ID: 1089783189

View in Genome Browser
Species Human (GRCh38)
Location 11:120888949-120888971
Sequence ATCAAAAACAAGTCCAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 519}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089783189_1089783192 -10 Left 1089783189 11:120888949-120888971 CCTTCCCTGGACTTGTTTTTGAT 0: 1
1: 0
2: 5
3: 33
4: 519
Right 1089783192 11:120888962-120888984 TGTTTTTGATCTCTTACCCTTGG 0: 1
1: 0
2: 2
3: 25
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089783189 Original CRISPR ATCAAAAACAAGTCCAGGGA AGG (reversed) Intronic
900805176 1:4762960-4762982 ATCAATAACAAAGCCAGGGAGGG - Intronic
901289419 1:8111635-8111657 ATTAAAAATAAGGCCAGGCATGG - Intergenic
901726219 1:11244334-11244356 ATAAAAAACCAGTACAGGGTCGG + Intronic
902593955 1:17495281-17495303 AAAAAAAAAAAGTCCAGGCACGG - Intergenic
903401844 1:23058642-23058664 ATGAAAAACAATACCAGGGATGG - Intronic
903598298 1:24513692-24513714 ATCAAAAAGAGGGCCAGGTACGG - Intronic
903656788 1:24954418-24954440 AGCCCACACAAGTCCAGGGAAGG + Intronic
903937061 1:26903086-26903108 ATAAAAAACAAATCCAGGCTTGG - Intronic
903945384 1:26959626-26959648 ATCAACGAGAAATCCAGGGAGGG - Intronic
904738756 1:32655265-32655287 AACAAAAACAGGGCCAGGCACGG - Intronic
904784011 1:32972161-32972183 ATGTAAAACAAGTCCTGGGGAGG - Intergenic
905094080 1:35454137-35454159 ACCAACAACAAGCCAAGGGAAGG + Intronic
905377388 1:37532391-37532413 AAAAAAAAAAATTCCAGGGATGG + Intergenic
905842696 1:41197588-41197610 ATTAAAAAAAATTCTAGGGATGG + Intronic
906403830 1:45525610-45525632 TTCAAGAACAAGGCCAGGCACGG + Intergenic
907416747 1:54319639-54319661 ATCATTAACAAATTCAGGGAGGG - Intronic
907530799 1:55094706-55094728 AAAAAAAAAAAGTCCAGGTATGG + Intronic
907535288 1:55148457-55148479 ATCAAAAGCAAGACAAGGTAAGG - Exonic
908130309 1:61068540-61068562 ATAAAATTCAAGGCCAGGGAAGG - Intronic
909002885 1:70240759-70240781 AAAAAAAAAAAGTCCAGTGATGG - Intronic
909013572 1:70359862-70359884 ATCAAAAAGAAGACAAAGGAGGG - Intronic
909616933 1:77621523-77621545 AAAAAAAAAAAGTCCAGGCATGG + Intronic
910452216 1:87358826-87358848 ATCAACAACAGGTGCAGTGATGG - Intergenic
911319374 1:96394393-96394415 ATCAAAAACAATTCCTGAGATGG + Intergenic
912179456 1:107200928-107200950 AGCAAACACAATTCAAGGGAGGG - Intronic
913403521 1:118462388-118462410 ATAAAAGATAAGGCCAGGGAGGG - Intergenic
913770811 1:122250683-122250705 ATCACAAAGAAGTTCTGGGAAGG - Intergenic
913772525 1:122273749-122273771 ATCACAAAGAAGTTCTGGGAAGG - Intergenic
913776006 1:122320401-122320423 ATCACAAAGAAGTTCTGGGAAGG - Intergenic
914443142 1:147724213-147724235 ACCAAAGACAAGTTCAGGGAAGG + Intergenic
915919835 1:159967279-159967301 ATAAAAATCAACTCAAGGGAGGG - Intergenic
916033830 1:160903347-160903369 ATAGAAAACAAGGCCAGGCATGG + Intergenic
916441734 1:164833136-164833158 AGCAAAAAAAAGTTCAGAGAAGG + Intronic
916935953 1:169628448-169628470 ATTAAAAACCATTCCAGGGCTGG + Intronic
916962880 1:169906913-169906935 ATCAAAATCACATCCAGGCATGG + Intergenic
917786278 1:178461102-178461124 ATAAAAAACTAGGCCAGGCACGG - Intronic
917905520 1:179584167-179584189 AACAAAAACAAATCCAGGCCGGG + Intergenic
919627697 1:199928153-199928175 AACAAAAAAAAGGCCAGGCACGG + Intergenic
919904604 1:202069540-202069562 AAAAAAAAAAAGTGCAGGGAAGG + Intergenic
920913388 1:210237876-210237898 ATCAAGAGCAAGCCAAGGGACGG - Intronic
923074361 1:230596533-230596555 ATCAACACCAAGTCCAGACACGG - Intergenic
923373297 1:233334153-233334175 AAAAAAAAAAAGTCCAGGCACGG - Intronic
1063007716 10:1989747-1989769 ATCAGACAGGAGTCCAGGGAAGG + Intergenic
1063495666 10:6505319-6505341 TTGAAAAACAATTCCATGGATGG - Intronic
1063580777 10:7304730-7304752 GTCAAAAACAAATTCAGGAAAGG + Intronic
1064419317 10:15177133-15177155 ATAATAAACAAGGCCAGGCACGG - Intergenic
1064538064 10:16378473-16378495 ATCATAAACAACTGCAGTGATGG - Intergenic
1064965388 10:21010949-21010971 ATCTGAGACCAGTCCAGGGAAGG + Intronic
1065265582 10:23971752-23971774 ATCAAGAAAAAGACCTGGGAAGG - Intronic
1066120363 10:32280448-32280470 CTCAAAAAAAAGGCCAGGCACGG + Intronic
1066506029 10:36044837-36044859 ACCCAAAGCAAGTGCAGGGAAGG - Intergenic
1067734985 10:48843807-48843829 ATTAAAAACATCTCCTGGGATGG - Intronic
1068243247 10:54333234-54333256 ATGAAAATCTAGGCCAGGGATGG - Intronic
1069563855 10:69450554-69450576 AACAAAAACAAGGCCGGGCACGG - Intergenic
1069729566 10:70602049-70602071 ATCATAAACAGGCCCAGGCAAGG - Intronic
1070696848 10:78570158-78570180 AGCAAAGGCAAGTCCAGGGATGG - Intergenic
1072366821 10:94719862-94719884 ATCAAAAACTTGGCCAGGCATGG - Intronic
1073369886 10:102978197-102978219 AAAAAAAAAAAGTCCAGGCATGG - Intronic
1073650800 10:105355905-105355927 ATCAAAAACAAATGCTGGGTTGG - Intergenic
1074362891 10:112837324-112837346 CTCAAAAAAAAATCCTGGGAGGG + Intergenic
1075215120 10:120525891-120525913 ACCAAAAACAAATCCCGGTAAGG - Intronic
1076012164 10:126998143-126998165 TTCACAAACAAGGCCAGAGAAGG - Exonic
1076459887 10:130634802-130634824 TTAACAAACCAGTCCAGGGAGGG - Intergenic
