergenic
989712564 5:44417515-44417537 TGGCAAGTGCAAAATCTGCAAGG - Intergenic
991432333 5:66561478-66561500 TAGCAGGGGCAACAACTGGAGGG - Intergenic
995797678 5:115959149-115959171 TTGCATGAGGAAACACTGGAAGG + Intergenic
996305333 5:122039716-122039738 TTGCTTGTGTAAAGACTGGATGG - Intronic
996929251 5:128866557-128866579 TCGTAATTGCAAAAACTGGATGG + Intronic
997070053 5:130611050-130611072 CTGAATGGGCAAAAACTGGAAGG + Intergenic
997544385 5:134693499-134693521 CTGCATGTGCAAGAACTGTAAGG + Intronic
999798175 5:155007504-155007526 CAGCTTGTGCATAAACTGGAGGG + Intergenic
1000530257 5:162410547-162410569 AGGCATGTGCAGAGACTGGATGG - Intergenic
1004859314 6:19784945-19784967 TACCATGTTCACAAACTGGAAGG + Intergenic
1006980431 6:38143293-38143315 TGGCATGTGTACAAACTGCATGG + Intronic
1009682470 6:66915357-66915379 TTGGATATGCAAAATCTGGAAGG + Intergenic
1010831098 6:80530519-80530541 TCTCATCTGTAAAATCTGGAAGG - Intergenic
1011140942 6:84155754-84155776 TCCCATGTGCATAGACTGGAAGG + Intronic
1013047134 6:106497707-106497729 TCACATTTGAAAAAACTGCAGGG - Intergenic
1013871467 6:114766837-114766859 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1015103437 6:129507957-129507979 TCTCATCTCCAGAAACTGGAAGG - Intronic
1018614891 6:165677331-165677353 TGGCATGTGGAAAAGCTGCAGGG - Intronic
1021279096 7:18694797-18694819 TTCCATTTGCATAAACTGGAGGG - Intronic
1023798230 7:43811308-43811330 TCTCATGTTAAAATACTGGAAGG + Intergenic
1023875753 7:44285409-44285431 TTGCAGGTGCAAACACAGGAGGG - Intronic
1027436765 7:78172829-78172851 TAGAATGTGGAAAAGCTGGAAGG + Intronic
1027560826 7:79727961-79727983 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1029095411 7:98081415-98081437 ACGCATATTCATAAACTGGAAGG - Intergenic
1030368647 7:108673121-108673143 TGGCCTGTGCAGAAAATGGATGG + Intergenic
1030829582 7:114204548-114204570 TCGCATGTGAAAAACGGGGAAGG - Intronic
1031094564 7:117403278-117403300 TGGCCTGTGCAAAAACCTGACGG - Intronic
1031104190 7:117519623-117519645 TCCCATGGGAAAAAGCTGGAAGG - Intronic
1031679944 7:124659495-124659517 GCTCATATGCAAAAACTGGGTGG + Intergenic
1033813721 7:145047766-145047788 TGTCATGTGCAAAACATGGATGG - Intergenic
1034053607 7:148010792-148010814 TTGCATGTATAAAAACTTGATGG - Intronic
1035770297 8:2141918-2141940 TCGGATGTGCGAAGACTCGATGG - Intronic
1036105100 8:5830004-5830026 TCTCATGTTAAAACACTGGAAGG - Intergenic
1036846697 8:12175133-12175155 GCTCAAGTGCAAAAACTGCAGGG - Intergenic
1038711758 8:29953425-29953447 TCACATATGCATAAGCTGGAAGG - Intergenic
1038884712 8:31650464-31650486 TGGCATATGTAAAAACAGGAGGG - Intronic
1043109792 8:76166707-76166729 TCACATGTCCAAATAGTGGATGG - Intergenic
1044751564 8:95421559-95421581 TGGCAGTTGCAAAAACTGGGCGG - Intergenic
1045396242 8:101763405-101763427 TGGCTTGAGCTAAAACTGGAAGG + Intronic
1045726682 8:105182135-105182157 CTGAATGGGCAAAAACTGGAGGG - Intronic
1047205567 8:122800424-122800446 TGGCTTCTGCAAAGACTGGAAGG + Intronic
1047565204 8:126036636-126036658 TCCTATGTGCAAAAGCTGGCAGG + Intergenic
1051345060 9:16144001-16144023 TGGCAAGTGCAAAATCTGCAGGG + Intergenic
1051454265 9:17235916-17235938 TTGCATGTGAGAAAACTGTATGG - Intronic
1052412830 9:28144877-28144899 TCCCAGTTACAAAAACTGGATGG + Intronic
1052598234 9:30590256-30590278 TAGAATGTTCAAAAACTTGAGGG + Intergenic
1053041221 9:34874290-34874312 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1055386065 9:75763247-75763269 ACACATGTGCAAAAACAGCAGGG + Intergenic
1058210643 9:102164448-102164470 TCACATGTTCTAAACCTGGATGG - Intergenic
1058482084 9:105406098-105406120 ATGAATGTGCAAAGACTGGAAGG + Intronic
1061344009 9:130007364-130007386 TTGGATGTGCAACAAATGGAAGG + Intronic
1203357935 Un_KI270442v1:179562-179584 TTGAATGGGCAAAAACTGAAAGG + Intergenic
1191148529 X:57194886-57194908 TGGCATTTGCAGCAACTGGATGG - Intergenic
1192281139 X:69687428-69687450 TCTCATGTTCATAGACTGGAGGG - Intronic
1192973437 X:76257471-76257493 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1193035000 X:76939915-76939937 CTGAATGTTCAAAAACTGGAAGG - Intergenic
1193965692 X:87983355-87983377 GTGCATGTGCAAAAAAGGGAAGG - Intergenic
1195116736 X:101706872-101706894 TGGCATGTGCAAAAACTAGGAGG + Intergenic
1195741476 X:108069004-108069026 TTAAATGTTCAAAAACTGGAGGG + Intronic
1197426439 X:126302741-126302763 TAGCATGTGCAAAAGCATGACGG + Intergenic
1199186881 X:144925559-144925581 TTGAATGGGCAAAAGCTGGAAGG + Intergenic
1199510206 X:148613232-148613254 TTGCAGGTGCAAAATCTTGATGG + Intronic
1200087647 X:153616615-153616637 TGGAAAGTGCAAAACCTGGATGG + Intergenic
1200813802 Y:7511028-7511050 CTGAATGGGCAAAAACTGGAAGG - Intergenic
1201238641 Y:11936234-11936256 CTGAATGGGCAAAAACTGGAAGG + Intergenic
1201464854 Y:14269361-14269383 CTGAATGGGCAAAAACTGGAAGG - Intergenic