1078236057 11:9485628-9485650 AACAAAAACAAGGCCAGGCACGG - Intronic
1078992257 11:16661534-16661556 AAGAAAAAAAAGACCAGGGAAGG - Intronic
1079587348 11:22142320-22142342 ATCAAAGCCAAGTCCTGGGGTGG + Intergenic
1079705155 11:23606669-23606691 AACAAAAACAAGTCTTGAGAAGG - Intergenic
1080472591 11:32560626-32560648 ATATAAAACAAGCCCAGGCACGG + Intergenic
1084039873 11:66536264-66536286 AACAACAACGAGTCCAGGCATGG + Intronic
1086228032 11:84536012-84536034 AACAAGAACCACTCCAGGGATGG + Intronic
1087978238 11:104577093-104577115 ATCAAAAACAACTGCAGTGGTGG - Intergenic
1088425889 11:109701968-109701990 ACAAAAAACAAGTCCTGGCAAGG + Intergenic
1088651918 11:111965098-111965120 ATCTAAACCAAGGCCAGAGAAGG + Intronic
1089319509 11:117615483-117615505 ATAAGAAGCAAGTGCAGGGAGGG + Intronic
1089339061 11:117745348-117745370 AACAAAAACAAAACCAGGGCAGG + Intronic
1089783189 11:120888949-120888971 ATCAAAAACAAGTCCAGGGAAGG - Intronic
1090962597 11:131570532-131570554 TTCAAAAACAAGGCCAGGCGCGG + Intronic
1091915943 12:4271983-4272005 ATCAAAAGGAAGCCAAGGGAGGG - Intergenic
1092702488 12:11247717-11247739 ATCACAAACCAGTCCTGGAATGG + Intergenic
1093087490 12:14882675-14882697 ACCAAAAAAAAAACCAGGGAGGG + Intronic
1093132810 12:15413081-15413103 AACAAAAACAAGGCCGGGCATGG - Intronic
1094031968 12:26022361-26022383 AACAAAGACAAGCCCAGAGAGGG + Intronic
1096274233 12:50191851-50191873 AACAAAAACAAGGCCAGGTGTGG + Intronic
1097776117 12:63648420-63648442 AAAAAAAAAAAGCCCAGGGAAGG - Intronic
1098340963 12:69450803-69450825 ATAAAAAATAAGGCCAGGCATGG + Intergenic
1099628082 12:85102277-85102299 AGGAAAAAAAAGTCAAGGGAAGG - Intronic
1100197736 12:92266493-92266515 CTTAAAAATAAGTCCAGGGCTGG - Intergenic
1100273424 12:93048044-93048066 AACAAAAACAAGGCCAGGCATGG + Intergenic
1100601778 12:96117805-96117827 AGCAGAACCAAGTCCAGTGATGG + Intergenic
1101379111 12:104198689-104198711 ATCAAAAAGAAGGCCAGGCGTGG + Intergenic
1102577183 12:113863142-113863164 CTCATAAACAAGTCGGGGGATGG + Intronic
1102748220 12:115268760-115268782 CACAAAAAGAAGTCCAGTGAAGG - Intergenic
1103109406 12:118262191-118262213 ATGAAAATCAAGGCCAGGCACGG + Intronic
1103135689 12:118505413-118505435 AACAAAAACAGGGCCAGGCATGG - Intergenic
1103395595 12:120604457-120604479 AACAAAAAAAAGGCCAGGCATGG + Intergenic
1104682499 12:130761300-130761322 AGCAAAAACGAGTCCAAGCATGG - Intergenic
1105827153 13:24132991-24133013 AACAAAAACAAGTCTAGGAAAGG + Intronic
1106464358 13:29999582-29999604 AGTAAACACAAGTCCAGGTATGG - Intergenic
1106503469 13:30351351-30351373 ATCATAAACCAGGCCAGGCACGG + Intergenic
1107224663 13:38032812-38032834 AATAAAAACAAGGCCAGGCATGG + Intergenic
1107913605 13:45127624-45127646 AAAAAAAACAAGGCCAGGGGTGG - Intronic
1108518655 13:51224844-51224866 CTGAGAAACAAGGCCAGGGAGGG - Intronic
1108955033 13:56142652-56142674 ATTAAAAACAATACCAGGGCAGG + Intergenic
1109489070 13:63071211-63071233 ATCAGTAAGAAGGCCAGGGAGGG - Intergenic
1109587798 13:64431467-64431489 AACAAATAAAACTCCAGGGATGG + Intergenic
1109890012 13:68599451-68599473 ATCAAAATCAAGTCCGGGTGTGG + Intergenic
1110956755 13:81562051-81562073 AACAAAAACAAAGCCAGGCATGG + Intergenic
1111121660 13:83859520-83859542 ATTAAAAACAAGTCCAGAGAGGG - Intergenic
1111877667 13:93917198-93917220 TTCAAAAACAAGTCATGGCAGGG + Intronic
1112487325 13:99831789-99831811 TACCAAAACAAGGCCAGGGATGG - Intronic
1112801633 13:103117638-103117660 ATCAAAAACAAATCCTTGAATGG - Intergenic
1112859728 13:103815472-103815494 ATCAGAAACAAGGCCATGAAAGG + Intergenic
1112902201 13:104370861-104370883 ATTAAAAACAAGTCCAAGGTAGG + Intergenic
1114638256 14:24201117-24201139 AACAAAAAAAAGGCCAGGCACGG - Intronic
1116196535 14:41734299-41734321 ATATAAAACCAGTCCAGGAAAGG - Intronic
1117343704 14:54812881-54812903 GGCAAAAACAATTCCAGGGAGGG + Intergenic
1117517556 14:56517462-56517484 AAAAAAAATAAGTCAAGGGAAGG + Intronic
1117783840 14:59261838-59261860 AACAAAAAAAAGTTCAAGGAAGG + Intronic
1118215192 14:63802401-63802423 ATCAAAAACAAGTCTGTGGCCGG - Intergenic
1120014093 14:79450566-79450588 ATTAAAAATAAGGCCAGGGGCGG + Intronic
1120477013 14:85001397-85001419 GTCAACATCAAGTGCAGGGATGG - Intergenic
1120635917 14:86950750-86950772 ATGAAAAACAAGTAGAGGCATGG - Intergenic
1121560567 14:94872242-94872264 GTCAAAGACCAGTCCTGGGATGG - Intergenic
1122399872 14:101460543-101460565 ATCAAAAACAGGTCAATGGCTGG + Intergenic
1122720515 14:103719462-103719484 AAAAAAAAAAAGTCCAGGTAAGG + Intronic
1123686794 15:22803967-22803989 AACAAAAACAAGGCCGGGCACGG - Intronic
1124152621 15:27195608-27195630 AACAAAAACATGGCCAGGCATGG - Intronic
1124220891 15:27848628-27848650 ATCAAAAACAGAGCCAGGCATGG - Intronic
1124602320 15:31145010-31145032 CTCAAAAACAAGGCCGGGGCTGG - Intronic
1125023657 15:35009245-35009267 AAAAAAAACAAGGCCAGGTACGG - Intergenic
1125807861 15:42509776-42509798 ATTATAAACAAGGCCAGGCACGG + Intronic
1126128440 15:45317000-45317022 ATTAAAAATAAGGCCAGGCATGG - Intergenic
1126870290 15:52980044-52980066 ATTAAAATAAAGTTCAGGGAGGG - Intergenic
1127844948 15:62861768-62861790 AACAGAAACCAGTCCAGGCAGGG - Intergenic
1127968098 15:63938852-63938874 ATCAAAAGCTAGTTCAGAGAAGG + Intronic
1128358089 15:66942513-66942535 AAAAAAAAAAAGTCCAGGCATGG + Intergenic
1128456221 15:67833069-67833091 CGCAGAAACAACTCCAGGGATGG - Intronic
1129140137 15:73590463-73590485 ATAAAAAACAAGTCTAAGGCTGG + Intronic
1129387628 15:75204453-75204475 AAAAGAAAAAAGTCCAGGGAGGG - Intronic
1129744776 15:78010504-78010526 ATGGAAAAAAAGTCCAGGAAGGG + Intronic
1129817682 15:78569726-78569748 TTCAAAAACAATTCCAGGCCGGG - Intronic
1130441285 15:83956364-83956386 ATTAAAAACAAGTACTGTGATGG + Intronic
1131076690 15:89499689-89499711 TTCAAAAACAAGTCCTGGCCGGG + Intergenic
1132082449 15:98878700-98878722 AACAAAAAAAAGGCCAGGCACGG + Intronic
1132735099 16:1381964-1381986 AACAAAAACAAACTCAGGGAAGG + Intronic
1134191982 16:12128740-12128762 AGCAAAAACAAGGCCGGGCAGGG - Intronic
1134406107 16:13960078-13960100 ATCATAAGCAAGTCCATGCATGG - Intergenic
1134411800 16:14009238-14009260 ATAAAAAATAAGGCCAGGCATGG - Intergenic
1134691205 16:16192019-16192041 AGCAAAAACAATCCCAGGGCAGG + Intronic
1134744493 16:16577308-16577330 AACAAAAACATGTGGAGGGAGGG - Intergenic
1134796500 16:17042033-17042055 ATCAAAAAGAAGTCTAGGCCAGG + Intergenic
1135000994 16:18776444-18776466 AACAAAAACATGTGGAGGGAGGG + Intergenic
1135472743 16:22746118-22746140 AACAAAAAAAAATCCAGGTATGG + Intergenic
1135765118 16:25170938-25170960 ATAAAAAACAAGGCCAGGCACGG + Intronic
1136722429 16:32336796-32336818 AGTAAAAACATGGCCAGGGAGGG + Intergenic
1136840743 16:33542768-33542790 AGTAAAAACATGGCCAGGGAGGG + Intergenic
1137375457 16:47948260-47948282 CTCAAAAAAAAGCCCAGGTATGG - Intergenic
1138003921 16:53312640-53312662 ATCAAAAACAGATCTAGGGCAGG + Intronic
1138196988 16:55059138-55059160 ATGAAATACAAATCCAGGTAAGG + Intergenic
1139535256 16:67568368-67568390 AACAAAAAAAAGGCCAGGCATGG - Intronic
1139920980 16:70460399-70460421 AAAAAAAAGAAGTCCAGGCACGG - Intronic
1140498407 16:75410616-75410638 ACAAAAAAAAAGTCCAGGCACGG + Intronic
1140512853 16:75520608-75520630 AACAAAAAAAAGGCCAGGCATGG + Intergenic
1140703411 16:77603595-77603617 ACAAAAAGCAAGTCCGGGGAAGG + Intergenic
1140812654 16:78593329-78593351 ATCAGTATCAAGGCCAGGGATGG - Intronic
1140836939 16:78803601-78803623 GTTAAAAACATGTCCAGGTATGG - Intronic
1140864328 16:79046741-79046763 CTCAAAAAGAAATCCAGGGCTGG + Intronic
1141956506 16:87375575-87375597 AACCAAAACAAGCCCAGGCAGGG + Intronic
1142360323 16:89623109-89623131 CTCAAAAACATGTTTAGGGAAGG - Intronic
1203004002 16_KI270728v1_random:180968-180990 AGTAAAAACATGGCCAGGGAGGG - Intergenic
1203135610 16_KI270728v1_random:1717375-1717397 AGTAAAAACATGGCCAGGGAGGG - Intergenic
1203150908 16_KI270728v1_random:1843065-1843087 AGTAAAAACATGGCCAGGGAGGG + Intergenic
1142782989 17:2196128-2196150 ATCAAAGACAAAGCCAGGCATGG + Intronic
1142856390 17:2732721-2732743 ATTAAAAAAAAGGCCAGGCACGG + Intergenic
1143075919 17:4343294-4343316 ATTAATAACAAGTCCAGGCCAGG + Intronic
1143269375 17:5664570-5664592 AACAAAAACAAGGCCGGGCAAGG + Intergenic
1143589602 17:7874292-7874314 TTCAAAAGGAAGTCCAGAGATGG + Intronic
1144252975 17:13438233-13438255 GTGAAATACAAGTCCAGGGAAGG - Intergenic
1144689929 17:17254519-17254541 ATGAAAATCAAGGCCAGGCACGG + Intronic
1144708013 17:17382678-17382700 AAAAAAAAAAAGTCCAGGAAAGG - Intergenic
1145276669 17:21435515-21435537 TTGAAAAACAAGGCCAGGGGAGG + Intergenic
1145712961 17:26993379-26993401 TTGAAAAACAAGGCCAGGGGAGG + Intergenic
1145874850 17:28309928-28309950 ATCAAGAACATATCCAGGCATGG - Intergenic
1146137291 17:30333932-30333954 ATTAAAAACAAGCCAAGTGAGGG - Intronic
1147225509 17:38973723-38973745 ACAAAAAAAAACTCCAGGGAAGG + Intergenic
1147282324 17:39372228-39372250 ACCAAAAAAAAGGCCAGGCACGG + Intronic
1147287820 17:39417038-39417060 AAGAAAAAAAAGTCCAGGCATGG + Intronic
1147413332 17:40269998-40270020 TTCCAAAAGAAGTCCTGGGATGG - Intronic
1147641784 17:42006808-42006830 AAAAAAAAAAAGTCCAGGCACGG + Intronic
1147750503 17:42729436-42729458 AACAACAAGAAGTCCAGGCACGG + Intronic
1147770812 17:42866754-42866776 ATCAAAAACTAGAGGAGGGAAGG + Intergenic
1148398190 17:47327451-47327473 ATAAAAAAAAAGGCCAGGTATGG - Intronic
1148499484 17:48078776-48078798 AAAAAAAAAAAGTCCAGGCACGG - Intronic
1148974535 17:51515539-51515561 ATTATTAAGAAGTCCAGGGATGG - Intergenic
1149665437 17:58361900-58361922 TTTAAAAGCAAGTCCAGAGAAGG - Intronic
1149889320 17:60372547-60372569 AAAAAAAAAAAGTCCAGGCACGG + Intronic
1150923201 17:69505149-69505171 ACAAAAAACAAGGCCAGGCATGG + Intronic
1151257992 17:72894377-72894399 AAAAAAAAAAAGGCCAGGGACGG + Intronic
1151592420 17:75054301-75054323 ATCAAAATCAAGGCCAGGTGCGG - Intronic
1152359647 17:79825685-79825707 ATCATAACCAAGACCAGGGACGG - Intergenic
1152990831 18:362325-362347 ATTAAAAAGAAGTCAGGGGAGGG - Intronic
1153693533 18:7616980-7617002 ATCAAACAGAAGTACAGAGAGGG + Intronic
1153954660 18:10086174-10086196 ACCTAAAGCAAGTCCAGTGATGG + Intergenic
1154382383 18:13864219-13864241 TACAAAAGCAAGTCCAGGAAGGG + Intergenic
1154410539 18:14139079-14139101 ATCAAGACCCAGTCCAGGTATGG + Intergenic
1154950610 18:21205915-21205937 CTGAGAAACAAGGCCAGGGAAGG - Intergenic
1155690430 18:28615521-28615543 ATCTATAAGAAATCCAGGGAAGG - Intergenic
1155971386 18:32086940-32086962 ATCAAAGACAAGGCCAGGCATGG - Intergenic
1156071908 18:33221703-33221725 ATCAAAAGCAAAGCCAGTGAAGG + Intronic
1156826290 18:41434129-41434151 ATAAAAAACAATTCCAGGCTGGG + Intergenic
1157322096 18:46642455-46642477 AGCAAAAGCAAGGCCAGTGATGG - Intronic
1157859560 18:51128624-51128646 AAAAAAAAAAAGTCCAGGGGAGG + Intergenic
1158318077 18:56234516-56234538 AACAATAAGCAGTCCAGGGAAGG + Intergenic
1158987750 18:62836069-62836091 ATCAAGAACAAGGCCGGGCACGG - Intronic
1162015082 19:7841299-7841321 ATCAAGATCAAGGCCAAGGAGGG + Intronic
1162519213 19:11169510-11169532 AACAAAAACAAGACCAGGCATGG + Intronic
1162761073 19:12888439-12888461 AACAAAAACAAGGCCAGGTGCGG + Intergenic
1162959861 19:14119099-14119121 ATCAACCACAGTTCCAGGGAGGG + Intergenic
1163812411 19:19441852-19441874 AACAAAAACCAGGCCAGGCACGG - Intronic
1164115823 19:22217650-22217672 ATCAAAAAATAGGCCAGGCACGG - Intergenic
1164199500 19:23004936-23004958 ATCAAAAACTAGGCCAGGCATGG - Intergenic
1164300798 19:23961129-23961151 ATGAAAAATAAGTCCATGAAAGG + Intergenic
1165014242 19:32869275-32869297 ATCAGAATCAAGTCCAGGTAAGG + Intronic
1165148488 19:33747796-33747818 ACAAAAAACAAGTCTAAGGAAGG + Intronic
1165677166 19:37736544-37736566 ATGAAAAAGAGGTCCAGGAAAGG + Intronic
1165844776 19:38811194-38811216 ATAAAAAATAAGTCCAGGCCGGG - Intronic
1166521554 19:43483959-43483981 ATGGAAAACAAGGCCAGGCACGG + Intronic
1166823457 19:45594984-45595006 AAAAAAAAGAAGTCCAGGCACGG + Intronic
1167133809 19:47604947-47604969 AACAAAAACAAGTCCGGGCGCGG - Intergenic
1167322213 19:48804251-48804273 ATAAAAAATAAGGCCAGGCATGG + Intronic
1167596252 19:50429711-50429733 AACAAAAACAAGGCCGGGCACGG + Exonic
1168294387 19:55371654-55371676 ACCAAAAACGAGGCCAGGCACGG - Intergenic
1168660936 19:58165688-58165710 AACAAAAACAAGGCCAGGCGCGG - Intergenic
926451035 2:13004328-13004350 ATCAATAACATGTCCAGAAAGGG + Intergenic
926674616 2:15610848-15610870 AAAAAAAACAAGTCTGGGGAAGG - Intronic
926770433 2:16368316-16368338 GTCAAGAATAAGTCAAGGGAGGG + Intergenic
927731908 2:25481106-25481128 ATTGAAAACAAGGCCAGGTATGG + Intronic
928078371 2:28286242-28286264 ATCAAAAATAAGGCCAGGCGCGG - Intronic
928156960 2:28885673-28885695 ATCTAAAAGAAGTGCAGGCACGG + Intergenic
928317185 2:30255431-30255453 GAGGAAAACAAGTCCAGGGAGGG - Intronic
928560292 2:32476456-32476478 ACCAAAAAAAAGTCCAGAGTAGG - Intronic
928570526 2:32603318-32603340 ATCAAAAAAAATTCCAGGCCAGG + Intronic
929469270 2:42175093-42175115 AACAAAAACACGGCCAGGCACGG - Intronic
929913017 2:46108199-46108221 CTCAAAAATAAGGCCAGGCATGG - Intronic
929987121 2:46745433-46745455 ATCAAAAACATGTCTAGCTATGG + Intronic
930711854 2:54557627-54557649 ATCATAAACAACTCCAGGTCAGG + Intronic
930768010 2:55104639-55104661 AATAAAAACAAGGCCAGGCACGG - Intronic
931608021 2:64071113-64071135 AAAAAAAAAAAGTCCAGGCAAGG + Intergenic
931944398 2:67288831-67288853 ATAAAAAAAAATTCTAGGGAAGG + Intergenic
932629684 2:73328888-73328910 AACAAAAACAAATTCAGGCAAGG - Intergenic
932637243 2:73401075-73401097 ATCAAAAATGAGGCCAGGTATGG - Intronic
932698483 2:73976923-73976945 ATTAAAAATTAGTCCAGGGTGGG + Intergenic
933186037 2:79280271-79280293 ATAAAAATAGAGTCCAGGGAAGG - Intronic
933295477 2:80485745-80485767 ATCACAAAAAAGTCCAGCCAGGG + Intronic
933389754 2:81654570-81654592 ATCAAAAACTTGCCCAGGAAAGG - Intergenic
935388347 2:102524702-102524724 ATCAAAAACATGACCTGGAAAGG + Intronic
935393304 2:102578071-102578093 ATCAAAAACAAAACATGGGAAGG - Intergenic
936429580 2:112450625-112450647 ATCTAAATCAGGTCCAGGTATGG - Intergenic
936819941 2:116508459-116508481 TTAAAAAACAAGACCAGGGCTGG - Intergenic
937407708 2:121646106-121646128 AACAAAAACAAAACAAGGGAAGG - Intronic
937428455 2:121818524-121818546 AACATAAACAGGTTCAGGGAGGG - Intergenic
937816711 2:126258712-126258734 AGCAAAAACGAATCCAGGAAGGG - Intergenic
937918079 2:127108996-127109018 ATAAAAAACAAGGCCGGGCACGG - Intergenic
938056959 2:128223027-128223049 GGCAAAAACAGGTCCTGGGAGGG + Intergenic
938158019 2:128958006-128958028 TTCAAAAACAAGTATCGGGAAGG - Intergenic
939017210 2:136916704-136916726 ATCAAAAAGGAGGCAAGGGAAGG - Intronic
940630085 2:156227530-156227552 ATCAAAAACAAGCAGAAGGAAGG + Intergenic
942323000 2:174752273-174752295 TTTAAAAACAAGTGCAGGGCAGG + Intronic
942677703 2:178446019-178446041 AAGAAAAACAAGGCCAGGCATGG - Intronic
942996468 2:182266906-182266928 ATCAGAAACAAGTCCAGAGATGG - Intronic
943035086 2:182734142-182734164 ATCATAAAAAAGTAGAGGGAAGG - Intronic
943140390 2:183975106-183975128 AACAAAAAAAAGTCCAGGACTGG - Intergenic
943645123 2:190401564-190401586 ATCAAACACAAGGCCAGGTGTGG + Intergenic
944650524 2:201825635-201825657 ATAAAAAAAAAGTCCCGCGATGG - Intronic
944805846 2:203280408-203280430 AAAAAAAACAAGGCCAGGCATGG + Intronic
945642796 2:212450833-212450855 AAAAAAAACAAGGCCAGGCATGG + Intronic
945701741 2:213179091-213179113 ATCAAAGACATTTCCAGGCAAGG + Intergenic
946514542 2:220397355-220397377 GACATAAACAAGTCCAGGCAGGG + Intergenic
946971524 2:225097837-225097859 ATCAATAACAAGTCCTGGTGAGG - Intergenic
947831932 2:233147540-233147562 ATCATTAAGAAGTCCAAGGATGG + Exonic
1169134091 20:3186007-3186029 AACAAAAACAAGGCCAGGCGCGG + Intergenic
1170235009 20:14093375-14093397 ATCAAAACAAAGGCCAGGCAAGG - Intronic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1171390581 20:24799160-24799182 ATCCACAAAAAGTCCTGGGATGG - Intergenic
1171478334 20:25431860-25431882 AACAAAAACAAGGCCAGGCATGG - Intronic
1171992000 20:31703786-31703808 AAAAAAAACAAGTTCAGGGCTGG - Intronic
1172541833 20:35724039-35724061 CTCAAAAACAAGGCCAGGTGTGG + Intronic
1172663101 20:36580832-36580854 AAAAAAAACAAGGCCAGGCACGG + Intronic
1173525014 20:43725345-43725367 ATAAAAACCAAGTCCAGGCCGGG - Intergenic
1173572533 20:44086772-44086794 AAAAAAAAAAAGTCAAGGGATGG - Intergenic
1173808551 20:45941875-45941897 ATTAAAAACTAGGCCAGGCATGG - Intronic
1174250870 20:49218678-49218700 ATAAAAATCAAGACCAGGCAAGG - Intergenic
1174872850 20:54199586-54199608 GTCCAAAACAAGGTCAGGGAGGG + Intergenic
1176862527 21:14019332-14019354 ATCAAGACCCAGTCCAGGTATGG - Intergenic
1177350965 21:19941338-19941360 AACAAAAACAAGGCCAGGCGCGG + Intergenic
1177747257 21:25233232-25233254 TACAAAAACAAGTCCAAGGGAGG + Intergenic
1178317445 21:31578451-31578473 ATAAAAAATAAGGCCAGGCAAGG + Intergenic
1178451606 21:32706703-32706725 ATTAAAAAAATGTACAGGGAGGG - Intronic
1178486474 21:33022949-33022971 ATCAGAAAGAAGGCCCGGGAGGG + Intergenic
1178748657 21:35279516-35279538 ATTAAGTACAAGTCCAGGCATGG + Intronic
1178795033 21:35735911-35735933 ATAAAAAATAAGGCCAGGCACGG + Intronic
1178972125 21:37189532-37189554 AACAAGAACAAGGCCAGGTACGG - Intronic
1179679546 21:43009155-43009177 AACAAAAACTAGGCCAGGCATGG + Intronic
1180208902 21:46281708-46281730 AATAAAAACAAGGCCAGGCATGG + Intronic
1180550449 22:16532678-16532700 AGTAAAAACATGGCCAGGGAGGG - Intergenic
1181384698 22:22535688-22535710 ATAAAAAACAAGGCCAGGCATGG + Intergenic
1181391063 22:22581166-22581188 AATAAAAACAAGGCCAGGCATGG - Intergenic
1181526420 22:23491580-23491602 AACAAAAAGAAGGCCAGGCACGG - Intergenic
1182224553 22:28786124-28786146 ATCAGAAAGGAGTTCAGGGAGGG - Exonic
1182390164 22:29987224-29987246 ATCAAAAAGAAGCCCAGTGCTGG - Intronic
1182681162 22:32081041-32081063 CTCCAAAACAATACCAGGGAGGG - Intronic
1183460289 22:37945821-37945843 AAAAAAAAAAAGTCCAGGCACGG + Intronic
1184172404 22:42767684-42767706 ATTAAAAAGAAGGCCATGGAGGG - Intergenic
1184487380 22:44788407-44788429 ATAAAATTAAAGTCCAGGGATGG - Intronic
1184543420 22:45146606-45146628 ATCAAGAACAAGACAAGGAAGGG - Intergenic
949822426 3:8130524-8130546 ATGAAAAATGAGTCCAGGCATGG + Intergenic
950733530 3:14984176-14984198 ATAGAAAACAAGGCCAGGCATGG - Intronic
951206073 3:19926948-19926970 AACAAAAACAAGTCCGGGCGGGG - Intronic
951334228 3:21402136-21402158 ATGATAAACAAGGCCAGGCATGG + Intergenic
951716317 3:25651260-25651282 ATCAAAAACAAAGCAGGGGAGGG + Intronic
953333005 3:42070144-42070166 ATCAAAAGCAATTCCAGGCTGGG - Intronic
953619672 3:44522282-44522304 AAGAAAAACAAGGCCAGGCACGG - Intergenic
956231859 3:67026154-67026176 TTTAAAAACAAGGCCAGGCATGG - Intergenic
956533792 3:70252787-70252809 ATCAAAAAGAAGGCCAGGCGCGG + Intergenic
956817361 3:72920423-72920445 ATTAAAAACAAGGCCAGGAGTGG - Intronic
957570322 3:81939144-81939166 CTCAAAAAAAAGTCCTGGTAGGG - Intergenic
958193652 3:90214597-90214619 AATAAAAACAAGACCAGGCACGG - Intergenic
958729946 3:97950840-97950862 ATCAAATACAAGCCCCGAGATGG + Exonic
959670512 3:108971904-108971926 ATGAACAACCAGTCCAGGAAAGG + Intronic
960296878 3:115955222-115955244 ATCAAAAACATGGCCAGGCGCGG - Intronic
961971244 3:130970681-130970703 ATAACAAATAAGTCCAGGCATGG - Intronic
962566979 3:136670760-136670782 AGAAAAAACAAGTCCGGGCATGG - Intronic
962576018 3:136755846-136755868 ATCAAAACTCTGTCCAGGGAGGG - Intergenic
962729832 3:138271239-138271261 AAAAAAAATAAGTCCTGGGAAGG - Intronic
963161786 3:142158239-142158261 AACAAAAACAAGGCCGGGCATGG - Intergenic
963446437 3:145415183-145415205 ATCAAAGAAAAGTTCAGGGCTGG - Intergenic
963554016 3:146762589-146762611 ATTAAAAATAAGTACAGTGATGG - Intergenic
963879207 3:150509327-150509349 ATCAAAGACAATTCCAGGACTGG + Intergenic
964269826 3:154943878-154943900 AACAAAAAAAAGTCCAGGACTGG + Intergenic
964653430 3:159038792-159038814 ATAAAAAAAAAGTCCTGGGAAGG - Intronic
965562467 3:170074771-170074793 AACAAAAATAAGGCCAGGCATGG - Intronic
965751994 3:171984994-171985016 ACCAAAACCAAGTCCAGGAGAGG - Intergenic
965769773 3:172169575-172169597 ATTAAAAACCACTCCATGGATGG + Intronic
966234210 3:177682711-177682733 CCCAAAAAAAAGTACAGGGAGGG - Intergenic
966738112 3:183206565-183206587 ATAAATAACAAGGCCAGGTATGG + Intronic
967042716 3:185708409-185708431 ACCAAAAACATCTCCAGGAAGGG + Intronic
967608327 3:191474981-191475003 CTCAAAACCAGGTCCAGTGATGG - Intergenic
968158725 3:196406321-196406343 TTAAAAAAAAAGTCCAGGCATGG - Intronic
969610065 4:8222662-8222684 AACAACAAAAAGTCCAGGCATGG - Intronic
970597909 4:17616668-17616690 ATTAAAAAGAAGGCCAGGGAAGG - Intronic
972640510 4:40920883-40920905 ACAAAAAACAAGGCCAGGGACGG + Intronic
972999476 4:44928144-44928166 GTCACAAGGAAGTCCAGGGATGG + Intergenic
973956190 4:56065775-56065797 ATAATGAACAAGTTCAGGGATGG - Intergenic
974317271 4:60298504-60298526 TTCAGAAAGAAGTTCAGGGAAGG + Intergenic
974626958 4:64438135-64438157 ATCAAAATCAAGTCTTGGGTGGG + Intergenic
974860071 4:67509779-67509801 AAGAAAAACAAGGCTAGGGAGGG - Intronic
975613739 4:76226011-76226033 AACAAAAAGAAGTCCAGGACCGG - Intronic
975896906 4:79104249-79104271 ATTAAAAACAACTACAGAGAAGG - Intergenic
976710992 4:88071638-88071660 AATAAAAACAAGTCCTGGGGAGG - Intronic
977150763 4:93508483-93508505 ATCAAAAACAAGGCCAGGCATGG - Intronic
978657165 4:111078072-111078094 ACCAAAAAAAAGTCCAGGACTGG + Intergenic
980688710 4:136263111-136263133 ATCAAAAAAAAGGACAAGGAGGG + Intergenic
980939492 4:139260338-139260360 ATAAAAAAAAAGTCCAGGTGTGG + Intergenic
981058940 4:140398667-140398689 ATAAAAAAAAATTACAGGGAGGG + Intronic
982079354 4:151772599-151772621 GAAAAAAAAAAGTCCAGGGAAGG - Intergenic
982488948 4:156004289-156004311 ATCAAAGAAAAGCCCAGTGATGG + Intergenic
983070491 4:163262148-163262170 ATTAAAAAGAACTGCAGGGATGG + Intergenic
983308636 4:166026394-166026416 AACAAAAACAAGGCCAGGTGCGG + Intronic
983801122 4:171930542-171930564 ATCAGGAACAAGGCCAGGCATGG + Intronic
984147953 4:176088132-176088154 ATAAAAATAAAGGCCAGGGATGG - Intronic
984554858 4:181201603-181201625 ATGGAAAACAAGCCCAGTGATGG - Intergenic
984839493 4:184054904-184054926 ATCAAACACAAGTTCAGACAAGG - Intergenic
985810893 5:2083833-2083855 ATCAAAAACAAGTAGAGTTAGGG + Intergenic
986311226 5:6552497-6552519 ATCAGAATAAAGGCCAGGGATGG - Intergenic
986694055 5:10336512-10336534 AAAAAAAAAAAGTCCAGGCACGG + Intergenic
986973174 5:13361043-13361065 TTCAAAAAACAGTGCAGGGAGGG + Intergenic
987000838 5:13657943-13657965 ATCTAAAGCAAGCCCAGGGTAGG - Intergenic
987724305 5:21678188-21678210 AACAAAAACAAGCCCTGGGGTGG - Intergenic
987789698 5:22549093-22549115 ACAAAAAACTAGGCCAGGGATGG - Intronic
989965733 5:50464653-50464675 TACAAACACAAGTCCTGGGATGG + Intergenic
990391750 5:55329462-55329484 ATCAAAAACATGGCCAGGCATGG - Intronic
990587311 5:57224746-57224768 AGCAACATCATGTCCAGGGATGG - Intronic
990990815 5:61682004-61682026 CTCAAAGAGAAGGCCAGGGATGG - Intronic
991378106 5:65987559-65987581 CTCAAAAAAAAGTCCAGGCGTGG + Intronic
991581684 5:68162232-68162254 ATTAAAAATAAGGCCAGGCACGG + Intergenic
991610808 5:68448110-68448132 ATCAAGAAAAAGTCAAGGGCAGG + Intergenic
991673351 5:69069184-69069206 ATGAAAAAAAAGCCCAAGGAAGG - Intergenic
991681026 5:69139541-69139563 ATAAAAAACAAGGCCATGGCCGG - Intergenic
991770635 5:70037663-70037685 ATAAAAAACAAGGCCGGGCATGG + Intronic
991849929 5:70913081-70913103 ATAAAAAACAAGGCCGGGCATGG + Intronic
991912166 5:71572936-71572958 ATAAAAAACAGGGCCAGGCATGG + Intergenic
994684244 5:102929748-102929770 ATCTAAAACATGCCCAGGTATGG - Intronic
995097558 5:108256802-108256824 AACAAAAACTTGTGCAGGGAAGG - Intronic
996086106 5:119306621-119306643 ATGAAAAGCAAGGCCAGGCACGG - Intronic
997625331 5:135327259-135327281 AACAAAAACAAGTCCTGGCCCGG + Intronic
997764752 5:136490299-136490321 ATCAACAACAAACTCAGGGAAGG - Intergenic
997986950 5:138509469-138509491 AACAAAAACCAGGCCAGGCATGG + Intronic
998473610 5:142402618-142402640 AATAAAAACAAGGCCAGGCATGG - Intergenic
998913528 5:146989120-146989142 ATCAAAGAAAAGTCCAGGAATGG + Intronic
999228204 5:150045105-150045127 CTAAAAAACAAGTCTGGGGATGG - Intronic
999590124 5:153135849-153135871 ACCAAAAACAAGACGAGGAATGG + Intergenic
999721523 5:154402257-154402279 ATCAAAAAGAAAGCCAGGGCAGG - Intronic
999765398 5:154736854-154736876 ATTAAAAATAGGGCCAGGGATGG - Intronic
1000263362 5:159611406-159611428 AACAAAAGAAAGTGCAGGGAAGG - Intergenic
1000798896 5:165699317-165699339 ACCCAAAACAAGTCCAGCTATGG - Intergenic
1000916079 5:167083454-167083476 ATCTAAAACAAGCTCAGTGAAGG - Intergenic
1001619498 5:173071498-173071520 AACAAAAACAAGGCCGGGCACGG - Intronic
1001910738 5:175515301-175515323 ATCAAAAGCAAACCCAGGGCCGG - Intronic
1003766182 6:9239593-9239615 ATCAAATACAATTCCAGGGATGG - Intergenic
1003962556 6:11222276-11222298 ATCTAAAAGAGTTCCAGGGAGGG - Intronic
1003989738 6:11473794-11473816 ATCAAAGACAAGTGCGGGGTAGG - Intergenic
1004659353 6:17696463-17696485 TTTAAAAACAAGGCCAGGCACGG + Intronic
1004669688 6:17784121-17784143 ATCAAAAACTGGCCCAGGGATGG + Intronic
1005056495 6:21734082-21734104 AGGAAAAAGAAGTTCAGGGAGGG + Intergenic
1005779563 6:29175487-29175509 ATCAAAAACAAGGCCGAGCACGG + Intergenic
1006080904 6:31565883-31565905 TTTAAAAACAAGTCCAGGCTGGG + Intergenic
1006080954 6:31566181-31566203 AAAAAAAAAAAGTCCAGGCAAGG + Intergenic
1006271828 6:32971137-32971159 AGAAAAAGCAAGTCCTGGGAGGG - Exonic
1006365570 6:33613228-33613250 GTGAAAAACAAGTCCTGGGCTGG - Intergenic
1006465757 6:34193801-34193823 AAAAAAAACAACTTCAGGGAAGG + Intergenic
1006476270 6:34256552-34256574 AACAAAAACAAGGCCGGGCATGG + Intergenic
1006847235 6:37071061-37071083 AACAAAAACAAGGCCGGGCACGG + Intergenic
1007560348 6:42802735-42802757 AACAAAAAAAAGGCCAGGCACGG - Intronic
1007914920 6:45552501-45552523 ATCCAAATCAAGTGAAGGGATGG - Intronic
1008147530 6:47909730-47909752 AGAAAAAAAAAGTCCAGGCATGG - Intronic
1008538685 6:52527885-52527907 AAAAAAATCAAGTCCAGGGCTGG + Intronic
1008704473 6:54141595-54141617 ATCAAAAAGTAGGCCAGGCATGG - Intronic
1011179619 6:84605429-84605451 TTCCAAATAAAGTCCAGGGATGG - Intergenic
1011307902 6:85949245-85949267 ATCCAAGGCAAGTCCATGGATGG + Intergenic
1011437887 6:87358315-87358337 AAAAAAAAAAAGTCCAGGGGCGG + Intronic
1011459573 6:87589478-87589500 ACCAAAAACAATTCTAGGGTAGG + Intronic
1011526381 6:88269818-88269840 AGCATAAACAAGTGCAGGAAAGG + Intergenic
1012576806 6:100812637-100812659 AACAAAAACAAGGCCAGGAATGG + Intronic
1012945696 6:105463455-105463477 CTCAAAAACAATGCCAGGCACGG - Intergenic
1013042356 6:106448370-106448392 ATCACAGACAGTTCCAGGGACGG - Intergenic
1013069772 6:106717845-106717867 ATCTAATAAAAGTCAAGGGAGGG - Intergenic
1013103426 6:107006648-107006670 TTCAAAAAGAAGGCCAGGCATGG + Intergenic
1013648216 6:112166926-112166948 AACAAAAAACAGTCCTGGGAAGG + Intronic
1013972639 6:116039565-116039587 ATCAGAAACATGTGCAGGGGAGG - Intronic
1014623714 6:123700627-123700649 ATCAAAGACCCATCCAGGGAAGG - Intergenic
1014626036 6:123726562-123726584 ACAAAAAGCAAGTCCAGGCATGG - Intergenic
1015397136 6:132747325-132747347 ATTAAAAACAAGGCCAGGCATGG + Intronic
1015922808 6:138282252-138282274 ATCAGAAACCAGTCTGGGGAGGG - Intronic
1016500387 6:144713928-144713950 AAAAAAAAAAAGTACAGGGAAGG + Intronic
1016721333 6:147302524-147302546 AAGAAAAACAAGGCCAGGCATGG + Intronic
1017239467 6:152150919-152150941 AACAACAACAAGGCCAGGAAGGG + Intronic
1017274549 6:152550898-152550920 ATCACACAGAAGTGCAGGGATGG + Intronic
1017310373 6:152968964-152968986 AACCAAAAAAAGTCCAGGAAGGG - Intergenic
1017784456 6:157743722-157743744 ATCATAAATAAGGCCAGGCATGG + Intronic
1018199390 6:161381180-161381202 GTCAAACACAATACCAGGGATGG - Intronic
1018598192 6:165507108-165507130 ATGAAACACAAGTACAGGGTAGG - Intronic
1020032419 7:4942241-4942263 ATAAAAAATAAGACCAGGCATGG - Intronic
1021189537 7:17603584-17603606 ATAAAAAAAAATTACAGGGAAGG + Intergenic
1021432565 7:20577454-20577476 GTCAAAAACTAGACCATGGATGG + Intergenic
1022935021 7:35166018-35166040 AAAAAAAAAAAGCCCAGGGAAGG - Intergenic
1023911037 7:44556690-44556712 TTAAAAAACAAGGCCAGGCATGG - Intergenic
1025025700 7:55514643-55514665 AGCAACAGTAAGTCCAGGGAAGG + Intronic
1025108493 7:56193005-56193027 AACAAAAACAAAAACAGGGAAGG + Intergenic
1025614031 7:63102689-63102711 GACAAAAACAATTGCAGGGAGGG - Intergenic
1025920766 7:65910004-65910026 GGCAAAAACAAGGCCAGGCACGG - Intronic
1026298553 7:69077614-69077636 CTCAAAAACAAGTCCTTGGATGG + Intergenic
1026534817 7:71230742-71230764 ACCAAAAACACACCCAGGGATGG - Intronic
1026730021 7:72903503-72903525 AGCAAAAGCAAACCCAGGGATGG - Intronic
1026956260 7:74378114-74378136 ACCAAAAAAAAGGCCAGGGATGG - Intronic
1027148635 7:75716510-75716532 AAAAAAAAAAAGTCCAGGCACGG - Intronic
1027201014 7:76063872-76063894 TTCAAAAATGAGTCCAGGGCTGG + Intronic
1027206625 7:76105476-76105498 AACAAAAACCAGGCCAGGCACGG - Intergenic
1027258899 7:76449949-76449971 ATAAAAAATAAGGCCAGGCACGG - Intergenic
1027286568 7:76651163-76651185 ATAAAAAATAAGGCCAGGCACGG + Intergenic
1027328536 7:77066594-77066616 AACAAAAACAAGGCCAGGCGTGG - Intergenic
1027967537 7:85031668-85031690 ATAAGAAACAAGCCCAGCGAAGG - Intronic
1028238404 7:88388527-88388549 AAAGAAAACAAGTCCATGGAAGG + Intergenic
1028431707 7:90754955-90754977 GTCAAAAACAGGTGCTGGGAAGG + Intronic
1028543778 7:91975140-91975162 AACAAAAACAAGGCCAAGCACGG - Intronic
1028585217 7:92445857-92445879 AGCAAAAACAGATGCAGGGAAGG - Intergenic
1028611471 7:92717054-92717076 ATGAAAAACAGGCCCAGGCATGG + Intronic
1028842961 7:95448851-95448873 ATAAATACCAAGTCCAAGGATGG - Intergenic
1029221636 7:98995133-98995155 ACCAAAAACAAGTGAAGGAAGGG - Intronic
1029830971 7:103258784-103258806 AAAAAAAAAAAGCCCAGGGAAGG - Intergenic
1030615916 7:111738222-111738244 TTCAAAACCAAGTTCAGGCAGGG + Intronic
1030947341 7:115740046-115740068 ATAAAAAAAAAATCCAGGCATGG + Intergenic
1032543175 7:132721196-132721218 ATCAAAGCCTAGTCCAGGGCTGG - Intronic
1032962798 7:137059006-137059028 ATCAATAACAAAGCCAGGCATGG + Intergenic
1033394258 7:140958609-140958631 AATAAAAACAAGCCCAGGGAAGG + Intergenic
1035598077 8:877285-877307 AACAAAAACAAGCCCAGGTGTGG - Intergenic
1037043628 8:14270039-14270061 ATAAAAATCAAGTCCAGGTGTGG + Intronic
1037568955 8:20142275-20142297 ATCAACCACACATCCAGGGAAGG + Intergenic
1037771167 8:21800936-21800958 AAAAAAAAGAAGTCCAGTGAGGG + Intronic
1038410961 8:27359636-27359658 AATAAAAACAAATCCAGAGATGG - Intronic
1038496889 8:28009874-28009896 AACAAAAACAAAACTAGGGAGGG - Intergenic
1038779479 8:30557800-30557822 TCCAAAAACATGTCCAGTGATGG + Intronic
1040474235 8:47762956-47762978 ATGTAAAAGAAGTCCAGGGGTGG + Intergenic
1040686379 8:49877741-49877763 ACCAAAAAAAAGTCCAGGACTGG - Intergenic
1041049936 8:53924476-53924498 TTAAAAAACTAGTCCAGGCACGG - Intronic
1042073628 8:64963995-64964017 AACAAAAATAATTCCAGAGATGG + Intergenic
1042274899 8:66994063-66994085 ATCCAAAACTGGTCCAGGGCAGG - Intronic
1042932001 8:74023119-74023141 ACCAAGAACCGGTCCAGGGAAGG - Intronic
1043185202 8:77139449-77139471 ATCAAAAAAAAGTCCCAGGCCGG - Intergenic
1043211946 8:77530890-77530912 AGGAAAAACAATTCCAGGCAAGG + Intergenic
1044465059 8:92493008-92493030 AATAAAAACAAGGCCAGGCATGG + Intergenic
1045807891 8:106186746-106186768 ATGAAAAACATCTCCAGGCAAGG - Intergenic
1046056522 8:109084870-109084892 ATCAAAAACATGCACAAGGATGG - Intergenic
1046160683 8:110359600-110359622 ATCAAAAACAATTTCACGTATGG + Intergenic
1046327832 8:112673094-112673116 ATCAAGAACAACTCCACAGAAGG - Intronic
1046441689 8:114263259-114263281 ATGTAAAACAAGCCCAAGGATGG - Intergenic
1047088074 8:121541867-121541889 ATCAAAAACAAGGCATGGGCTGG - Intergenic
1047489863 8:125365563-125365585 ATAAAATCCAAGTCCAGGCACGG + Intronic
1048080733 8:131123458-131123480 AGAAAAAAAAAGGCCAGGGATGG - Intergenic
1049096861 8:140553697-140553719 CTCAAAAAAAAGGCCAGGCATGG - Intronic
1049518499 8:143075411-143075433 TTCAAAAATAAGGCCAGGCACGG + Intergenic
1049667965 8:143856503-143856525 TTCAAAAACAAGTGGAGGAAAGG - Intergenic
1050321490 9:4457482-4457504 ACCCAAAACAAGTCCACAGAGGG - Intergenic
1050355602 9:4780284-4780306 AACAACAACAAGGCCAGGCACGG - Intergenic
1052483191 9:29058727-29058749 ATGAAAACCAAATACAGGGAAGG + Intergenic
1055444697 9:76371024-76371046 ATCAAAGAAAAGGCCAGGCAAGG + Intergenic
1057166554 9:92931764-92931786 AACAAAACCAAGTCCAGGAAAGG - Intergenic
1057306978 9:93918172-93918194 ATGAAAATCAAGACCTGGGAGGG + Intergenic
1057327484 9:94079118-94079140 AACAAAAACAAGTCCGGGGAGGG - Intronic
1057433256 9:95015112-95015134 ATCAAAACAAAGACCAGGCATGG - Intronic
1057466612 9:95319660-95319682 ATCAAAAGCAAGTCCTGGGTAGG + Intergenic
1058576233 9:106405719-106405741 ATAAAAAACAAGTCTAGTAAAGG + Intergenic
1059144713 9:111888889-111888911 ATTTATAACAATTCCAGGGAGGG - Intergenic
1059201119 9:112417785-112417807 AAAAAAAAAAAGTCCAGGCATGG + Intronic
1059451509 9:114373897-114373919 AAAAAAAAAAAGCCCAGGGAAGG + Intronic
1060397556 9:123326748-123326770 ACCAAAAACAACTGCGGGGAAGG + Intergenic
1061475697 9:130864539-130864561 ATTAAGAAAAAGTCCAGGGCCGG - Intronic
1062227071 9:135458318-135458340 ATTAAAAAAAAGTCCTGGGCCGG - Intergenic
1062257445 9:135634416-135634438 AGGAAAAACAAGGCCAGGCATGG - Intronic
1062519475 9:136951759-136951781 AGCAAGAACAGGACCAGGGAGGG - Intronic
1185944050 X:4354838-4354860 ATCAAGATCAAATCCAGGGCTGG + Intergenic
1186127769 X:6432428-6432450 AGTAAAAACCAGTCAAGGGACGG - Intergenic
1187566754 X:20458075-20458097 ATCAAACACAAATTAAGGGAGGG - Intergenic
1188964042 X:36528624-36528646 AATGAAAAGAAGTCCAGGGATGG + Intergenic
1189047068 X:37604671-37604693 CTCAAAATCAAGAGCAGGGATGG + Intronic
1189275617 X:39783596-39783618 ATAAAAAATAAGGCCAGGCACGG + Intergenic
1189805952 X:44735947-44735969 AACATAAAAAAGTTCAGGGATGG + Intergenic
1190767422 X:53487120-53487142 AACAAAAACAAGGCCAGGTGTGG - Intergenic
1191056933 X:56251749-56251771 ATTAAAAATAAGGCCAGGTACGG - Intronic
1193743632 X:85247709-85247731 ATCAAAAATAAGTTGAGGAAGGG + Intronic
1194029409 X:88793136-88793158 ATCAACAAGAAGTTCAGAGATGG + Intergenic
1194117329 X:89919084-89919106 AACAAAAACAAGGCCAGGCGTGG - Intergenic
1194204777 X:91000187-91000209 ATCTAAAACAATTCCAAGAAAGG + Intergenic
1195574085 X:106430368-106430390 ATCAAAACCAAGTACAGGGTAGG + Intergenic
1195773936 X:108382654-108382676 ATGAAAAACTAGGCCAGGCACGG + Intronic
1196155342 X:112422514-112422536 ATAAAAGATAAGACCAGGGAAGG - Intergenic
1196284027 X:113858792-113858814 ATCAAAAGCAATTGCAGGAAAGG - Intergenic
1196806096 X:119587627-119587649 ATAAAAAACAGGGCCAGGCACGG + Intergenic
1196846516 X:119900521-119900543 ATAAAAAACATGGCCAGGCACGG - Intronic
1197805683 X:130396456-130396478 ATAAAAAAAAAATCCAGGCATGG - Intergenic
1198252074 X:134889690-134889712 ATAAAAAAAAAGTACAGAGAAGG + Intronic
1199930968 X:152521129-152521151 AGCAACAGCAAGCCCAGGGAGGG + Intergenic
1200470119 Y:3576227-3576249 AACAAAAACAAGGCCAGGCGTGG - Intergenic
1200550604 Y:4575332-4575354 ATCTAAAACAATTCCAAGAAAGG + Intergenic
1201162682 Y:11178745-11178767 AGCAATAACAAGTCCATGGCTGG - Intergenic
1201318697 Y:12673591-12673613 AAAAAAAAAAAGTCCTGGGATGG - Intergenic
1201335579 Y:12877400-12877422 ATGAAAAATAAGTGCTGGGAAGG + Intergenic
1202381100 Y:24276973-24276995 GTCAAAAGCAAGGCCTGGGAAGG - Intergenic
1202489685 Y:25393153-25393175 GTCAAAAGCAAGGCCTGGGAAGG + Intergenic